Starting /dee2/code/volunteer_pipeline.sh SRR12161483 current disk space = 3087652737024 free memory = 1582378416 SRR12161483 SRAfilesize c69f12997a17f4b7b9a8d08ef7ae5da9 SRR12161483.sra SRR12161483.sra file validated SRR12161483 is paired end SRR12161483 is conventional basespace SRR12161483 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161483_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.441 37.0 37.0 37.0 37.0 37.0 2 36.2965 37.0 37.0 37.0 37.0 37.0 3 36.434 37.0 37.0 37.0 37.0 37.0 4 36.542 37.0 37.0 37.0 37.0 37.0 5 36.582 37.0 37.0 37.0 37.0 37.0 6 36.473 37.0 37.0 37.0 37.0 37.0 7 36.411 37.0 37.0 37.0 37.0 37.0 8 36.4375 37.0 37.0 37.0 37.0 37.0 9 36.4465 37.0 37.0 37.0 37.0 37.0 10-14 36.5292 37.0 37.0 37.0 37.0 37.0 15-19 36.5242 37.0 37.0 37.0 37.0 37.0 20-24 36.474599999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4156 37.0 37.0 37.0 37.0 37.0 30-34 36.4072 37.0 37.0 37.0 37.0 37.0 35-39 36.3643 37.0 37.0 37.0 37.0 37.0 40-44 36.26950000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.318999999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.2959 37.0 37.0 37.0 37.0 37.0 55-59 36.2517 37.0 37.0 37.0 37.0 37.0 60-64 36.2411 37.0 37.0 37.0 37.0 37.0 65-69 36.1826 37.0 37.0 37.0 37.0 37.0 70-74 36.2211 37.0 37.0 37.0 37.0 37.0 75-79 36.178799999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.186 37.0 37.0 37.0 37.0 37.0 85-89 36.0964 37.0 37.0 37.0 37.0 37.0 90-94 36.0712 37.0 37.0 37.0 37.0 37.0 95-99 36.137800000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.0167 37.0 37.0 37.0 37.0 37.0 105-109 36.061099999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.9166 37.0 37.0 37.0 37.0 37.0 115-119 35.9459 37.0 37.0 37.0 37.0 37.0 120-124 36.0151 37.0 37.0 37.0 37.0 37.0 125-129 35.9053 37.0 37.0 37.0 37.0 37.0 130-134 35.8569 37.0 37.0 37.0 37.0 37.0 135-139 35.7097 37.0 37.0 37.0 37.0 37.0 140-144 35.639799999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.6447 37.0 37.0 37.0 37.0 37.0 150-151 35.4535 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 1.0 26 5.0 27 7.0 28 13.0 29 24.0 30 27.0 31 46.0 32 68.0 33 92.0 34 147.0 35 366.0 36 2887.0 37 315.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.22122122122122 13.263263263263264 6.206206206206207 34.30930930930931 2 20.025000000000002 13.850000000000001 34.675 31.45 3 17.525 19.675 30.15 32.65 4 20.95 27.3 25.5 26.25 5 22.400000000000002 32.0 24.85 20.75 6 19.950000000000003 37.025000000000006 24.525 18.5 7 14.575 27.575 41.575 16.275000000000002 8 17.424999999999997 27.400000000000002 31.0 24.175 9 17.25 24.2 34.325 24.224999999999998 10-14 19.06 29.585 27.72 23.635 15-19 19.805 28.915000000000003 27.639999999999997 23.64 20-24 19.73 28.849999999999998 27.889999999999997 23.53 25-29 19.12 29.385 27.595 23.9 30-34 19.66 29.69 27.589999999999996 23.06 35-39 19.97 28.685 27.560000000000002 23.785 40-44 19.6 28.799999999999997 28.54 23.06 45-49 18.96 28.975 28.044999999999998 24.02 50-54 20.015 28.860000000000003 27.98 23.145 55-59 19.43 28.810000000000002 28.345 23.415 60-64 20.085 29.244999999999997 27.339999999999996 23.330000000000002 65-69 20.025000000000002 28.884999999999998 27.694999999999997 23.395 70-74 20.244999999999997 29.099999999999998 27.525 23.13 75-79 20.18 28.355000000000004 27.62 23.845 80-84 20.48 28.77 27.485 23.265 85-89 19.56 28.884999999999998 28.105000000000004 23.45 90-94 19.63 28.64 28.21 23.52 95-99 19.759999999999998 28.599999999999998 27.58 24.060000000000002 100-104 19.78 29.044999999999998 27.925 23.25 105-109 20.580000000000002 28.53 27.73 23.16 110-114 20.055 28.255000000000003 27.785 23.905 115-119 20.695 28.194999999999997 27.644999999999996 23.465 120-124 20.51 28.595 26.924999999999997 23.97 125-129 19.900000000000002 28.360000000000003 27.694999999999997 24.044999999999998 130-134 20.125 28.449999999999996 27.485 23.94 135-139 20.07 28.720000000000002 27.305 23.905 140-144 21.0 27.944999999999997 27.334999999999997 23.72 145-149 20.775 28.205000000000002 26.63 24.39 150-151 20.575 28.675 27.05 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.0 24 2.0 25 3.0 26 3.0 27 7.0 28 8.5 29 10.0 30 17.5 31 26.0 32 36.5 33 44.5 34 57.0 35 72.0 36 87.5 37 111.0 38 140.5 39 172.5 40 202.0 41 239.0 42 255.0 43 274.0 44 284.0 45 289.5 46 292.0 47 249.0 48 219.5 49 198.5 50 172.5 51 142.5 52 114.5 53 87.5 54 57.5 55 40.0 56 30.5 57 21.5 58 12.5 59 6.0 60 1.5 61 0.5 62 1.5 63 1.5 64 0.0 65 0.5 66 1.0 67 0.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.025 #Duplication Level Percentage of deduplicated Percentage of total 1 95.1854775059195 90.45 2 4.393580636674559 8.35 3 0.4209418574059458 1.2 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.8500000000000001 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.3375 0.0 0.0 0.0 0.0 116-117 2.7874999999999996 0.0 0.0 0.0 0.0 118-119 3.0875 0.0 0.0 0.0 0.0 120-121 3.3499999999999996 0.0 0.0 0.0 0.0 122-123 3.575 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.375 0.0 0.0 0.0 0.0 128-129 5.0125 0.0 0.0 0.0 0.0 130-131 5.4375 0.0 0.0 0.0 0.0 132-133 5.775 0.0 0.0 0.0 0.0 134-135 6.3125 0.0 0.0 0.0 0.0 136-137 6.6625 0.0 0.0 0.0 0.0 138-139 7.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12161483 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161483_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.225 37.0 37.0 37.0 37.0 37.0 2 35.898 37.0 37.0 37.0 37.0 37.0 3 36.083 37.0 37.0 37.0 37.0 37.0 4 36.111 37.0 37.0 37.0 37.0 37.0 5 36.0765 37.0 37.0 37.0 37.0 37.0 6 36.0785 37.0 37.0 37.0 37.0 37.0 7 36.101 37.0 37.0 37.0 37.0 37.0 8 36.128 37.0 37.0 37.0 37.0 37.0 9 36.1375 37.0 37.0 37.0 37.0 37.0 10-14 36.0885 37.0 37.0 37.0 37.0 37.0 15-19 36.099599999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.0081 37.0 37.0 37.0 37.0 37.0 25-29 35.9404 37.0 37.0 37.0 37.0 37.0 30-34 35.9478 37.0 37.0 37.0 37.0 37.0 35-39 35.8799 37.0 37.0 37.0 37.0 37.0 40-44 35.863099999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.842999999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.8153 37.0 37.0 37.0 37.0 37.0 55-59 35.7647 37.0 37.0 37.0 37.0 37.0 60-64 35.762299999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.7703 37.0 37.0 37.0 37.0 37.0 70-74 35.652 37.0 37.0 37.0 37.0 37.0 75-79 35.6819 37.0 37.0 37.0 37.0 37.0 80-84 35.664100000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.6629 37.0 37.0 37.0 37.0 37.0 90-94 35.637299999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.5951 37.0 37.0 37.0 37.0 37.0 100-104 35.6075 37.0 37.0 37.0 37.0 37.0 105-109 35.5431 37.0 37.0 37.0 37.0 37.0 110-114 35.4885 37.0 37.0 37.0 37.0 37.0 115-119 35.4777 37.0 37.0 37.0 37.0 37.0 120-124 35.4195 37.0 37.0 37.0 37.0 37.0 125-129 35.3865 37.0 37.0 37.0 37.0 37.0 130-134 35.2737 37.0 37.0 37.0 32.2 37.0 135-139 35.2374 37.0 37.0 37.0 32.2 37.0 140-144 35.2401 37.0 37.0 37.0 34.6 37.0 145-149 35.147299999999994 37.0 37.0 37.0 27.4 37.0 150-151 34.678 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 6.0 15 3.0 16 2.0 17 4.0 18 1.0 19 2.0 20 4.0 21 10.0 22 8.0 23 10.0 24 4.0 25 14.0 26 14.0 27 9.0 28 18.0 29 22.0 30 33.0 31 44.0 32 76.0 33 101.0 34 195.0 35 590.0 36 2594.0 37 230.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.5 23.325000000000003 9.575 22.6 2 27.224999999999998 25.575 30.375000000000004 16.825000000000003 3 21.4 27.175 33.025 18.4 4 24.3 33.825 23.200000000000003 18.675 5 25.15 36.8 21.625 16.425 6 20.45 39.0 23.200000000000003 17.349999999999998 7 20.825 23.150000000000002 37.85 18.175 8 21.224999999999998 26.5 28.449999999999996 23.825 9 22.525000000000002 24.8 28.975 23.7 10-14 23.96 29.080000000000002 26.195 20.765 15-19 23.215 28.54 27.46 20.785 20-24 23.355 29.020000000000003 27.095000000000002 20.53 25-29 23.855 28.58 27.445000000000004 20.119999999999997 30-34 23.13 27.88 28.349999999999998 20.64 35-39 23.405 28.015 28.095 20.485 40-44 22.689999999999998 29.17 27.584999999999997 20.555 45-49 23.724999999999998 27.975 27.985 20.315 50-54 23.48 28.395 28.03 20.095 55-59 23.294999999999998 28.754999999999995 27.805000000000003 20.145 60-64 23.505000000000003 28.585 27.975 19.935 65-69 23.455000000000002 29.145 27.935 19.465 70-74 24.04 28.410000000000004 27.884999999999998 19.665 75-79 23.494999999999997 28.299999999999997 28.575 19.63 80-84 23.849999999999998 28.610000000000003 27.68 19.86 85-89 23.855 28.675 27.55 19.919999999999998 90-94 23.72 28.599999999999998 27.939999999999998 19.74 95-99 23.925 28.77 27.13 20.175 100-104 24.41 28.360000000000003 27.62 19.61 105-109 24.255 27.800000000000004 27.88 20.064999999999998 110-114 24.245 28.634999999999998 27.955000000000002 19.165 115-119 24.48 28.575 27.474999999999998 19.470000000000002 120-124 24.77 28.694999999999997 27.034999999999997 19.5 125-129 24.87 28.499999999999996 27.065 19.564999999999998 130-134 24.86 28.53 27.36 19.25 135-139 24.72 28.58 27.529999999999998 19.17 140-144 25.245 28.935 26.96 18.86 145-149 25.779999999999998 27.91 27.310000000000002 19.0 150-151 26.2125 27.975 26.8375 18.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.5 5 0.5 6 1.0 7 1.5 8 0.5 9 1.0 10 1.5 11 0.5 12 0.0 13 0.5 14 2.0 15 2.0 16 1.5 17 2.0 18 1.5 19 1.5 20 1.0 21 0.0 22 1.0 23 2.5 24 2.0 25 1.5 26 1.5 27 4.5 28 10.0 29 11.5 30 12.0 31 17.5 32 19.5 33 25.0 34 42.5 35 59.0 36 79.5 37 124.5 38 156.5 39 170.0 40 213.0 41 247.0 42 259.5 43 289.5 44 303.0 45 293.5 46 278.0 47 246.0 48 226.5 49 208.5 50 173.0 51 132.0 52 95.0 53 75.0 54 56.5 55 37.0 56 25.5 57 19.0 58 13.0 59 9.0 60 6.5 61 3.0 62 4.0 63 3.0 64 0.5 65 0.0 66 0.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 1.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 2.0 90 2.0 91 1.0 92 1.0 93 1.0 94 1.5 95 1.0 96 0.5 97 0.5 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.875 #Duplication Level Percentage of deduplicated Percentage of total 1 95.30961791831358 90.425 2 4.216073781291173 8.0 3 0.42160737812911725 1.2 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.026350461133069828 0.17500000000000002 8 0.026350461133069828 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.8500000000000001 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.7999999999999998 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.8125 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.6 0.0 0.0 0.0 0.0 124-125 3.975 0.0 0.0 0.0 0.0 126-127 4.4 0.0 0.0 0.0 0.0 128-129 5.0375 0.0 0.0 0.0 0.0 130-131 5.4625 0.0 0.0 0.0 0.0 132-133 5.800000000000001 0.0 0.0 0.0 0.0 134-135 6.324999999999999 0.0 0.0 0.0 0.0 136-137 6.6875 0.0 0.0 0.0 0.0 138-139 7.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTGGA 10 0.006830828 145.0 145 GACTCAA 10 0.006830828 145.0 5 >>END_MODULE Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538642 spots for SRR12161483.sra Written 1538642 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra Read 1538637 spots for SRR12161483.sra Written 1538637 spots for SRR12161483.sra SRR ids: ['SRR12161483.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ak2iaxwk SRR12161483.sra spots: 30772745 blocks: [[1, 1538637], [1538638, 3077274], [3077275, 4615911], [4615912, 6154548], [6154549, 7693185], [7693186, 9231822], [9231823, 10770459], [10770460, 12309096], [12309097, 13847733], [13847734, 15386370], [15386371, 16925007], [16925008, 18463644], [18463645, 20002281], [20002282, 21540918], [21540919, 23079555], [23079556, 24618192], [24618193, 26156829], [26156830, 27695466], [27695467, 29234103], [29234104, 30772745]] SRR12161483 file size 10436224 SRR12161483 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161483 SRR12161483_1.fastq SRR12161483_2.fastq Input file: SRR12161483_1.fastq Paired file: SRR12161483_2.fastq trimmed: SRR12161483-trimmed-pair1.fastq, SRR12161483-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:57:13 2025 >> started Thu Feb 13 18:57:45 2025 >> done (31.897s) 30772745 read pairs processed; of these: 88 ( 0.00%) short read pairs filtered out after trimming by size control 15019 ( 0.05%) empty read pairs filtered out after trimming by size control 30757638 (99.95%) read pairs available; of these: 3404918 (11.07%) trimmed read pairs available after processing 27352720 (88.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 10 0.00% 21 11 0.00% 22 22 0.00% 23 20 0.00% 24 25 0.00% 25 20 0.00% 26 32 0.00% 27 41 0.00% 28 36 0.00% 29 40 0.00% 30 41 0.00% 31 31 0.00% 32 32 0.00% 33 30 0.00% 34 51 0.00% 35 47 0.00% 36 52 0.00% 37 52 0.00% 38 52 0.00% 39 54 0.00% 40 70 0.00% 41 61 0.00% 42 61 0.00% 43 61 0.00% 44 54 0.00% 45 80 0.00% 46 99 0.00% 47 89 0.00% 48 88 0.00% 49 121 0.00% 50 141 0.00% 51 134 0.00% 52 159 0.00% 53 167 0.00% 54 167 0.00% 55 190 0.00% 56 234 0.00% 57 247 0.00% 58 287 0.00% 59 324 0.00% 60 338 0.00% 61 418 0.00% 62 435 0.00% 63 563 0.00% 64 546 0.00% 65 599 0.00% 66 674 0.00% 67 762 0.00% 68 878 0.00% 69 972 0.00% 70 1125 0.00% 71 1246 0.00% 72 1462 0.00% 73 1768 0.01% 74 1769 0.01% 75 2011 0.01% 76 2220 0.01% 77 2407 0.01% 78 2741 0.01% 79 3155 0.01% 80 3642 0.01% 81 4058 0.01% 82 4629 0.02% 83 5342 0.02% 84 5992 0.02% 85 6699 0.02% 86 6998 0.02% 87 7544 0.02% 88 8167 0.03% 89 8992 0.03% 90 9851 0.03% 91 11133 0.04% 92 12562 0.04% 93 13824 0.04% 94 14775 0.05% 95 16381 0.05% 96 16795 0.05% 97 17946 0.06% 98 19055 0.06% 99 19877 0.06% 100 21608 0.07% 101 22794 0.07% 102 25312 0.08% 103 26931 0.09% 104 28829 0.09% 105 30508 0.10% 106 31428 0.10% 107 32721 0.11% 108 33795 0.11% 109 35202 0.11% 110 36516 0.12% 111 38537 0.13% 112 40448 0.13% 113 42636 0.14% 114 45319 0.15% 115 47298 0.15% 116 48469 0.16% 117 49475 0.16% 118 50343 0.16% 119 51202 0.17% 120 53340 0.17% 121 55031 0.18% 122 56906 0.19% 123 60002 0.20% 124 62771 0.20% 125 64001 0.21% 126 65589 0.21% 127 67037 0.22% 128 67809 0.22% 129 68327 0.22% 130 69565 0.23% 131 70155 0.23% 132 73047 0.24% 133 76279 0.25% 134 78498 0.26% 135 81031 0.26% 136 82052 0.27% 137 82663 0.27% 138 82972 0.27% 139 83908 0.27% 140 84880 0.28% 141 86516 0.28% 142 87926 0.29% 143 90108 0.29% 144 93095 0.30% 145 94903 0.31% 146 95426 0.31% 147 96423 0.31% 148 96804 0.31% 149 96738 0.31% 150 97848 0.32% 151 27352720 88.93% 30757638 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=39 prefix-density=0.20 prefix-fanout=2.0 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=492.09 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=34.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.67 fanout-score-rank=22 prefix-density=0.32 prefix-fanout=3.6 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=8 fanout-score=264.50 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=29.1 sequence=GAAGAAGAAGAAA SRR12161483 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:58:30 Started mapping on | Feb 13 18:58:30 Finished on | Feb 13 19:01:22 Mapping speed, Million of reads per hour | 643.76 Number of input reads | 30757638 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 28834460 Uniquely mapped reads % | 93.75% Average mapped length | 295.41 Number of splices: Total | 30879703 Number of splices: Annotated (sjdb) | 30275094 Number of splices: GT/AG | 30383788 Number of splices: GC/AG | 397958 Number of splices: AT/AC | 26098 Number of splices: Non-canonical | 71859 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 683633 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 38977 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.70% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1239545 1239545 1239545 N_multimapping 683633 683633 683633 N_noFeature 798657 28561990 935455 N_ambiguous 299444 1504 162872 UnstrandedReadsAssigned:27736359 PositiveStrandReadsAssigned:270966 NegativeStrandReadsAssigned:27736133 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161483 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161483-trimmed-pair1.fastq SRR12161483-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,757,638 reads, 27,800,287 reads pseudoaligned [quant] estimated average fragment length: 252.278 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52401 SRR12161483.ke.tsv 34699 SRR12161483.se.tsv 87100 total ==> SRR12161483.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.72 1808 36.7041 Potri.005G024800.1.v4.1 1035 783.722 280 12.8139 Potri.004G059700.1.v4.1 961 709.928 142 7.17395 Potri.007G009000.2.v4.1 1416 1164.72 0 0 Potri.003G141000.2.v4.1 2943 2691.72 761 10.14 Potri.016G087400.1.v4.1 270 86.2969 1913.01 795.071 Potri.015G069301.1.v4.1 564 326.483 0 0 Potri.010G195200.1.v4.1 1773 1521.72 111.013 2.61651 Potri.012G127500.1.v4.1 977 725.811 4858 240.059 ==> SRR12161483.se.tsv <== Potri.001G166300.v4.1 5 Potri.001G448400.v4.1 71 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 521 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 207 SRR12161483 completed mapping pipeline successfully