Starting /dee2/code/volunteer_pipeline.sh SRR12161484 current disk space = 3088910237696 free memory = 1449953176 SRR12161484 SRAfilesize bf1045c45d93524d3d5594fbcd52ccbf SRR12161484.sra SRR12161484.sra file validated SRR12161484 is paired end SRR12161484 is conventional basespace SRR12161484 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161484_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5015 37.0 37.0 37.0 37.0 37.0 2 36.344 37.0 37.0 37.0 37.0 37.0 3 36.472 37.0 37.0 37.0 37.0 37.0 4 36.461 37.0 37.0 37.0 37.0 37.0 5 36.582 37.0 37.0 37.0 37.0 37.0 6 36.5375 37.0 37.0 37.0 37.0 37.0 7 36.4285 37.0 37.0 37.0 37.0 37.0 8 36.528 37.0 37.0 37.0 37.0 37.0 9 36.443 37.0 37.0 37.0 37.0 37.0 10-14 36.525800000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.525400000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.474399999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.339000000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.3611 37.0 37.0 37.0 37.0 37.0 35-39 36.3275 37.0 37.0 37.0 37.0 37.0 40-44 36.2908 37.0 37.0 37.0 37.0 37.0 45-49 36.303700000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.2688 37.0 37.0 37.0 37.0 37.0 55-59 36.2062 37.0 37.0 37.0 37.0 37.0 60-64 36.174400000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.1982 37.0 37.0 37.0 37.0 37.0 70-74 36.150400000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.159000000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.1395 37.0 37.0 37.0 37.0 37.0 85-89 36.1643 37.0 37.0 37.0 37.0 37.0 90-94 36.0818 37.0 37.0 37.0 37.0 37.0 95-99 36.126099999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.0758 37.0 37.0 37.0 37.0 37.0 105-109 35.9507 37.0 37.0 37.0 37.0 37.0 110-114 35.9267 37.0 37.0 37.0 37.0 37.0 115-119 36.0174 37.0 37.0 37.0 37.0 37.0 120-124 36.0346 37.0 37.0 37.0 37.0 37.0 125-129 35.880900000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.8673 37.0 37.0 37.0 37.0 37.0 135-139 35.789100000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.782000000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.782399999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.494749999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 3.0 24 0.0 25 3.0 26 2.0 27 13.0 28 24.0 29 15.0 30 37.0 31 31.0 32 49.0 33 94.0 34 128.0 35 362.0 36 2933.0 37 303.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.31797696544817 11.917876815222835 6.134201301952929 36.629944917376065 2 19.475 12.525 34.775 33.225 3 17.2 15.85 29.099999999999998 37.85 4 21.15 24.25 24.825 29.775000000000002 5 22.425 30.625000000000004 24.625 22.325 6 20.9 33.6 23.25 22.25 7 15.35 28.375 40.150000000000006 16.125 8 17.125 27.425 31.55 23.9 9 16.925 24.349999999999998 35.099999999999994 23.625 10-14 20.09 29.645 27.395000000000003 22.869999999999997 15-19 19.384999999999998 28.33 28.505000000000003 23.78 20-24 19.38 28.71 28.17 23.74 25-29 19.794999999999998 28.77 27.634999999999998 23.799999999999997 30-34 19.195 27.994999999999997 28.720000000000002 24.09 35-39 19.68 28.01 28.799999999999997 23.51 40-44 19.12 28.599999999999998 28.405 23.875 45-49 19.72 28.244999999999997 28.015 24.02 50-54 20.21 28.46 27.189999999999998 24.14 55-59 20.055 27.915 28.294999999999998 23.735 60-64 19.52 28.939999999999998 28.000000000000004 23.54 65-69 20.075000000000003 28.82 27.925 23.18 70-74 19.665 28.384999999999998 27.915 24.035 75-79 19.955000000000002 28.294999999999998 27.91 23.84 80-84 20.145 28.37 28.425 23.06 85-89 19.939999999999998 28.560000000000002 28.110000000000003 23.39 90-94 20.06 28.365000000000002 28.084999999999997 23.49 95-99 20.044999999999998 28.405 28.315 23.235 100-104 20.39 28.849999999999998 27.339999999999996 23.419999999999998 105-109 20.445 28.075 28.04 23.44 110-114 20.255000000000003 28.355000000000004 27.87 23.52 115-119 20.355 27.92 28.134999999999998 23.59 120-124 20.75 28.49 27.115000000000002 23.645 125-129 20.32 29.049999999999997 27.29 23.34 130-134 20.89 28.99 26.650000000000002 23.47 135-139 20.47 28.410000000000004 27.495000000000005 23.625 140-144 21.025 28.299999999999997 27.200000000000003 23.474999999999998 145-149 21.25 28.405 27.1 23.244999999999997 150-151 21.6 27.700000000000003 27.224999999999998 23.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 1.0 25 0.5 26 1.5 27 1.0 28 3.0 29 7.5 30 15.0 31 22.0 32 29.0 33 44.0 34 54.5 35 66.5 36 77.5 37 94.0 38 131.5 39 175.5 40 214.0 41 235.5 42 245.5 43 273.0 44 301.0 45 291.5 46 280.5 47 272.5 48 236.5 49 203.0 50 182.0 51 148.5 52 104.0 53 78.5 54 60.5 55 38.5 56 28.0 57 23.5 58 19.0 59 10.5 60 6.0 61 4.5 62 2.0 63 0.5 64 0.5 65 1.0 66 0.5 67 2.0 68 2.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.35189075630252 90.77499999999999 2 4.385504201680672 8.35 3 0.21008403361344538 0.6 4 0.026260504201680673 0.1 5 0.0 0.0 6 0.0 0.0 7 0.026260504201680673 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTTCTTGATCGCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 21 (97% over 38bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1625 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.9625 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.525 0.0 0.0 0.0 0.0 116-117 1.675 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.2750000000000004 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.4000000000000004 0.0 0.0 0.0 0.0 130-131 3.7249999999999996 0.0 0.0 0.0 0.0 132-133 4.0375 0.0 0.0 0.0 0.0 134-135 4.612500000000001 0.0 0.0 0.0 0.0 136-137 5.074999999999999 0.0 0.0 0.0 0.0 138-139 5.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTCTC 10 0.006830828 145.0 8 ATTCTCT 10 0.006830828 145.0 7 >>END_MODULE SRR12161484 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161484_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.375 37.0 37.0 37.0 37.0 37.0 2 36.1595 37.0 37.0 37.0 37.0 37.0 3 36.1655 37.0 37.0 37.0 37.0 37.0 4 36.2395 37.0 37.0 37.0 37.0 37.0 5 36.295 37.0 37.0 37.0 37.0 37.0 6 36.2275 37.0 37.0 37.0 37.0 37.0 7 36.2525 37.0 37.0 37.0 37.0 37.0 8 36.225 37.0 37.0 37.0 37.0 37.0 9 36.1195 37.0 37.0 37.0 37.0 37.0 10-14 36.254 37.0 37.0 37.0 37.0 37.0 15-19 36.2208 37.0 37.0 37.0 37.0 37.0 20-24 36.2232 37.0 37.0 37.0 37.0 37.0 25-29 36.1453 37.0 37.0 37.0 37.0 37.0 30-34 36.102999999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.0724 37.0 37.0 37.0 37.0 37.0 40-44 36.05310000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.069399999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.005 37.0 37.0 37.0 37.0 37.0 55-59 36.016999999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.9575 37.0 37.0 37.0 37.0 37.0 65-69 35.8604 37.0 37.0 37.0 37.0 37.0 70-74 35.8639 37.0 37.0 37.0 37.0 37.0 75-79 35.8476 37.0 37.0 37.0 37.0 37.0 80-84 35.84609999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.8076 37.0 37.0 37.0 37.0 37.0 90-94 35.7549 37.0 37.0 37.0 37.0 37.0 95-99 35.7673 37.0 37.0 37.0 37.0 37.0 100-104 35.7331 37.0 37.0 37.0 37.0 37.0 105-109 35.714800000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.6567 37.0 37.0 37.0 37.0 37.0 115-119 35.6905 37.0 37.0 37.0 37.0 37.0 120-124 35.607299999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.6135 37.0 37.0 37.0 37.0 37.0 130-134 35.5437 37.0 37.0 37.0 37.0 37.0 135-139 35.4449 37.0 37.0 37.0 37.0 37.0 140-144 35.33669999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.3077 37.0 37.0 37.0 34.6 37.0 150-151 34.975750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 0.0 16 2.0 17 1.0 18 2.0 19 2.0 20 3.0 21 4.0 22 8.0 23 3.0 24 11.0 25 6.0 26 8.0 27 12.0 28 21.0 29 22.0 30 16.0 31 38.0 32 58.0 33 107.0 34 200.0 35 564.0 36 2647.0 37 260.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.925000000000004 25.025 9.825000000000001 23.225 2 28.275 27.05 28.199999999999996 16.475 3 20.674999999999997 28.875 31.8 18.65 4 23.150000000000002 34.375 23.849999999999998 18.625 5 23.775 37.65 21.65 16.925 6 20.974999999999998 39.85 21.675 17.5 7 19.0 22.875 39.175 18.95 8 21.25 26.85 28.000000000000004 23.9 9 21.55 25.1 29.45 23.9 10-14 23.585 29.555 26.265 20.595 15-19 22.93 28.499999999999996 27.47 21.099999999999998 20-24 22.57 28.515 27.965 20.95 25-29 23.015 27.845 28.425 20.715 30-34 22.79 28.854999999999997 27.944999999999997 20.41 35-39 22.994999999999997 27.985 28.15 20.87 40-44 23.165 28.38 27.775 20.68 45-49 23.075000000000003 28.395 28.285 20.244999999999997 50-54 23.119999999999997 28.54 27.54 20.8 55-59 23.82 28.415000000000003 27.73 20.035 60-64 23.375 28.355000000000004 28.265 20.005 65-69 23.23 28.595 27.860000000000003 20.315 70-74 24.0 28.134999999999998 28.005000000000003 19.86 75-79 22.925 28.965000000000003 28.444999999999997 19.665 80-84 24.205 27.439999999999998 28.505000000000003 19.85 85-89 24.075 27.650000000000002 28.194999999999997 20.080000000000002 90-94 23.915 28.845 27.655 19.585 95-99 23.799999999999997 28.050000000000004 27.82 20.330000000000002 100-104 23.715 28.375 27.955000000000002 19.955000000000002 105-109 23.885 27.91 28.09 20.115 110-114 24.404999999999998 28.499999999999996 27.450000000000003 19.645000000000003 115-119 24.25 28.535 27.334999999999997 19.88 120-124 24.445 27.825 27.634999999999998 20.095 125-129 24.485 28.799999999999997 26.834999999999997 19.88 130-134 24.795 28.345 27.37 19.49 135-139 25.019999999999996 28.325 27.405 19.25 140-144 25.305 28.12 27.12 19.455 145-149 25.205 28.549999999999997 27.26 18.985 150-151 26.474999999999998 28.012500000000003 26.875 18.637500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.5 20 1.5 21 2.0 22 1.5 23 1.5 24 3.5 25 3.0 26 1.0 27 4.0 28 7.0 29 9.0 30 12.0 31 17.0 32 27.5 33 41.0 34 45.5 35 60.0 36 85.5 37 117.5 38 151.0 39 179.0 40 219.0 41 254.5 42 268.5 43 284.0 44 295.0 45 292.5 46 275.5 47 246.5 48 229.5 49 197.5 50 164.5 51 127.0 52 94.0 53 82.5 54 63.5 55 42.0 56 25.5 57 17.5 58 9.0 59 3.0 60 4.5 61 4.0 62 2.0 63 2.0 64 1.5 65 0.5 66 0.5 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.5 95 1.0 96 0.5 97 0.0 98 1.0 99 2.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.15 #Duplication Level Percentage of deduplicated Percentage of total 1 95.40199684708355 90.77499999999999 2 4.230162900683132 8.05 3 0.2890173410404624 0.8250000000000001 4 0.05254860746190226 0.2 5 0.0 0.0 6 0.02627430373095113 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1625 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.8500000000000001 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.4000000000000004 0.0 0.0 0.0 0.0 122-123 2.6625 0.0 0.0 0.0 0.0 124-125 2.8375 0.0 0.0 0.0 0.0 126-127 3.1625 0.0 0.0 0.0 0.0 128-129 3.55 0.0 0.0 0.0 0.0 130-131 3.8875 0.0 0.0 0.0 0.0 132-133 4.1875 0.0 0.0 0.0 0.0 134-135 4.7875 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAATTG 10 0.006830828 145.0 7 >>END_MODULE Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804433 spots for SRR12161484.sra Written 1804433 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra Read 1804420 spots for SRR12161484.sra Written 1804420 spots for SRR12161484.sra SRR ids: ['SRR12161484.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qh2hbr87 SRR12161484.sra spots: 36088413 blocks: [[1, 1804420], [1804421, 3608840], [3608841, 5413260], [5413261, 7217680], [7217681, 9022100], [9022101, 10826520], [10826521, 12630940], [12630941, 14435360], [14435361, 16239780], [16239781, 18044200], [18044201, 19848620], [19848621, 21653040], [21653041, 23457460], [23457461, 25261880], [25261881, 27066300], [27066301, 28870720], [28870721, 30675140], [30675141, 32479560], [32479561, 34283980], [34283981, 36088413]] SRR12161484 file size 12242721 SRR12161484 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161484 SRR12161484_1.fastq SRR12161484_2.fastq Input file: SRR12161484_1.fastq Paired file: SRR12161484_2.fastq trimmed: SRR12161484-trimmed-pair1.fastq, SRR12161484-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:39:47 2025 >> started Fri Feb 14 01:40:38 2025 >> done (51.591s) 36088413 read pairs processed; of these: 70 ( 0.00%) short read pairs filtered out after trimming by size control 53790 ( 0.15%) empty read pairs filtered out after trimming by size control 36034553 (99.85%) read pairs available; of these: 2816461 ( 7.82%) trimmed read pairs available after processing 33218092 (92.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 11 0.00% 20 11 0.00% 21 20 0.00% 22 18 0.00% 23 14 0.00% 24 21 0.00% 25 21 0.00% 26 17 0.00% 27 29 0.00% 28 31 0.00% 29 31 0.00% 30 36 0.00% 31 38 0.00% 32 36 0.00% 33 27 0.00% 34 32 0.00% 35 33 0.00% 36 33 0.00% 37 50 0.00% 38 46 0.00% 39 46 0.00% 40 49 0.00% 41 55 0.00% 42 40 0.00% 43 63 0.00% 44 48 0.00% 45 71 0.00% 46 59 0.00% 47 61 0.00% 48 76 0.00% 49 79 0.00% 50 80 0.00% 51 106 0.00% 52 104 0.00% 53 126 0.00% 54 112 0.00% 55 98 0.00% 56 160 0.00% 57 165 0.00% 58 162 0.00% 59 221 0.00% 60 262 0.00% 61 223 0.00% 62 298 0.00% 63 328 0.00% 64 365 0.00% 65 359 0.00% 66 371 0.00% 67 411 0.00% 68 489 0.00% 69 562 0.00% 70 636 0.00% 71 723 0.00% 72 837 0.00% 73 968 0.00% 74 1063 0.00% 75 1163 0.00% 76 1279 0.00% 77 1393 0.00% 78 1645 0.00% 79 1801 0.00% 80 2060 0.01% 81 2320 0.01% 82 2663 0.01% 83 2892 0.01% 84 3479 0.01% 85 3775 0.01% 86 4153 0.01% 87 4624 0.01% 88 4869 0.01% 89 5415 0.02% 90 6133 0.02% 91 6832 0.02% 92 7475 0.02% 93 8497 0.02% 94 9202 0.03% 95 9988 0.03% 96 10649 0.03% 97 11447 0.03% 98 12040 0.03% 99 12995 0.04% 100 14302 0.04% 101 15177 0.04% 102 16491 0.05% 103 17950 0.05% 104 19380 0.05% 105 20512 0.06% 106 21455 0.06% 107 22673 0.06% 108 23799 0.07% 109 24880 0.07% 110 26396 0.07% 111 28172 0.08% 112 29643 0.08% 113 31142 0.09% 114 32633 0.09% 115 34687 0.10% 116 35773 0.10% 117 37504 0.10% 118 38601 0.11% 119 40018 0.11% 120 41802 0.12% 121 43519 0.12% 122 45319 0.13% 123 47441 0.13% 124 49748 0.14% 125 51191 0.14% 126 53297 0.15% 127 54473 0.15% 128 56109 0.16% 129 56887 0.16% 130 58858 0.16% 131 60135 0.17% 132 63196 0.18% 133 65309 0.18% 134 67272 0.19% 135 69601 0.19% 136 71333 0.20% 137 72712 0.20% 138 74623 0.21% 139 75679 0.21% 140 77293 0.21% 141 79009 0.22% 142 81347 0.23% 143 84032 0.23% 144 86194 0.24% 145 88679 0.25% 146 89495 0.25% 147 90970 0.25% 148 91939 0.26% 149 93009 0.26% 150 95576 0.27% 151 33218092 92.18% 36034553 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=34 prefix-density=0.20 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=441.91 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=35.6 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.87 fanout-score-rank=20 prefix-density=0.41 prefix-fanout=3.4 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=313.67 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=31.4 sequence=GAAGAAGAAGAAA SRR12161484 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:41:21 Started mapping on | Feb 14 01:41:21 Finished on | Feb 14 01:45:24 Mapping speed, Million of reads per hour | 533.85 Number of input reads | 36034553 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 34227863 Uniquely mapped reads % | 94.99% Average mapped length | 297.50 Number of splices: Total | 35982154 Number of splices: Annotated (sjdb) | 35258073 Number of splices: GT/AG | 35406866 Number of splices: GC/AG | 457881 Number of splices: AT/AC | 29960 Number of splices: Non-canonical | 87447 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 812157 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 62874 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.47% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 994533 994533 994533 N_multimapping 812157 812157 812157 N_noFeature 939291 33922167 1093622 N_ambiguous 337696 1677 185259 UnstrandedReadsAssigned:32950876 PositiveStrandReadsAssigned:304019 NegativeStrandReadsAssigned:32948982 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161484 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161484-trimmed-pair1.fastq SRR12161484-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,034,553 reads, 32,873,388 reads pseudoaligned [quant] estimated average fragment length: 259.579 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR12161484.ke.tsv 34699 SRR12161484.se.tsv 87100 total ==> SRR12161484.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.42 1943 35.2308 Potri.005G024800.1.v4.1 1035 776.421 313 12.8608 Potri.004G059700.1.v4.1 961 702.574 161 7.31061 Potri.007G009000.2.v4.1 1416 1157.42 0 0 Potri.003G141000.2.v4.1 2943 2684.42 1311.28 15.5835 Potri.016G087400.1.v4.1 270 78.1756 1755 716.186 Potri.015G069301.1.v4.1 564 316.237 0 0 Potri.010G195200.1.v4.1 1773 1514.42 142 2.99131 Potri.012G127500.1.v4.1 977 718.495 3491 155.005 ==> SRR12161484.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 50 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 662 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 242 SRR12161484 completed mapping pipeline successfully