Starting /dee2/code/volunteer_pipeline.sh SRR12161485 current disk space = 3088261791744 free memory = 1450011852 SRR12161485 SRAfilesize f42f8055248cdec4bd4f2d07a5a61226 SRR12161485.sra SRR12161485.sra file validated SRR12161485 is paired end SRR12161485 is conventional basespace SRR12161485 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161485_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3655 37.0 37.0 37.0 37.0 37.0 2 36.2635 37.0 37.0 37.0 37.0 37.0 3 36.4875 37.0 37.0 37.0 37.0 37.0 4 36.533 37.0 37.0 37.0 37.0 37.0 5 36.5645 37.0 37.0 37.0 37.0 37.0 6 36.5015 37.0 37.0 37.0 37.0 37.0 7 36.3705 37.0 37.0 37.0 37.0 37.0 8 36.508 37.0 37.0 37.0 37.0 37.0 9 36.508 37.0 37.0 37.0 37.0 37.0 10-14 36.520500000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.4988 37.0 37.0 37.0 37.0 37.0 20-24 36.4682 37.0 37.0 37.0 37.0 37.0 25-29 36.3596 37.0 37.0 37.0 37.0 37.0 30-34 36.3411 37.0 37.0 37.0 37.0 37.0 35-39 36.3156 37.0 37.0 37.0 37.0 37.0 40-44 36.258399999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.3398 37.0 37.0 37.0 37.0 37.0 50-54 36.3074 37.0 37.0 37.0 37.0 37.0 55-59 36.2532 37.0 37.0 37.0 37.0 37.0 60-64 36.235699999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.237700000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.1188 37.0 37.0 37.0 37.0 37.0 75-79 36.144400000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.0817 37.0 37.0 37.0 37.0 37.0 85-89 36.101 37.0 37.0 37.0 37.0 37.0 90-94 36.109 37.0 37.0 37.0 37.0 37.0 95-99 36.171200000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.0587 37.0 37.0 37.0 37.0 37.0 105-109 36.000800000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.849 37.0 37.0 37.0 37.0 37.0 115-119 35.9401 37.0 37.0 37.0 37.0 37.0 120-124 35.935700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.8392 37.0 37.0 37.0 37.0 37.0 130-134 35.7586 37.0 37.0 37.0 37.0 37.0 135-139 35.768 37.0 37.0 37.0 37.0 37.0 140-144 35.6573 37.0 37.0 37.0 37.0 37.0 145-149 35.7081 37.0 37.0 37.0 37.0 37.0 150-151 35.454750000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 0.0 25 2.0 26 10.0 27 6.0 28 15.0 29 21.0 30 32.0 31 51.0 32 67.0 33 87.0 34 136.0 35 360.0 36 2912.0 37 298.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.745117676514774 11.4421632448673 6.384576865297947 35.42814221331998 2 21.85 13.125 34.125 30.9 3 17.5 19.0 29.425 34.075 4 21.099999999999998 24.75 26.25 27.900000000000002 5 22.475 31.85 24.6 21.075 6 20.75 35.8 23.599999999999998 19.85 7 14.875 27.0 42.5 15.625 8 17.724999999999998 24.875 32.65 24.75 9 18.05 23.599999999999998 35.25 23.1 10-14 19.355 29.79 28.000000000000004 22.855 15-19 19.805 28.275 27.639999999999997 24.279999999999998 20-24 19.564999999999998 28.665000000000003 28.310000000000002 23.46 25-29 19.355 28.810000000000002 27.955000000000002 23.880000000000003 30-34 20.14 28.65 27.810000000000002 23.400000000000002 35-39 19.525000000000002 28.815 27.47 24.19 40-44 19.73 28.265 28.64 23.365 45-49 20.035 29.220000000000002 27.284999999999997 23.46 50-54 19.755 28.715000000000003 28.110000000000003 23.419999999999998 55-59 20.345 28.825 27.18 23.65 60-64 19.61 29.425 27.865000000000002 23.1 65-69 20.485 28.255000000000003 27.744999999999997 23.515 70-74 19.975 28.470000000000002 27.944999999999997 23.61 75-79 20.345 28.46 27.93 23.265 80-84 19.595000000000002 28.485 28.325 23.595 85-89 19.84 28.444999999999997 27.750000000000004 23.965 90-94 19.455 28.73 28.249999999999996 23.565 95-99 19.945 28.29 27.525 24.240000000000002 100-104 20.265 28.970000000000002 27.284999999999997 23.48 105-109 20.705000000000002 28.7 27.439999999999998 23.155 110-114 20.305 28.225 28.13 23.34 115-119 20.41 28.02 28.4 23.169999999999998 120-124 20.02 28.485 27.250000000000004 24.245 125-129 20.544999999999998 28.720000000000002 27.66 23.075000000000003 130-134 20.705000000000002 28.24 27.43 23.625 135-139 20.86 28.29 27.310000000000002 23.54 140-144 20.53 28.58 27.435 23.455000000000002 145-149 20.474999999999998 29.07 26.955000000000002 23.5 150-151 20.9 28.65 26.575 23.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 3.0 25 2.0 26 0.5 27 2.0 28 5.5 29 11.0 30 16.0 31 21.5 32 27.0 33 41.0 34 59.0 35 71.5 36 90.5 37 106.0 38 128.0 39 167.5 40 209.5 41 242.0 42 252.0 43 248.5 44 258.0 45 288.0 46 289.0 47 266.5 48 254.5 49 216.0 50 172.5 51 140.5 52 110.5 53 81.0 54 58.0 55 46.5 56 33.5 57 26.0 58 18.0 59 11.0 60 6.5 61 3.0 62 1.5 63 1.0 64 1.5 65 2.0 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.0 #Duplication Level Percentage of deduplicated Percentage of total 1 95.07894736842105 90.325 2 4.578947368421052 8.7 3 0.34210526315789475 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.3625 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.3 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 4.0125 0.0 0.0 0.0 0.0 130-131 4.4875 0.0 0.0 0.0 0.0 132-133 4.85 0.0 0.0 0.0 0.0 134-135 5.175000000000001 0.0 0.0 0.0 0.0 136-137 5.6 0.0 0.0 0.0 0.0 138-139 6.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATATA 10 0.006830828 145.0 9 >>END_MODULE SRR12161485 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12161485_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.244 37.0 37.0 37.0 37.0 37.0 2 35.9715 37.0 37.0 37.0 37.0 37.0 3 36.244 37.0 37.0 37.0 37.0 37.0 4 36.201 37.0 37.0 37.0 37.0 37.0 5 36.2465 37.0 37.0 37.0 37.0 37.0 6 36.202 37.0 37.0 37.0 37.0 37.0 7 36.338 37.0 37.0 37.0 37.0 37.0 8 36.137 37.0 37.0 37.0 37.0 37.0 9 36.2415 37.0 37.0 37.0 37.0 37.0 10-14 36.1871 37.0 37.0 37.0 37.0 37.0 15-19 36.16420000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.161199999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.044799999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.0802 37.0 37.0 37.0 37.0 37.0 35-39 36.049400000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.0081 37.0 37.0 37.0 37.0 37.0 45-49 36.0159 37.0 37.0 37.0 37.0 37.0 50-54 35.971500000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.9701 37.0 37.0 37.0 37.0 37.0 60-64 35.9014 37.0 37.0 37.0 37.0 37.0 65-69 35.903800000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.793000000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.8232 37.0 37.0 37.0 37.0 37.0 80-84 35.7467 37.0 37.0 37.0 37.0 37.0 85-89 35.716300000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.7317 37.0 37.0 37.0 37.0 37.0 95-99 35.683400000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.6738 37.0 37.0 37.0 37.0 37.0 105-109 35.644800000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.6097 37.0 37.0 37.0 37.0 37.0 115-119 35.55929999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.5225 37.0 37.0 37.0 37.0 37.0 125-129 35.516999999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.488299999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.338499999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.26 37.0 37.0 37.0 29.8 37.0 145-149 35.2201 37.0 37.0 37.0 34.6 37.0 150-151 35.004000000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 5.0 15 4.0 16 2.0 17 2.0 18 1.0 19 1.0 20 0.0 21 2.0 22 6.0 23 5.0 24 7.0 25 11.0 26 9.0 27 21.0 28 19.0 29 15.0 30 24.0 31 45.0 32 58.0 33 104.0 34 223.0 35 576.0 36 2642.0 37 214.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.925 25.5 8.7 20.875 2 27.650000000000002 25.575 29.549999999999997 17.224999999999998 3 20.625 27.175 33.1 19.1 4 23.5 34.325 23.45 18.725 5 24.075 37.425000000000004 21.025 17.474999999999998 6 21.175 40.1 21.224999999999998 17.5 7 21.575 23.1 36.875 18.45 8 20.75 26.0 29.75 23.5 9 22.875 24.75 29.925 22.45 10-14 23.565 29.595 26.025 20.815 15-19 23.45 28.655 27.6 20.294999999999998 20-24 23.115 28.555000000000003 28.03 20.3 25-29 23.0 28.455000000000002 28.17 20.375 30-34 22.994999999999997 28.28 28.03 20.695 35-39 23.145 28.335 28.244999999999997 20.275000000000002 40-44 23.505000000000003 28.09 28.335 20.07 45-49 22.939999999999998 28.194999999999997 27.865000000000002 21.0 50-54 22.759999999999998 28.835 28.439999999999998 19.965 55-59 23.544999999999998 28.365000000000002 27.805000000000003 20.285 60-64 23.225 28.395 28.08 20.3 65-69 22.825 28.525 28.065 20.585 70-74 23.169999999999998 28.444999999999997 28.52 19.865 75-79 22.605 28.025 28.799999999999997 20.57 80-84 23.275000000000002 28.110000000000003 27.83 20.785 85-89 23.36 28.22 28.494999999999997 19.925 90-94 24.065 27.825 28.134999999999998 19.975 95-99 22.955000000000002 28.799999999999997 28.08 20.165 100-104 23.89 28.455000000000002 27.744999999999997 19.91 105-109 23.14 28.735 28.21 19.915 110-114 23.62 28.33 28.02 20.03 115-119 23.965 28.865000000000002 26.995 20.175 120-124 24.279999999999998 28.02 28.035 19.665 125-129 24.0 28.305000000000003 27.655 20.04 130-134 24.6 27.889999999999997 27.74 19.77 135-139 24.385 28.025 27.805000000000003 19.785 140-144 25.09 27.655 27.525 19.73 145-149 25.295 28.455000000000002 27.005000000000003 19.245 150-151 25.825 27.962500000000002 26.875 19.3375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.5 9 2.0 10 1.5 11 0.0 12 1.0 13 1.0 14 0.5 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 1.5 22 3.0 23 2.5 24 1.5 25 3.0 26 3.5 27 6.0 28 9.0 29 9.0 30 13.0 31 14.5 32 22.0 33 35.5 34 50.0 35 70.5 36 98.5 37 112.5 38 135.5 39 179.5 40 217.5 41 251.5 42 273.5 43 286.0 44 296.5 45 280.0 46 263.5 47 263.0 48 222.5 49 184.0 50 157.0 51 128.0 52 100.0 53 77.0 54 60.5 55 44.0 56 33.0 57 21.0 58 15.0 59 9.5 60 5.5 61 4.5 62 4.5 63 3.0 64 0.5 65 0.0 66 0.0 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.69999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.06335797254488 90.025 2 4.435058078141499 8.4 3 0.42238648363252373 1.2 4 0.05279831045406547 0.2 5 0.0 0.0 6 0.0 0.0 7 0.026399155227032733 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.9125 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.15 0.0 0.0 0.0 0.0 118-119 2.4125 0.0 0.0 0.0 0.0 120-121 2.7 0.0 0.0 0.0 0.0 122-123 3.0250000000000004 0.0 0.0 0.0 0.0 124-125 3.4124999999999996 0.0 0.0 0.0 0.0 126-127 3.8 0.0 0.0 0.0 0.0 128-129 4.1375 0.0 0.0 0.0 0.0 130-131 4.5875 0.0 0.0 0.0 0.0 132-133 4.95 0.0 0.0 0.0 0.0 134-135 5.275 0.0 0.0 0.0 0.0 136-137 5.699999999999999 0.0 0.0 0.0 0.0 138-139 6.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGCC 10 0.006830828 145.0 7 TCTGCCT 10 0.006830828 145.0 8 TCTTTAA 10 0.006830828 145.0 5 >>END_MODULE Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525074 spots for SRR12161485.sra Written 1525074 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra Read 1525062 spots for SRR12161485.sra Written 1525062 spots for SRR12161485.sra SRR ids: ['SRR12161485.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pm_anssl SRR12161485.sra spots: 30501252 blocks: [[1, 1525062], [1525063, 3050124], [3050125, 4575186], [4575187, 6100248], [6100249, 7625310], [7625311, 9150372], [9150373, 10675434], [10675435, 12200496], [12200497, 13725558], [13725559, 15250620], [15250621, 16775682], [16775683, 18300744], [18300745, 19825806], [19825807, 21350868], [21350869, 22875930], [22875931, 24400992], [24400993, 25926054], [25926055, 27451116], [27451117, 28976178], [28976179, 30501252]] SRR12161485 file size 10343959 SRR12161485 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12161485 SRR12161485_1.fastq SRR12161485_2.fastq Input file: SRR12161485_1.fastq Paired file: SRR12161485_2.fastq trimmed: SRR12161485-trimmed-pair1.fastq, SRR12161485-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:04:11 2025 >> started Fri Feb 14 02:04:44 2025 >> done (32.600s) 30501252 read pairs processed; of these: 60 ( 0.00%) short read pairs filtered out after trimming by size control 5206 ( 0.02%) empty read pairs filtered out after trimming by size control 30495986 (99.98%) read pairs available; of these: 3053278 (10.01%) trimmed read pairs available after processing 27442708 (89.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 9 0.00% 20 12 0.00% 21 16 0.00% 22 16 0.00% 23 18 0.00% 24 21 0.00% 25 25 0.00% 26 30 0.00% 27 47 0.00% 28 19 0.00% 29 39 0.00% 30 45 0.00% 31 42 0.00% 32 49 0.00% 33 38 0.00% 34 43 0.00% 35 31 0.00% 36 50 0.00% 37 57 0.00% 38 59 0.00% 39 51 0.00% 40 61 0.00% 41 62 0.00% 42 67 0.00% 43 62 0.00% 44 53 0.00% 45 92 0.00% 46 75 0.00% 47 75 0.00% 48 118 0.00% 49 119 0.00% 50 119 0.00% 51 125 0.00% 52 130 0.00% 53 140 0.00% 54 164 0.00% 55 161 0.00% 56 184 0.00% 57 196 0.00% 58 260 0.00% 59 282 0.00% 60 293 0.00% 61 362 0.00% 62 414 0.00% 63 436 0.00% 64 533 0.00% 65 492 0.00% 66 572 0.00% 67 626 0.00% 68 745 0.00% 69 833 0.00% 70 920 0.00% 71 1157 0.00% 72 1262 0.00% 73 1487 0.00% 74 1635 0.01% 75 1762 0.01% 76 1914 0.01% 77 2122 0.01% 78 2393 0.01% 79 2667 0.01% 80 3143 0.01% 81 3529 0.01% 82 4029 0.01% 83 4583 0.02% 84 5148 0.02% 85 5628 0.02% 86 6089 0.02% 87 6551 0.02% 88 7055 0.02% 89 7720 0.03% 90 8660 0.03% 91 9730 0.03% 92 10710 0.04% 93 11972 0.04% 94 13071 0.04% 95 13776 0.05% 96 14786 0.05% 97 15487 0.05% 98 16059 0.05% 99 17433 0.06% 100 18688 0.06% 101 20276 0.07% 102 21680 0.07% 103 23472 0.08% 104 25023 0.08% 105 26383 0.09% 106 27428 0.09% 107 28447 0.09% 108 29398 0.10% 109 30472 0.10% 110 32100 0.11% 111 33599 0.11% 112 35820 0.12% 113 37388 0.12% 114 39563 0.13% 115 41392 0.14% 116 42875 0.14% 117 43349 0.14% 118 44460 0.15% 119 45305 0.15% 120 46623 0.15% 121 49240 0.16% 122 50675 0.17% 123 53072 0.17% 124 55926 0.18% 125 57269 0.19% 126 58822 0.19% 127 59508 0.20% 128 62387 0.20% 129 60898 0.20% 130 62312 0.20% 131 63241 0.21% 132 66186 0.22% 133 68126 0.22% 134 71016 0.23% 135 73218 0.24% 136 74817 0.25% 137 75105 0.25% 138 75823 0.25% 139 75297 0.25% 140 77814 0.26% 141 77942 0.26% 142 80743 0.26% 143 82653 0.27% 144 85391 0.28% 145 87464 0.29% 146 87783 0.29% 147 88792 0.29% 148 88950 0.29% 149 88209 0.29% 150 89806 0.29% 151 27442708 89.99% 30495986 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=27 prefix-density=0.83 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=17.54 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=4.5 sequence=AGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCAT criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=4.47 fanout-score-rank=20 prefix-density=0.93 prefix-fanout=3.3 sequence=AGAAAATGTCTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=322.79 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=30.6 sequence=AAGAAGAAGAAA SRR12161485 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:05:31 Started mapping on | Feb 14 02:05:31 Finished on | Feb 14 02:08:28 Mapping speed, Million of reads per hour | 620.26 Number of input reads | 30495986 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 28501486 Uniquely mapped reads % | 93.46% Average mapped length | 295.95 Number of splices: Total | 29283862 Number of splices: Annotated (sjdb) | 28627258 Number of splices: GT/AG | 28803185 Number of splices: GC/AG | 376322 Number of splices: AT/AC | 26446 Number of splices: Non-canonical | 77909 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 676085 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 29569 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.11% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1318415 1318415 1318415 N_multimapping 676085 676085 676085 N_noFeature 930040 28244385 1057100 N_ambiguous 296123 1460 165190 UnstrandedReadsAssigned:27275323 PositiveStrandReadsAssigned:255641 NegativeStrandReadsAssigned:27279196 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12161485 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12161485-trimmed-pair1.fastq SRR12161485-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,495,986 reads, 27,207,028 reads pseudoaligned [quant] estimated average fragment length: 259.112 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR12161485.ke.tsv 34699 SRR12161485.se.tsv 87100 total ==> SRR12161485.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.89 2714 56.8386 Potri.005G024800.1.v4.1 1035 776.888 312 14.8018 Potri.004G059700.1.v4.1 961 703.11 82 4.29843 Potri.007G009000.2.v4.1 1416 1157.89 0 0 Potri.003G141000.2.v4.1 2943 2684.89 969.601 13.3102 Potri.016G087400.1.v4.1 270 84.5954 1329.55 579.263 Potri.015G069301.1.v4.1 564 320.409 0 0 Potri.010G195200.1.v4.1 1773 1514.89 334 8.12615 Potri.012G127500.1.v4.1 977 718.99 9309 477.198 ==> SRR12161485.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 123 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 555 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 428 SRR12161485 completed mapping pipeline successfully