Starting /dee2/code/volunteer_pipeline.sh SRR12192578 current disk space = 3085094895616 free memory = 1580593784 SRR12192578 SRAfilesize 4698c96caab50be7cc709bd5f895e195 SRR12192578.sra SRR12192578.sra file validated SRR12192578 is single end SRR12192578 is conventional basespace SRR12192578 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192578_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.20375 32.0 2.0 32.0 2.0 32.0 2 31.65875 32.0 32.0 32.0 32.0 32.0 3 34.17875 32.0 32.0 37.0 32.0 37.0 4 36.03875 37.0 37.0 37.0 32.0 37.0 5 36.56625 37.0 37.0 37.0 37.0 37.0 6 40.1605 41.0 41.0 41.0 37.0 41.0 7 40.2545 41.0 41.0 41.0 37.0 41.0 8 40.42275 41.0 41.0 41.0 41.0 41.0 9 40.31725 41.0 41.0 41.0 41.0 41.0 10-14 40.376 41.0 41.0 41.0 41.0 41.0 15-19 40.37474999999999 41.0 41.0 41.0 41.0 41.0 20-24 40.3976 41.0 41.0 41.0 41.0 41.0 25-29 40.368300000000005 41.0 41.0 41.0 41.0 41.0 30-34 40.245250000000006 41.0 41.0 41.0 38.6 41.0 35-39 40.3588 41.0 41.0 41.0 41.0 41.0 40-44 40.21295 41.0 41.0 41.0 40.2 41.0 45-49 40.291 41.0 41.0 41.0 41.0 41.0 50-54 40.24615 41.0 41.0 41.0 39.4 41.0 55-59 40.19755 41.0 41.0 41.0 40.2 41.0 60-64 40.085449999999994 41.0 41.0 41.0 39.4 41.0 65-69 40.08475 41.0 41.0 41.0 37.8 41.0 70-74 40.035650000000004 41.0 41.0 41.0 37.0 41.0 75-79 39.807599999999994 41.0 41.0 41.0 37.0 41.0 80-84 40.0655 41.0 41.0 41.0 37.0 41.0 85-89 40.11965 41.0 41.0 41.0 37.8 41.0 90-94 40.069100000000006 41.0 41.0 41.0 37.0 41.0 95-99 39.9506 41.0 41.0 41.0 37.0 41.0 100-104 39.9307 41.0 41.0 41.0 37.0 41.0 105-109 39.882400000000004 41.0 41.0 41.0 37.0 41.0 110-114 39.8235 41.0 41.0 41.0 37.0 41.0 115-119 39.7165 41.0 41.0 41.0 37.0 41.0 120-124 39.4209 41.0 41.0 41.0 37.0 41.0 125-129 39.27225 41.0 41.0 41.0 37.0 41.0 130-134 39.1678 41.0 41.0 41.0 37.0 41.0 135-139 39.1441 41.0 41.0 41.0 37.0 41.0 140-144 38.97055 41.0 41.0 41.0 37.0 41.0 145-149 38.707 41.0 40.2 41.0 33.0 41.0 150 38.67025 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 2.0 26 3.0 27 7.0 28 9.0 29 11.0 30 20.0 31 20.0 32 19.0 33 39.0 34 45.0 35 56.0 36 79.0 37 150.0 38 213.0 39 546.0 40 2778.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.730703259005146 15.09433962264151 15.480274442538594 40.694682675814754 2 21.525 21.224999999999998 34.725 22.525000000000002 3 23.7 23.75 26.525 26.025 4 25.494120590442833 28.821616212159118 22.34175631723793 23.34250688016012 5 26.224999999999998 32.975 21.825 18.975 6 19.375 37.375 23.549999999999997 19.7 7 18.7 18.775 41.025 21.5 8 20.525 23.150000000000002 28.375 27.950000000000003 9 21.05 21.95 31.574999999999996 25.424999999999997 10-14 22.37 28.310000000000002 25.814999999999998 23.505000000000003 15-19 22.975 27.305 26.619999999999997 23.1 20-24 22.45 27.61 26.784999999999997 23.155 25-29 23.075000000000003 27.005000000000003 26.345000000000002 23.575 30-34 22.93 26.61 26.93 23.53 35-39 23.735 26.855 26.340000000000003 23.07 40-44 23.189999999999998 26.795 26.590000000000003 23.425 45-49 23.145 26.224999999999998 27.134999999999998 23.494999999999997 50-54 23.455000000000002 26.895000000000003 27.24 22.41 55-59 23.255 26.66 26.625 23.46 60-64 23.115 26.650000000000002 27.084999999999997 23.150000000000002 65-69 22.495 27.35 26.5 23.655 70-74 22.814999999999998 27.245 26.369999999999997 23.57 75-79 23.77 26.650000000000002 25.965 23.615 80-84 23.425 26.895000000000003 26.565 23.115 85-89 23.54 27.04 26.69 22.73 90-94 23.265 26.665 26.36 23.71 95-99 23.315 26.740000000000002 27.245 22.7 100-104 23.297473104828622 26.8951713785339 26.584938704028023 23.222416812609456 105-109 22.830000000000002 26.645000000000003 27.235 23.29 110-114 22.965669102191974 26.508857972174958 27.08938044239816 23.436092483234912 115-119 22.984193677470987 26.800720288115247 26.65566226490596 23.559423769507802 120-124 23.49554420746971 26.22909782717533 27.075197757084208 23.200160208270752 125-129 23.082699239086903 26.39167000400481 27.588105726872246 22.937525030036042 130-134 23.02032235459005 26.80949043948343 27.08479327259986 23.08539393332666 135-139 23.029969480162105 27.36778906289088 26.10696953019463 23.49527192675239 140-144 23.905 27.51 26.1 22.485 145-149 24.107410741074105 27.63776377637764 25.6025602560256 22.65226522652265 150 23.05 27.025 26.450000000000003 23.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 2.0 25 1.0 26 2.5 27 4.5 28 5.5 29 10.5 30 17.0 31 21.5 32 23.5 33 25.0 34 28.0 35 41.0 36 57.5 37 77.0 38 114.5 39 154.0 40 185.0 41 208.5 42 226.5 43 260.0 44 271.0 45 254.0 46 254.0 47 257.0 48 214.5 49 165.0 50 152.0 51 124.0 52 91.5 53 79.0 54 72.0 55 53.0 56 41.0 57 42.0 58 39.0 59 43.5 60 45.0 61 38.5 62 34.0 63 32.0 64 45.0 65 51.0 66 38.0 67 36.5 68 32.0 69 17.0 70 6.5 71 0.5 72 0.5 73 0.5 74 1.5 75 2.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 41.699999999999996 2 0.0 3 0.0 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.075 105-109 0.0 110-114 0.09 115-119 0.04 120-124 0.13 125-129 0.12 130-134 0.11 135-139 0.065 140-144 0.0 145-149 0.01 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.21311047270828 92.10000000000001 2 3.3951423348132668 6.5 3 0.2872812744841995 0.8250000000000001 4 0.05223295899712719 0.2 5 0.026116479498563595 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026116479498563595 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTAGAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTC 10 0.25 No Hit NTAGAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.2875 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138 2.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCGGA 20 0.0063356147 28.615 140-144 >>END_MODULE Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104641 READS because READLEN < 1 Read 1104641 spots for SRR12192578.sra Written 1104641 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192578.sra Written 1104627 spots for SRR12192578.sra SRR ids: ['SRR12192578.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u9isausd SRR12192578.sra spots: 22092554 blocks: [[1, 1104627], [1104628, 2209254], [2209255, 3313881], [3313882, 4418508], [4418509, 5523135], [5523136, 6627762], [6627763, 7732389], [7732390, 8837016], [8837017, 9941643], [9941644, 11046270], [11046271, 12150897], [12150898, 13255524], [13255525, 14360151], [14360152, 15464778], [15464779, 16569405], [16569406, 17674032], [17674033, 18778659], [18778660, 19883286], [19883287, 20987913], [20987914, 22092554]] SRR12192578 file size 7443166 SRR12192578 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192578 SRR12192578_1.fastq Input file: SRR12192578_1.fastq trimmed: SRR12192578-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 06:48:34 2025 >> started Fri Feb 14 06:48:47 2025 >> done (13.010s) 22092554 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 22092554 (100.00%) reads available; of these: 138509 ( 0.63%) trimmed reads available after processing 21954045 (99.37%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 1 0.00% 37 0 0.00% 38 1 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 1 0.00% 45 1 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 1 0.00% 50 0 0.00% 51 0 0.00% 52 1 0.00% 53 1 0.00% 54 0 0.00% 55 2 0.00% 56 0 0.00% 57 0 0.00% 58 1 0.00% 59 0 0.00% 60 2 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 1 0.00% 66 4 0.00% 67 3 0.00% 68 3 0.00% 69 0 0.00% 70 0 0.00% 71 0 0.00% 72 0 0.00% 73 2 0.00% 74 0 0.00% 75 1 0.00% 76 1 0.00% 77 2 0.00% 78 0 0.00% 79 1 0.00% 80 0 0.00% 81 1 0.00% 82 1 0.00% 83 1 0.00% 84 1 0.00% 85 0 0.00% 86 1 0.00% 87 1 0.00% 88 1 0.00% 89 1 0.00% 90 1 0.00% 91 2 0.00% 92 5 0.00% 93 1 0.00% 94 2 0.00% 95 3 0.00% 96 4 0.00% 97 2 0.00% 98 3 0.00% 99 2 0.00% 100 4 0.00% 101 2 0.00% 102 5 0.00% 103 3 0.00% 104 3 0.00% 105 5 0.00% 106 8 0.00% 107 6 0.00% 108 3 0.00% 109 17 0.00% 110 7 0.00% 111 12 0.00% 112 12 0.00% 113 7 0.00% 114 11 0.00% 115 18 0.00% 116 18 0.00% 117 22 0.00% 118 10 0.00% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 1 0.00% 140 7 0.00% 141 13 0.00% 142 32 0.00% 143 95 0.00% 144 209 0.00% 145 481 0.00% 146 1220 0.01% 147 3877 0.02% 148 17153 0.08% 149 115183 0.52% 150 21954045 99.37% 22092554 reads passed initial QC criterion=sequence-density sequence-density=1.56 sequence-density-rank=1 fanout-score=80.36 fanout-score-rank=1 prefix-density=2.81 prefix-fanout=44.5 sequence=AGATCGGAAGAGCACA criterion=fanout-score sequence-density=1.56 sequence-density-rank=1 fanout-score=80.36 fanout-score-rank=1 prefix-density=2.81 prefix-fanout=44.5 sequence=AGATCGGAAGAGCACA Started job on | Feb 14 06:49:21 Started mapping on | Feb 14 06:49:21 Finished on | Feb 14 06:51:04 Mapping speed, Million of reads per hour | 772.17 Number of input reads | 22092554 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 18312104 Uniquely mapped reads % | 82.89% Average mapped length | 149.02 Number of splices: Total | 9369110 Number of splices: Annotated (sjdb) | 9152053 Number of splices: GT/AG | 9222906 Number of splices: GC/AG | 120395 Number of splices: AT/AC | 7046 Number of splices: Non-canonical | 18763 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.90 Insertion rate per base | 0.01% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 986259 % of reads mapped to multiple loci | 4.46% Number of reads mapped to too many loci | 88717 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.23% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2794191 2794191 2794191 N_multimapping 986259 986259 986259 N_noFeature 599888 9547604 9302404 N_ambiguous 118244 28633 28040 UnstrandedReadsAssigned:17593972 PositiveStrandReadsAssigned:8735867 NegativeStrandReadsAssigned:8981660 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192578 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192578-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,092,554 reads, 18,522,249 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR12192578.ke.tsv 34699 SRR12192578.se.tsv 87100 total ==> SRR12192578.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 4444.48 156.866 Potri.005G024800.1.v4.1 1035 936 576 41.6801 Potri.004G059700.1.v4.1 961 862 3 0.23572 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 415.351 9.89162 Potri.016G087400.1.v4.1 270 171 946 374.694 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 451.944 18.2857 Potri.012G127500.1.v4.1 977 878 2671 206.045 ==> SRR12192578.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 173 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 0 SRR12192578 completed mapping pipeline successfully