Starting /dee2/code/volunteer_pipeline.sh SRR12192579 current disk space = 3085344522240 free memory = 1449642372 SRR12192579 SRAfilesize de184879ef55af9f9baf256544c7cec4 SRR12192579.sra SRR12192579.sra file validated SRR12192579 is single end SRR12192579 is conventional basespace SRR12192579 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192579_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 16.5625 12.0 2.0 32.0 2.0 32.0 2 31.225 32.0 32.0 32.0 32.0 32.0 3 32.38 32.0 32.0 37.0 32.0 37.0 4 34.735 37.0 32.0 37.0 32.0 37.0 5 35.07125 37.0 37.0 37.0 32.0 37.0 6 36.26375 37.0 32.0 41.0 27.0 41.0 7 37.15475 41.0 37.0 41.0 27.0 41.0 8 38.51875 41.0 37.0 41.0 32.0 41.0 9 38.8965 41.0 37.0 41.0 37.0 41.0 10-14 39.02035 41.0 38.6 41.0 36.0 41.0 15-19 39.26649999999999 41.0 40.2 41.0 36.0 41.0 20-24 39.606100000000005 41.0 41.0 41.0 37.0 41.0 25-29 39.50665 41.0 41.0 41.0 37.0 41.0 30-34 39.2246 41.0 41.0 41.0 37.0 41.0 35-39 39.347199999999994 41.0 41.0 41.0 37.0 41.0 40-44 39.4407 41.0 41.0 41.0 37.0 41.0 45-49 39.07770000000001 41.0 41.0 41.0 37.0 41.0 50-54 39.14665 41.0 41.0 41.0 37.0 41.0 55-59 39.11215 41.0 41.0 41.0 37.0 41.0 60-64 39.09830000000001 41.0 41.0 41.0 37.0 41.0 65-69 39.035000000000004 41.0 41.0 41.0 36.0 41.0 70-74 39.0825 41.0 41.0 41.0 36.0 41.0 75-79 38.67445 41.0 39.4 41.0 34.0 41.0 80-84 39.2059 41.0 41.0 41.0 36.0 41.0 85-89 39.2112 41.0 41.0 41.0 37.0 41.0 90-94 39.04145 41.0 41.0 41.0 37.0 41.0 95-99 38.96105 41.0 41.0 41.0 37.0 41.0 100-104 38.8403 41.0 40.2 41.0 34.0 41.0 105-109 38.60575 41.0 37.0 41.0 32.0 41.0 110-114 38.155950000000004 41.0 37.0 41.0 32.0 41.0 115-119 38.022000000000006 41.0 37.0 41.0 32.0 41.0 120-124 37.94070000000001 41.0 37.0 41.0 32.0 41.0 125-129 37.33215 41.0 37.0 41.0 27.0 41.0 130-134 36.74235 41.0 37.0 41.0 27.0 41.0 135-139 36.22025 41.0 34.0 41.0 27.0 41.0 140-144 35.710249999999995 41.0 32.0 41.0 23.0 41.0 145-149 35.14385 38.6 32.0 41.0 22.0 41.0 150 34.871 37.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 16.0 24 14.0 25 9.0 26 25.0 27 22.0 28 27.0 29 38.0 30 46.0 31 38.0 32 50.0 33 87.0 34 101.0 35 148.0 36 194.0 37 284.0 38 546.0 39 1331.0 40 1021.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.720451201569396 14.713094654242276 15.105443845022071 40.461010299166254 2 22.625 20.225 34.35 22.8 3 23.974999999999998 24.4 26.775 24.85 4 25.062531265632813 29.214607303651825 21.635817908954476 24.087043521760883 5 25.48774387193597 33.26663331665833 23.761880940470235 17.483741870935468 6 20.65 35.475 22.975 20.9 7 18.625 18.95 40.525 21.9 8 20.349999999999998 24.8 28.125 26.724999999999998 9 21.5 21.55 31.424999999999997 25.525 10-14 22.38 28.285 25.85 23.485 15-19 22.195 26.855 27.750000000000004 23.200000000000003 20-24 22.27 27.205000000000002 26.884999999999998 23.64 25-29 22.845 27.46 26.290000000000003 23.405 30-34 22.27 27.639999999999997 26.88 23.21 35-39 22.705000000000002 27.47 26.950000000000003 22.875 40-44 23.12731273127313 26.452645264526453 26.782678267826782 23.637363736373636 45-49 22.775000000000002 27.43 26.66 23.135 50-54 22.867286728672866 27.012701270127014 26.62766276627663 23.492349234923495 55-59 23.682368236823685 26.937693769376935 26.67766776677668 22.7022702270227 60-64 23.419999999999998 26.85 26.305 23.425 65-69 22.418539466439764 27.874267981380452 26.177486360678714 23.529706191501077 70-74 23.235 27.58 26.314999999999998 22.869999999999997 75-79 22.735 26.605 27.005000000000003 23.655 80-84 22.715 26.875 27.034999999999997 23.375 85-89 23.200000000000003 26.87 27.134999999999998 22.795 90-94 22.865 27.029999999999998 26.979999999999997 23.125 95-99 22.869999999999997 26.82 27.195000000000004 23.115 100-104 23.355 26.450000000000003 27.045 23.150000000000002 105-109 23.02 27.284999999999997 26.384999999999998 23.31 110-114 22.775000000000002 27.485 26.479999999999997 23.26 115-119 23.45 27.115000000000002 26.025 23.41 120-124 23.005 27.794999999999998 26.179999999999996 23.02 125-129 23.535 26.55 26.735 23.18 130-134 23.77 27.165 25.990000000000002 23.075000000000003 135-139 23.515 26.840000000000003 26.584999999999997 23.06 140-144 23.605901475368842 27.25681420355089 25.926481620405102 23.210802700675167 145-149 24.371092773193297 27.461865466366593 25.401350337584393 22.765691422855713 150 23.65 25.55 26.400000000000002 24.4 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.5 22 1.5 23 0.5 24 1.0 25 1.5 26 1.5 27 3.5 28 7.5 29 9.0 30 11.0 31 17.0 32 26.0 33 35.5 34 41.5 35 54.0 36 71.0 37 92.0 38 118.5 39 150.0 40 192.0 41 233.0 42 248.5 43 241.0 44 257.5 45 258.0 46 234.0 47 236.5 48 211.5 49 161.0 50 140.0 51 128.0 52 97.5 53 77.0 54 56.5 55 43.5 56 42.0 57 35.0 58 45.0 59 48.0 60 40.0 61 42.0 62 39.5 63 38.0 64 51.0 65 47.5 66 36.0 67 28.0 68 23.0 69 15.5 70 3.5 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 49.025 2 0.0 3 0.0 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.01 55-59 0.01 60-64 0.0 65-69 0.105 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.025 145-149 0.025 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.25 #Duplication Level Percentage of deduplicated Percentage of total 1 96.4935064935065 92.875 2 3.1428571428571432 6.05 3 0.33766233766233766 0.975 4 0.025974025974025976 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.3125 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138 2.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGATCC 10 6.731378E-4 309.8108 1 GGCGAAG 10 6.731378E-4 309.8108 1 GGATCCC 10 0.0070778397 143.2875 2 TTTTTTT 20 0.006289843 28.6575 90-94 GATCGGA 20 0.006289843 28.6575 140-144 >>END_MODULE Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104641 READS because READLEN < 1 Read 1104641 spots for SRR12192579.sra Written 1104641 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra Rejected 1104627 READS because READLEN < 1 Read 1104627 spots for SRR12192579.sra Written 1104627 spots for SRR12192579.sra SRR ids: ['SRR12192579.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_50u5sq12 SRR12192579.sra spots: 22092554 blocks: [[1, 1104627], [1104628, 2209254], [2209255, 3313881], [3313882, 4418508], [4418509, 5523135], [5523136, 6627762], [6627763, 7732389], [7732390, 8837016], [8837017, 9941643], [9941644, 11046270], [11046271, 12150897], [12150898, 13255524], [13255525, 14360151], [14360152, 15464778], [15464779, 16569405], [16569406, 17674032], [17674033, 18778659], [18778660, 19883286], [19883287, 20987913], [20987914, 22092554]] SRR12192579 file size 7443166 SRR12192579 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192579 SRR12192579_2.fastq Input file: SRR12192579_2.fastq trimmed: SRR12192579-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 06:21:46 2025 >> started Fri Feb 14 06:21:59 2025 >> done (13.074s) 22092554 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 2 ( 0.00%) empty reads filtered out after trimming by size control 22092552 (100.00%) reads available; of these: 382419 ( 1.73%) trimmed reads available after processing 21710133 (98.27%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 87 1 0.00% 88 0 0.00% 89 1 0.00% 90 0 0.00% 91 0 0.00% 92 0 0.00% 93 0 0.00% 94 0 0.00% 95 0 0.00% 96 0 0.00% 97 0 0.00% 98 0 0.00% 99 0 0.00% 100 0 0.00% 101 0 0.00% 102 0 0.00% 103 0 0.00% 104 0 0.00% 105 0 0.00% 106 0 0.00% 107 0 0.00% 108 0 0.00% 109 0 0.00% 110 0 0.00% 111 0 0.00% 112 0 0.00% 113 0 0.00% 114 0 0.00% 115 0 0.00% 116 0 0.00% 117 0 0.00% 118 0 0.00% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 2 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 4 0.00% 138 6 0.00% 139 6 0.00% 140 17 0.00% 141 34 0.00% 142 84 0.00% 143 191 0.00% 144 483 0.00% 145 1261 0.01% 146 3647 0.02% 147 11834 0.05% 148 54011 0.24% 149 310837 1.41% 150 21710133 98.27% 22092552 reads passed initial QC criterion=sequence-density sequence-density=1.55 sequence-density-rank=1 fanout-score=79.58 fanout-score-rank=1 prefix-density=2.80 prefix-fanout=44.1 sequence=AGATCGGAAGAGCGTC criterion=fanout-score sequence-density=1.55 sequence-density-rank=1 fanout-score=79.58 fanout-score-rank=1 prefix-density=2.80 prefix-fanout=44.1 sequence=AGATCGGAAGAGCGTC Started job on | Feb 14 06:22:26 Started mapping on | Feb 14 06:22:27 Finished on | Feb 14 06:24:15 Mapping speed, Million of reads per hour | 736.42 Number of input reads | 22092552 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 18230299 Uniquely mapped reads % | 82.52% Average mapped length | 148.88 Number of splices: Total | 9297809 Number of splices: Annotated (sjdb) | 9079638 Number of splices: GT/AG | 9152331 Number of splices: GC/AG | 117826 Number of splices: AT/AC | 7153 Number of splices: Non-canonical | 20499 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 2.89 Insertion rate per base | 0.01% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 994510 % of reads mapped to multiple loci | 4.50% Number of reads mapped to too many loci | 88091 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.55% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2867743 2867743 2867743 N_multimapping 994510 994510 994510 N_noFeature 597387 9309250 9456634 N_ambiguous 117874 28827 27620 UnstrandedReadsAssigned:17515038 PositiveStrandReadsAssigned:8892222 NegativeStrandReadsAssigned:8746045 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192579 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192579-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,092,552 reads, 18,496,625 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52401 SRR12192579.ke.tsv 34699 SRR12192579.se.tsv 87100 total ==> SRR12192579.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 4446.43 157.227 Potri.005G024800.1.v4.1 1035 936 573 41.5402 Potri.004G059700.1.v4.1 961 862 3 0.236159 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 421.531 10.0575 Potri.016G087400.1.v4.1 270 171 934 370.63 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 453 18.3625 Potri.012G127500.1.v4.1 977 878 2675 206.737 ==> SRR12192579.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 174 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 7 Potri.001G452600.v4.1 0 SRR12192579 completed mapping pipeline successfully