Starting /dee2/code/volunteer_pipeline.sh SRR12192580 current disk space = 3085289021440 free memory = 1493686692 SRR12192580 SRAfilesize 41d34620bc269295b3242031ac9e8582 SRR12192580.sra SRR12192580.sra file validated SRR12192580 is single end SRR12192580 is conventional basespace SRR12192580 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192580_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.645 32.0 2.0 32.0 2.0 32.0 2 31.68375 32.0 32.0 32.0 32.0 32.0 3 34.6425 37.0 32.0 37.0 32.0 37.0 4 36.3075 37.0 37.0 37.0 37.0 37.0 5 36.57375 37.0 37.0 37.0 37.0 37.0 6 40.2075 41.0 41.0 41.0 37.0 41.0 7 40.41275 41.0 41.0 41.0 41.0 41.0 8 40.389 41.0 41.0 41.0 41.0 41.0 9 40.43425 41.0 41.0 41.0 41.0 41.0 10-14 40.41175 41.0 41.0 41.0 41.0 41.0 15-19 40.36455 41.0 41.0 41.0 41.0 41.0 20-24 40.4295 41.0 41.0 41.0 41.0 41.0 25-29 40.43435 41.0 41.0 41.0 41.0 41.0 30-34 40.2363 41.0 41.0 41.0 39.4 41.0 35-39 40.3621 41.0 41.0 41.0 41.0 41.0 40-44 40.2191 41.0 41.0 41.0 39.4 41.0 45-49 40.281499999999994 41.0 41.0 41.0 41.0 41.0 50-54 40.16245 41.0 41.0 41.0 38.6 41.0 55-59 40.11395 41.0 41.0 41.0 37.8 41.0 60-64 39.88235 41.0 41.0 41.0 37.0 41.0 65-69 39.68175 41.0 41.0 41.0 37.0 41.0 70-74 39.54805 41.0 41.0 41.0 37.0 41.0 75-79 38.589150000000004 40.2 39.4 41.0 35.0 41.0 80-84 39.2772 41.0 41.0 41.0 37.0 41.0 85-89 39.23915 41.0 41.0 41.0 37.0 41.0 90-94 39.133250000000004 41.0 41.0 41.0 37.0 41.0 95-99 38.74485 41.0 37.8 41.0 33.0 41.0 100-104 38.73645 41.0 37.8 41.0 33.0 41.0 105-109 38.57425 41.0 37.0 41.0 32.0 41.0 110-114 38.467 41.0 37.0 41.0 32.0 41.0 115-119 38.5253 41.0 37.0 41.0 32.0 41.0 120-124 38.17835 41.0 37.0 41.0 32.0 41.0 125-129 38.23309999999999 41.0 37.0 41.0 32.0 41.0 130-134 38.06195 41.0 37.0 41.0 32.0 41.0 135-139 38.079100000000004 41.0 37.0 41.0 32.0 41.0 140-144 37.830650000000006 41.0 37.0 41.0 32.0 41.0 145-149 37.72304999999999 41.0 37.0 41.0 32.0 41.0 150 37.7815 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 4.0 26 8.0 27 9.0 28 14.0 29 22.0 30 21.0 31 27.0 32 37.0 33 56.0 34 56.0 35 77.0 36 118.0 37 206.0 38 402.0 39 1232.0 40 1710.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.802008608321376 14.02439024390244 16.642754662840744 40.53084648493544 2 22.35 19.875 33.324999999999996 24.45 3 24.425 22.8 27.825 24.95 4 26.76338169084542 27.63881940970485 21.285642821410704 24.312156078039017 5 27.925 31.45 22.5 18.125 6 21.25 35.4 23.724999999999998 19.625 7 20.45 17.974999999999998 40.400000000000006 21.175 8 21.25 24.125 28.4 26.224999999999998 9 21.05 22.975 31.574999999999996 24.4 10-14 22.925 27.334999999999997 26.71 23.03 15-19 23.36 26.61 26.565 23.465 20-24 22.88 26.735 26.44 23.945 25-29 23.44 26.1 26.88 23.580000000000002 30-34 23.345 26.39 26.55 23.715 35-39 23.255 26.355 26.314999999999998 24.075 40-44 23.635 25.990000000000002 26.875 23.5 45-49 22.97 26.815 26.590000000000003 23.625 50-54 23.71 26.939999999999998 25.979999999999997 23.369999999999997 55-59 23.785 26.095000000000002 26.590000000000003 23.53 60-64 23.34 26.56 26.13 23.97 65-69 23.080000000000002 26.224999999999998 26.729999999999997 23.965 70-74 22.915 26.61 26.745 23.73 75-79 23.01 26.279999999999998 26.605 24.104999999999997 80-84 23.165 26.284999999999997 26.419999999999998 24.13 85-89 23.155 26.3 26.490000000000002 24.055 90-94 23.0 26.215 26.715 24.07 95-99 22.88 26.619999999999997 26.619999999999997 23.880000000000003 100-104 23.705408515535098 26.987541902236455 25.931855706209035 23.375193876019413 105-109 23.22 26.295 27.255000000000003 23.23 110-114 23.1935548438751 26.501200960768617 26.476180944755807 23.82906325060048 115-119 23.422026607982392 26.863058917675303 26.047814344303287 23.667100130039014 120-124 23.003402722177743 26.406124899919938 26.81144915932746 23.77902321857486 125-129 22.77207905929447 26.474856142106578 26.715036277207904 24.038028521391045 130-134 23.341006906215593 26.488839955960366 26.32369132218997 23.846461815634072 135-139 23.280476214296435 26.98214196388375 26.22680206092742 23.5105797608924 140-144 23.294999999999998 27.250000000000004 26.195 23.26 145-149 24.362436243624362 27.687768776877686 25.397539753975394 22.55225522552255 150 22.225 29.225 25.775 22.775000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 2.0 25 3.5 26 3.0 27 2.5 28 4.0 29 7.5 30 10.5 31 16.0 32 23.5 33 34.5 34 43.5 35 50.0 36 64.0 37 87.5 38 113.5 39 147.0 40 167.5 41 188.0 42 218.5 43 235.0 44 252.5 45 243.0 46 217.0 47 202.5 48 186.5 49 181.0 50 163.0 51 132.5 52 108.0 53 83.5 54 72.5 55 56.0 56 38.5 57 42.0 58 46.5 59 51.5 60 49.0 61 37.5 62 38.0 63 57.5 64 79.5 65 68.0 66 53.5 67 47.0 68 36.0 69 23.0 70 6.5 71 1.5 72 1.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 30.3 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.065 105-109 0.0 110-114 0.08 115-119 0.03 120-124 0.08 125-129 0.075 130-134 0.09 135-139 0.045 140-144 0.0 145-149 0.01 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.90921087358142 90.85 2 3.378200052784376 6.4 3 0.395882818685669 1.125 4 0.2111375032990235 0.8 5 0.0 0.0 6 0.0 0.0 7 0.0791765637371338 0.525 8 0.0 0.0 9 0.0 0.0 >10 0.026392187912377938 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTAGAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTC 12 0.3 No Hit TAGAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCA 7 0.17500000000000002 No Hit GTCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGTGAAGGTGGTCACGA 7 0.17500000000000002 No Hit NTAGAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.2875 0.0 0.0 0.0 0.0 136-137 1.2875 0.0 0.0 0.0 0.0 138 2.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATAA 10 0.0070282277 143.625 3 >>END_MODULE Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760724 READS because READLEN < 1 Read 760724 spots for SRR12192580.sra Written 760724 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192580.sra Written 760708 spots for SRR12192580.sra SRR ids: ['SRR12192580.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mworz_wl SRR12192580.sra spots: 15214176 blocks: [[1, 760708], [760709, 1521416], [1521417, 2282124], [2282125, 3042832], [3042833, 3803540], [3803541, 4564248], [4564249, 5324956], [5324957, 6085664], [6085665, 6846372], [6846373, 7607080], [7607081, 8367788], [8367789, 9128496], [9128497, 9889204], [9889205, 10649912], [10649913, 11410620], [11410621, 12171328], [12171329, 12932036], [12932037, 13692744], [13692745, 14453452], [14453453, 15214176]] SRR12192580 file size 5119027 SRR12192580 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192580 SRR12192580_1.fastq Input file: SRR12192580_1.fastq trimmed: SRR12192580-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 06:20:48 2025 >> started Fri Feb 14 06:20:56 2025 >> done (8.741s) 15214176 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 15214176 (100.00%) reads available; of these: 145697 ( 0.96%) trimmed reads available after processing 15068479 (99.04%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 1 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 1 0.00% 52 0 0.00% 53 0 0.00% 54 1 0.00% 55 1 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 3 0.00% 61 1 0.00% 62 0 0.00% 63 0 0.00% 64 2 0.00% 65 0 0.00% 66 1 0.00% 67 0 0.00% 68 2 0.00% 69 3 0.00% 70 0 0.00% 71 2 0.00% 72 0 0.00% 73 3 0.00% 74 0 0.00% 75 2 0.00% 76 1 0.00% 77 0 0.00% 78 0 0.00% 79 1 0.00% 80 1 0.00% 81 3 0.00% 82 5 0.00% 83 1 0.00% 84 3 0.00% 85 3 0.00% 86 2 0.00% 87 2 0.00% 88 1 0.00% 89 3 0.00% 90 1 0.00% 91 0 0.00% 92 1 0.00% 93 4 0.00% 94 2 0.00% 95 2 0.00% 96 3 0.00% 97 2 0.00% 98 3 0.00% 99 4 0.00% 100 3 0.00% 101 10 0.00% 102 2 0.00% 103 4 0.00% 104 5 0.00% 105 9 0.00% 106 13 0.00% 107 7 0.00% 108 13 0.00% 109 12 0.00% 110 8 0.00% 111 17 0.00% 112 15 0.00% 113 26 0.00% 114 20 0.00% 115 20 0.00% 116 29 0.00% 117 30 0.00% 118 11 0.00% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 1 0.00% 138 1 0.00% 139 1 0.00% 140 7 0.00% 141 14 0.00% 142 22 0.00% 143 50 0.00% 144 152 0.00% 145 386 0.00% 146 1057 0.01% 147 3680 0.02% 148 17475 0.11% 149 122525 0.81% 150 15068479 99.04% 15214176 reads passed initial QC criterion=sequence-density sequence-density=1.81 sequence-density-rank=1 fanout-score=82.43 fanout-score-rank=1 prefix-density=3.23 prefix-fanout=46.1 sequence=AGATCGGAAGAGCACA criterion=fanout-score sequence-density=1.81 sequence-density-rank=1 fanout-score=82.43 fanout-score-rank=1 prefix-density=3.23 prefix-fanout=46.1 sequence=AGATCGGAAGAGCACA Started job on | Feb 14 06:21:23 Started mapping on | Feb 14 06:21:23 Finished on | Feb 14 06:22:51 Mapping speed, Million of reads per hour | 622.40 Number of input reads | 15214176 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 12229228 Uniquely mapped reads % | 80.38% Average mapped length | 148.93 Number of splices: Total | 6345599 Number of splices: Annotated (sjdb) | 6182339 Number of splices: GT/AG | 6243847 Number of splices: GC/AG | 83644 Number of splices: AT/AC | 4814 Number of splices: Non-canonical | 13294 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 500240 % of reads mapped to multiple loci | 3.29% Number of reads mapped to too many loci | 256482 % of reads mapped to too many loci | 1.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.61% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2484708 2484708 2484708 N_multimapping 500240 500240 500240 N_noFeature 411474 6417587 6181575 N_ambiguous 79345 19025 18995 UnstrandedReadsAssigned:11738409 PositiveStrandReadsAssigned:5792616 NegativeStrandReadsAssigned:6028658 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192580 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192580-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,214,176 reads, 12,402,152 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR12192580.ke.tsv 34699 SRR12192580.se.tsv 87100 total ==> SRR12192580.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2254 123.014 Potri.005G024800.1.v4.1 1035 936 762 85.2619 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 432.258 15.918 Potri.016G087400.1.v4.1 270 171 654 400.551 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 350.954 21.9569 Potri.012G127500.1.v4.1 977 878 566 67.5146 ==> SRR12192580.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 162 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 0 SRR12192580 completed mapping pipeline successfully