Starting /dee2/code/volunteer_pipeline.sh SRR12192581 current disk space = 2823729713152 free memory = 1579165384 SRR12192581 SRAfilesize 71ee5f0da4c4008eebea07f17deb3cf1 SRR12192581.sra SRR12192581.sra file validated SRR12192581 is single end SRR12192581 is conventional basespace SRR12192581 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192581_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.025 32.0 2.0 32.0 2.0 32.0 2 31.0675 32.0 32.0 32.0 32.0 32.0 3 33.55125 32.0 32.0 37.0 32.0 37.0 4 35.0975 37.0 37.0 37.0 32.0 37.0 5 35.80125 37.0 37.0 37.0 32.0 37.0 6 39.203 41.0 41.0 41.0 37.0 41.0 7 39.0755 41.0 41.0 41.0 37.0 41.0 8 39.4525 41.0 41.0 41.0 37.0 41.0 9 39.0835 41.0 41.0 41.0 37.0 41.0 10-14 39.34785000000001 41.0 41.0 41.0 37.0 41.0 15-19 39.44565 41.0 41.0 41.0 37.0 41.0 20-24 39.4419 41.0 41.0 41.0 37.0 41.0 25-29 38.924350000000004 41.0 41.0 41.0 36.0 41.0 30-34 38.48295 41.0 38.6 41.0 32.0 41.0 35-39 38.78545 41.0 40.2 41.0 35.0 41.0 40-44 38.7793 41.0 41.0 41.0 34.0 41.0 45-49 38.860749999999996 41.0 41.0 41.0 34.0 41.0 50-54 38.8516 41.0 41.0 41.0 33.0 41.0 55-59 38.8112 41.0 41.0 41.0 34.0 41.0 60-64 38.8613 41.0 41.0 41.0 34.0 41.0 65-69 38.61005 41.0 40.2 41.0 32.0 41.0 70-74 38.69325 41.0 41.0 41.0 32.0 41.0 75-79 38.28715 41.0 38.6 41.0 32.0 41.0 80-84 38.82055 41.0 40.2 41.0 34.0 41.0 85-89 38.79879999999999 41.0 41.0 41.0 32.0 41.0 90-94 38.64 41.0 40.2 41.0 32.0 41.0 95-99 38.53975 41.0 37.0 41.0 32.0 41.0 100-104 38.269099999999995 41.0 37.0 41.0 32.0 41.0 105-109 38.012150000000005 41.0 37.0 41.0 32.0 41.0 110-114 37.591750000000005 41.0 37.0 41.0 29.0 41.0 115-119 37.45365 41.0 37.0 41.0 29.0 41.0 120-124 37.2084 41.0 37.0 41.0 27.0 41.0 125-129 36.739850000000004 41.0 36.0 41.0 27.0 41.0 130-134 36.2384 41.0 34.0 41.0 26.0 41.0 135-139 35.455349999999996 41.0 32.0 41.0 22.0 41.0 140-144 34.95175 39.4 32.0 41.0 22.0 41.0 145-149 34.4473 37.0 32.0 41.0 22.0 41.0 150 34.072 37.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 19.0 24 19.0 25 21.0 26 36.0 27 30.0 28 31.0 29 50.0 30 56.0 31 57.0 32 65.0 33 105.0 34 125.0 35 167.0 36 203.0 37 289.0 38 546.0 39 1129.0 40 1049.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.36906584992343 14.127105666156204 17.879019908116387 39.62480857580398 2 23.45 21.475 32.6 22.475 3 24.975 25.025 25.525 24.474999999999998 4 26.206551637909474 29.48237059264816 20.080020005001252 24.23105776444111 5 25.731432858214554 33.408352088022006 22.705676419104776 18.154538634658664 6 20.9 38.4 21.175 19.525000000000002 7 19.75 18.45 40.550000000000004 21.25 8 21.9 24.474999999999998 27.224999999999998 26.400000000000002 9 21.7 23.225 29.4 25.674999999999997 10-14 22.785 27.644999999999996 26.805 22.765 15-19 23.09 26.51 26.645000000000003 23.755000000000003 20-24 23.225 27.015 26.745 23.015 25-29 23.34 26.51 27.465 22.685 30-34 23.39 26.545 26.939999999999998 23.125 35-39 23.225 26.695 26.43 23.65 40-44 23.78618930946547 27.13135656782839 25.751287564378217 23.33116655832792 45-49 23.455000000000002 26.06 27.084999999999997 23.400000000000002 50-54 24.17120856042802 26.151307565378268 26.116305815290765 23.561178058902946 55-59 23.131156557827893 26.741337066853344 26.87634381719086 23.251162558127906 60-64 23.391169558477923 26.436321816090803 26.401320066003297 23.771188559427973 65-69 23.41458531458031 26.97332198808749 26.202512638270182 23.409580059062016 70-74 23.799999999999997 27.310000000000002 26.465 22.425 75-79 23.849999999999998 26.565 25.869999999999997 23.715 80-84 24.04 26.834999999999997 25.86 23.265 85-89 23.905 26.645000000000003 26.405 23.044999999999998 90-94 23.655 26.72 26.72 22.905 95-99 23.935000000000002 27.005000000000003 25.88 23.18 100-104 23.186159307965397 27.061353067653382 26.306315315765787 23.44617230861543 105-109 23.34 26.76 26.36 23.54 110-114 24.23 26.400000000000002 26.075 23.294999999999998 115-119 23.875 26.57 25.94 23.615 120-124 23.505000000000003 26.900000000000002 26.009999999999998 23.585 125-129 23.745 26.26 26.325 23.669999999999998 130-134 23.200000000000003 26.88 26.38 23.54 135-139 23.775 27.165 25.665 23.395 140-144 24.56868530279542 27.104065609841477 25.38380757113567 22.943441516227434 145-149 24.83872580887133 27.879181877281596 24.833725058758812 22.448367255088264 150 24.75 27.675 25.3 22.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 1.0 25 2.0 26 3.5 27 5.0 28 7.0 29 6.5 30 7.0 31 12.0 32 22.0 33 33.0 34 37.0 35 50.5 36 71.5 37 92.5 38 114.0 39 145.5 40 179.0 41 206.0 42 225.5 43 237.5 44 256.5 45 274.0 46 244.5 47 207.0 48 189.0 49 169.5 50 151.0 51 111.0 52 86.0 53 79.0 54 68.5 55 52.5 56 39.0 57 39.0 58 42.0 59 48.0 60 48.5 61 43.5 62 47.0 63 54.5 64 61.5 65 55.0 66 44.5 67 44.5 68 44.0 69 26.0 70 7.5 71 2.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 34.699999999999996 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.005 55-59 0.005 60-64 0.005 65-69 0.105 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.015 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.03570490942505 91.45 2 3.229194014176949 6.15 3 0.5250721974271462 1.5 4 0.10501443948542925 0.4 5 0.10501443948542925 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACG 5 0.125 No Hit CAAGCAGAAGACGGCATACGAGATCGTTTCACGTGACTGGAGTTCAGACG 5 0.125 RNA PCR Primer, Index 28 (96% over 29bp) CTAGAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTC 5 0.125 No Hit CGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.275 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138 1.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra Rejected 760724 READS because READLEN < 1 Read 760724 spots for SRR12192581.sra Written 760724 spots for SRR12192581.sra Rejected 760708 READS because READLEN < 1 Read 760708 spots for SRR12192581.sra Written 760708 spots for SRR12192581.sra SRR ids: ['SRR12192581.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m0ge0dfq SRR12192581.sra spots: 15214176 blocks: [[1, 760708], [760709, 1521416], [1521417, 2282124], [2282125, 3042832], [3042833, 3803540], [3803541, 4564248], [4564249, 5324956], [5324957, 6085664], [6085665, 6846372], [6846373, 7607080], [7607081, 8367788], [8367789, 9128496], [9128497, 9889204], [9889205, 10649912], [10649913, 11410620], [11410621, 12171328], [12171329, 12932036], [12932037, 13692744], [13692745, 14453452], [14453453, 15214176]] SRR12192581 file size 5119027 SRR12192581 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192581 SRR12192581_2.fastq Input file: SRR12192581_2.fastq trimmed: SRR12192581-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Apr 10 13:58:28 2025 >> started Thu Apr 10 13:58:36 2025 >> done (8.822s) 15214176 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 15214176 (100.00%) reads available; of these: 360263 ( 2.37%) trimmed reads available after processing 14853913 (97.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 65 1 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 0 0.00% 70 0 0.00% 71 0 0.00% 72 0 0.00% 73 0 0.00% 74 0 0.00% 75 0 0.00% 76 0 0.00% 77 0 0.00% 78 0 0.00% 79 0 0.00% 80 0 0.00% 81 0 0.00% 82 0 0.00% 83 0 0.00% 84 0 0.00% 85 0 0.00% 86 1 0.00% 87 0 0.00% 88 0 0.00% 89 0 0.00% 90 0 0.00% 91 0 0.00% 92 0 0.00% 93 0 0.00% 94 0 0.00% 95 0 0.00% 96 0 0.00% 97 0 0.00% 98 0 0.00% 99 0 0.00% 100 0 0.00% 101 0 0.00% 102 0 0.00% 103 0 0.00% 104 0 0.00% 105 0 0.00% 106 0 0.00% 107 0 0.00% 108 0 0.00% 109 0 0.00% 110 0 0.00% 111 0 0.00% 112 0 0.00% 113 0 0.00% 114 0 0.00% 115 0 0.00% 116 0 0.00% 117 0 0.00% 118 0 0.00% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 1 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 1 0.00% 137 2 0.00% 138 4 0.00% 139 13 0.00% 140 5 0.00% 141 30 0.00% 142 51 0.00% 143 143 0.00% 144 459 0.00% 145 1147 0.01% 146 3502 0.02% 147 12228 0.08% 148 52784 0.35% 149 289891 1.91% 150 14853913 97.63% 15214176 reads passed initial QC criterion=sequence-density sequence-density=1.79 sequence-density-rank=1 fanout-score=80.98 fanout-score-rank=1 prefix-density=3.21 prefix-fanout=45.3 sequence=AGATCGGAAGAGCGTC criterion=fanout-score sequence-density=1.79 sequence-density-rank=1 fanout-score=80.98 fanout-score-rank=1 prefix-density=3.21 prefix-fanout=45.3 sequence=AGATCGGAAGAGCGTC Started job on | Apr 10 13:59:10 Started mapping on | Apr 10 13:59:10 Finished on | Apr 10 14:00:31 Mapping speed, Million of reads per hour | 676.19 Number of input reads | 15214176 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 12152932 Uniquely mapped reads % | 79.88% Average mapped length | 148.74 Number of splices: Total | 6271053 Number of splices: Annotated (sjdb) | 6107390 Number of splices: GT/AG | 6170319 Number of splices: GC/AG | 81535 Number of splices: AT/AC | 4683 Number of splices: Non-canonical | 14516 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.01% Deletion average length | 2.73 Insertion rate per base | 0.01% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 505761 % of reads mapped to multiple loci | 3.32% Number of reads mapped to too many loci | 251925 % of reads mapped to too many loci | 1.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.08% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2555483 2555483 2555483 N_multimapping 505761 505761 505761 N_noFeature 408820 6178301 6342148 N_ambiguous 78983 19468 18438 UnstrandedReadsAssigned:11665129 PositiveStrandReadsAssigned:5955163 NegativeStrandReadsAssigned:5792346 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192581 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192581-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,214,176 reads, 12,367,653 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR12192581.ke.tsv 34699 SRR12192581.se.tsv 87100 total ==> SRR12192581.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2250.41 123.139 Potri.005G024800.1.v4.1 1035 936 755 84.6992 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 428.256 15.8118 Potri.016G087400.1.v4.1 270 171 652 400.368 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 353 22.1425 Potri.012G127500.1.v4.1 977 878 563 67.3321 ==> SRR12192581.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 160 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 0 SRR12192581 completed mapping pipeline successfully