Starting /dee2/code/volunteer_pipeline.sh SRR12192582 current disk space = 3119735349248 free memory = 1582538848 SRR12192582 SRAfilesize ea67b6a8e86aa7ac311fd4c18350ed15 SRR12192582.sra SRR12192582.sra file validated SRR12192582 is single end SRR12192582 is conventional basespace SRR12192582 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192582_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.9875 32.0 2.0 32.0 2.0 32.0 2 31.64875 32.0 32.0 32.0 32.0 32.0 3 34.63125 37.0 32.0 37.0 32.0 37.0 4 36.25 37.0 37.0 37.0 32.0 37.0 5 36.59 37.0 37.0 37.0 37.0 37.0 6 40.227 41.0 41.0 41.0 37.0 41.0 7 40.4195 41.0 41.0 41.0 41.0 41.0 8 40.342 41.0 41.0 41.0 41.0 41.0 9 40.30975 41.0 41.0 41.0 41.0 41.0 10-14 40.453649999999996 41.0 41.0 41.0 41.0 41.0 15-19 40.3697 41.0 41.0 41.0 41.0 41.0 20-24 40.4151 41.0 41.0 41.0 41.0 41.0 25-29 40.38935 41.0 41.0 41.0 41.0 41.0 30-34 40.2036 41.0 41.0 41.0 39.4 41.0 35-39 40.33875 41.0 41.0 41.0 41.0 41.0 40-44 40.254000000000005 41.0 41.0 41.0 40.2 41.0 45-49 40.32155 41.0 41.0 41.0 41.0 41.0 50-54 40.21155 41.0 41.0 41.0 39.4 41.0 55-59 40.19135 41.0 41.0 41.0 40.2 41.0 60-64 40.075199999999995 41.0 41.0 41.0 39.4 41.0 65-69 40.024 41.0 41.0 41.0 37.0 41.0 70-74 40.035250000000005 41.0 41.0 41.0 37.0 41.0 75-79 39.765499999999996 41.0 40.2 41.0 37.0 41.0 80-84 40.129599999999996 41.0 41.0 41.0 38.6 41.0 85-89 40.08515 41.0 41.0 41.0 37.8 41.0 90-94 40.0964 41.0 41.0 41.0 38.6 41.0 95-99 39.990750000000006 41.0 41.0 41.0 37.0 41.0 100-104 39.99665 41.0 41.0 41.0 37.0 41.0 105-109 39.9231 41.0 41.0 41.0 37.0 41.0 110-114 39.723200000000006 41.0 41.0 41.0 37.0 41.0 115-119 39.81805 41.0 41.0 41.0 37.0 41.0 120-124 39.629149999999996 41.0 41.0 41.0 37.0 41.0 125-129 39.41925 41.0 41.0 41.0 37.0 41.0 130-134 39.287400000000005 41.0 41.0 41.0 37.0 41.0 135-139 39.190749999999994 41.0 41.0 41.0 37.0 41.0 140-144 39.065000000000005 41.0 41.0 41.0 37.0 41.0 145-149 38.852050000000006 41.0 40.2 41.0 34.0 41.0 150 38.7255 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 4.0 25 1.0 26 5.0 27 2.0 28 11.0 29 14.0 30 20.0 31 21.0 32 22.0 33 26.0 34 49.0 35 59.0 36 87.0 37 124.0 38 185.0 39 517.0 40 2853.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.33555308916019 14.021457639659637 10.987791342952276 43.65519792822789 2 25.05 20.25 32.025 22.675 3 26.1 23.35 23.775 26.775 4 27.956989247311824 28.157039259814955 19.02975743935984 24.85621405351338 5 27.750000000000004 31.85 20.1 20.3 6 22.875 33.5 21.15 22.475 7 19.950000000000003 17.95 38.7 23.400000000000002 8 21.099999999999998 22.8 28.199999999999996 27.900000000000002 9 21.975 22.275 30.875000000000004 24.875 10-14 24.425 26.575 25.014999999999997 23.985 15-19 25.005 24.755 25.64 24.6 20-24 24.465 25.405 26.035000000000004 24.095 25-29 24.735 25.185000000000002 25.945 24.135 30-34 23.79 25.615 25.580000000000002 25.014999999999997 35-39 24.735 25.290000000000003 25.919999999999998 24.055 40-44 24.415 25.115 25.64 24.83 45-49 24.560000000000002 24.884999999999998 25.919999999999998 24.635 50-54 24.94 25.314999999999998 25.5 24.245 55-59 25.615 25.19 25.19 24.005000000000003 60-64 24.62 24.585 25.740000000000002 25.055 65-69 24.54 24.925 25.865 24.67 70-74 24.9 25.119999999999997 25.490000000000002 24.490000000000002 75-79 24.815 24.54 25.495 25.15 80-84 24.305 25.174999999999997 25.575 24.945 85-89 25.005 25.324999999999996 25.330000000000002 24.34 90-94 24.959999999999997 25.085 25.335 24.62 95-99 24.535 24.779999999999998 26.185000000000002 24.5 100-104 24.74984990994597 25.230138082849713 25.500300180108066 24.51971182709626 105-109 24.805 24.935 25.755 24.505 110-114 25.091309351078202 24.190723970580876 26.54725571621554 24.17071096212538 115-119 25.292646323161584 24.412206103051524 25.967983991995997 24.327163581790895 120-124 24.994994994994997 25.21021021021021 25.295295295295293 24.4994994994995 125-129 24.69222300070063 25.287758983084775 25.618056250625564 24.401961765589032 130-134 24.639567480977174 24.814777733279936 26.16139367240689 24.384261113336002 135-139 24.384507606084867 25.775620496397117 25.49039231385108 24.349479583666934 140-144 25.695 25.215 25.135 23.955000000000002 145-149 26.14130706535327 26.421321066053306 23.866193309665483 23.571178558927947 150 25.75 27.55 23.575 23.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 2.0 23 2.0 24 0.5 25 1.0 26 2.5 27 5.0 28 4.5 29 6.0 30 12.0 31 16.0 32 20.0 33 24.5 34 44.5 35 48.5 36 58.5 37 75.0 38 82.0 39 115.5 40 142.5 41 169.0 42 178.0 43 177.0 44 193.5 45 205.0 46 205.0 47 203.0 48 187.0 49 154.0 50 131.0 51 113.0 52 95.5 53 75.0 54 54.5 55 44.0 56 39.5 57 44.0 58 64.0 59 90.0 60 95.5 61 82.0 62 79.5 63 95.0 64 126.5 65 114.5 66 99.5 67 99.0 68 64.5 69 34.5 70 13.0 71 3.5 72 1.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 32.425 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06 105-109 0.0 110-114 0.065 115-119 0.05 120-124 0.1 125-129 0.09 130-134 0.12 135-139 0.08 140-144 0.0 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.225 #Duplication Level Percentage of deduplicated Percentage of total 1 91.58401813544914 80.80000000000001 2 5.724001133465571 10.100000000000001 3 1.643525077925758 4.35 4 0.5100595069424767 1.7999999999999998 5 0.3117030320204024 1.375 6 0.0850099178237461 0.44999999999999996 7 0.028336639274582034 0.17500000000000002 8 0.0850099178237461 0.6 9 0.0 0.0 >10 0.028336639274582034 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTAGAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTC 14 0.35000000000000003 No Hit GGAAATTCGAGCTCCGCTTTACTTGTACAGCTCGTCCATGCCGTGAGTGA 8 0.2 No Hit GCCAAATGTTTGAACGATCGGGGAAATTCGAGCTCCGCTTTACTTGTACA 8 0.2 No Hit AGAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCAC 8 0.2 No Hit CTCTAGAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGT 7 0.17500000000000002 No Hit TAGAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCA 6 0.15 No Hit CCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGG 6 0.15 No Hit GAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACC 6 0.15 No Hit GGGAAATTCGAGCTCCGCTTTACTTGTACAGCTCGTCCATGCCGTGAGTG 5 0.125 No Hit CGGATCTTGAAGTTCACCTTGATGCCGTTCTTCTGCTTGTCGGCCATGAT 5 0.125 No Hit GGGGTAGCGGCTGAAGCACTGCACGCCGTAGGTGAAGGTGGTCACGAGGG 5 0.125 No Hit GGCTGTTGTAGTTGTACTCCAGCTTGTGCCCCAGGATGTTGCCGTCCTCC 5 0.125 No Hit GCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGC 5 0.125 No Hit NGAAATTCGAGCTCCGCTTTACTTGTACAGCTCGTCCATGCCGTGAGTGA 5 0.125 No Hit CTCAGGTAGTGGTTGTCGGGCAGCAGCACGGGGCCGTCGCCGATGGGGGT 5 0.125 No Hit CCAGCTTGTGCCCCAGGATGTTGCCGTCCTCCTTGAAGTCGATGCCCTTC 5 0.125 No Hit ACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACAT 5 0.125 No Hit GGCGGATCTTGAAGTTCACCTTGATGCCGTTCTTCTGCTTGTCGGCCATG 5 0.125 No Hit GATGAACTTCAGGGTCAGCTTGCCGTAGGTGGCATCGCCCTCGCCCTCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.225 0.0 0.0 0.0 0.0 136-137 1.325 0.0 0.0 0.0 0.0 138 2.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866306 READS because READLEN < 1 Read 866306 spots for SRR12192582.sra Written 866306 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192582.sra Written 866300 spots for SRR12192582.sra SRR ids: ['SRR12192582.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6lm88rry SRR12192582.sra spots: 17326006 blocks: [[1, 866300], [866301, 1732600], [1732601, 2598900], [2598901, 3465200], [3465201, 4331500], [4331501, 5197800], [5197801, 6064100], [6064101, 6930400], [6930401, 7796700], [7796701, 8663000], [8663001, 9529300], [9529301, 10395600], [10395601, 11261900], [11261901, 12128200], [12128201, 12994500], [12994501, 13860800], [13860801, 14727100], [14727101, 15593400], [15593401, 16459700], [16459701, 17326006]] SRR12192582 file size 5832594 SRR12192582 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192582 SRR12192582_1.fastq Input file: SRR12192582_1.fastq trimmed: SRR12192582-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 07:23:25 2025 >> started Fri Feb 14 07:23:39 2025 >> done (14.644s) 17326006 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 17326006 (100.00%) reads available; of these: 130255 ( 0.75%) trimmed reads available after processing 17195751 (99.25%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 2 0.00% 30 1 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 0 0.00% 35 0 0.00% 36 1 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 1 0.00% 41 1 0.00% 42 1 0.00% 43 1 0.00% 44 0 0.00% 45 2 0.00% 46 1 0.00% 47 1 0.00% 48 0 0.00% 49 0 0.00% 50 1 0.00% 51 0 0.00% 52 1 0.00% 53 4 0.00% 54 1 0.00% 55 0 0.00% 56 0 0.00% 57 3 0.00% 58 4 0.00% 59 0 0.00% 60 2 0.00% 61 1 0.00% 62 0 0.00% 63 1 0.00% 64 1 0.00% 65 4 0.00% 66 2 0.00% 67 0 0.00% 68 0 0.00% 69 1 0.00% 70 1 0.00% 71 1 0.00% 72 4 0.00% 73 2 0.00% 74 1 0.00% 75 1 0.00% 76 0 0.00% 77 4 0.00% 78 2 0.00% 79 2 0.00% 80 2 0.00% 81 3 0.00% 82 2 0.00% 83 2 0.00% 84 2 0.00% 85 5 0.00% 86 2 0.00% 87 4 0.00% 88 5 0.00% 89 6 0.00% 90 1 0.00% 91 0 0.00% 92 1 0.00% 93 2 0.00% 94 4 0.00% 95 1 0.00% 96 5 0.00% 97 2 0.00% 98 2 0.00% 99 6 0.00% 100 5 0.00% 101 4 0.00% 102 3 0.00% 103 7 0.00% 104 5 0.00% 105 5 0.00% 106 6 0.00% 107 5 0.00% 108 8 0.00% 109 10 0.00% 110 13 0.00% 111 15 0.00% 112 12 0.00% 113 5 0.00% 114 14 0.00% 115 19 0.00% 116 19 0.00% 117 24 0.00% 118 6 0.00% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 2 0.00% 140 5 0.00% 141 15 0.00% 142 32 0.00% 143 68 0.00% 144 173 0.00% 145 441 0.00% 146 1203 0.01% 147 3733 0.02% 148 16272 0.09% 149 108007 0.62% 150 17195751 99.25% 17326006 reads passed initial QC criterion=sequence-density sequence-density=1.86 sequence-density-rank=1 fanout-score=77.10 fanout-score-rank=1 prefix-density=3.33 prefix-fanout=43.0 sequence=AGATCGGAAGAGCACA criterion=fanout-score sequence-density=1.86 sequence-density-rank=1 fanout-score=77.10 fanout-score-rank=1 prefix-density=3.33 prefix-fanout=43.0 sequence=AGATCGGAAGAGCACA Started job on | Feb 14 07:24:13 Started mapping on | Feb 14 07:24:13 Finished on | Feb 14 07:26:45 Mapping speed, Million of reads per hour | 410.35 Number of input reads | 17326006 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 11485478 Uniquely mapped reads % | 66.29% Average mapped length | 148.87 Number of splices: Total | 5555380 Number of splices: Annotated (sjdb) | 5406812 Number of splices: GT/AG | 5462564 Number of splices: GC/AG | 74320 Number of splices: AT/AC | 4543 Number of splices: Non-canonical | 13953 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.76 Insertion rate per base | 0.01% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 530932 % of reads mapped to multiple loci | 3.06% Number of reads mapped to too many loci | 176311 % of reads mapped to too many loci | 1.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 29.60% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5309596 5309596 5309596 N_multimapping 530932 530932 530932 N_noFeature 431555 5991480 5874628 N_ambiguous 87450 18566 18193 UnstrandedReadsAssigned:10966473 PositiveStrandReadsAssigned:5475432 NegativeStrandReadsAssigned:5592657 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192582 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192582-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,326,006 reads, 11,595,647 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR12192582.ke.tsv 34699 SRR12192582.se.tsv 87100 total ==> SRR12192582.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2512 131.811 Potri.005G024800.1.v4.1 1035 936 1055 113.497 Potri.004G059700.1.v4.1 961 862 3 0.350445 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 359.493 12.7282 Potri.016G087400.1.v4.1 270 171 745 438.698 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 211.96 12.7498 Potri.012G127500.1.v4.1 977 878 751 86.1294 ==> SRR12192582.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 198 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 3 SRR12192582 completed mapping pipeline successfully