Starting /dee2/code/volunteer_pipeline.sh SRR12192583 current disk space = 3119407706112 free memory = 1574081104 SRR12192583 SRAfilesize a2d6505c9268caadf53beefb35e3ff91 SRR12192583.sra SRR12192583.sra file validated SRR12192583 is single end SRR12192583 is conventional basespace SRR12192583 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192583_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.66125 27.0 2.0 32.0 2.0 32.0 2 30.15625 32.0 32.0 32.0 27.0 32.0 3 32.25 32.0 32.0 37.0 32.0 37.0 4 34.455 37.0 32.0 37.0 32.0 37.0 5 35.60875 37.0 37.0 37.0 32.0 37.0 6 38.47975 41.0 37.0 41.0 32.0 41.0 7 37.338 41.0 37.0 41.0 32.0 41.0 8 38.448 41.0 37.0 41.0 32.0 41.0 9 39.214 41.0 41.0 41.0 37.0 41.0 10-14 39.45654999999999 41.0 41.0 41.0 37.0 41.0 15-19 39.653 41.0 41.0 41.0 37.0 41.0 20-24 39.7254 41.0 41.0 41.0 37.0 41.0 25-29 39.663 41.0 41.0 41.0 37.0 41.0 30-34 39.4602 41.0 41.0 41.0 37.0 41.0 35-39 39.550200000000004 41.0 41.0 41.0 37.0 41.0 40-44 39.50175 41.0 41.0 41.0 37.0 41.0 45-49 39.209649999999996 41.0 41.0 41.0 37.0 41.0 50-54 39.3403 41.0 41.0 41.0 37.0 41.0 55-59 39.2872 41.0 41.0 41.0 37.0 41.0 60-64 39.2727 41.0 41.0 41.0 37.0 41.0 65-69 39.18245 41.0 41.0 41.0 37.0 41.0 70-74 39.148649999999996 41.0 41.0 41.0 37.0 41.0 75-79 38.887699999999995 41.0 39.4 41.0 35.0 41.0 80-84 39.2355 41.0 41.0 41.0 37.0 41.0 85-89 39.10625 41.0 41.0 41.0 37.0 41.0 90-94 39.14025 41.0 41.0 41.0 37.0 41.0 95-99 38.89445 41.0 40.2 41.0 35.0 41.0 100-104 38.74405 41.0 40.2 41.0 34.0 41.0 105-109 38.48005 41.0 37.0 41.0 33.0 41.0 110-114 38.33795 41.0 37.0 41.0 32.0 41.0 115-119 38.088849999999994 41.0 37.0 41.0 32.0 41.0 120-124 37.78595 41.0 37.0 41.0 31.0 41.0 125-129 37.52235 41.0 37.0 41.0 29.0 41.0 130-134 37.09955 41.0 37.0 41.0 27.0 41.0 135-139 36.32535 41.0 36.0 41.0 27.0 41.0 140-144 35.807 41.0 33.0 41.0 23.0 41.0 145-149 35.3972 41.0 32.0 41.0 22.0 41.0 150 35.0055 41.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 6.0 24 19.0 25 21.0 26 23.0 27 21.0 28 26.0 29 31.0 30 45.0 31 42.0 32 64.0 33 68.0 34 93.0 35 132.0 36 179.0 37 262.0 38 474.0 39 1200.0 40 1292.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.257533145841705 14.423463238248294 11.00843712334271 43.3105664925673 2 23.875 20.974999999999998 31.35 23.799999999999997 3 25.974999999999998 24.675 24.075 25.275 4 27.631907976994246 28.032008002000502 19.529882470617654 24.8062015503876 5 27.956989247311824 32.85821455363841 19.129782445611404 20.05501375343836 6 21.85 35.925000000000004 19.85 22.375 7 20.5 17.825 38.574999999999996 23.1 8 19.85 24.275 26.25 29.625 9 21.725 21.3 30.2 26.775 10-14 23.405 27.49 24.195 24.91 15-19 24.075 26.515 24.68 24.73 20-24 23.435 26.735 24.955 24.875 25-29 24.425 26.085 25.025 24.465 30-34 23.794999999999998 26.32 24.93 24.955 35-39 23.785 26.41 24.92 24.884999999999998 40-44 24.911245562278115 25.371268563428174 24.771238561928097 24.946247312365617 45-49 24.310000000000002 25.525 24.955 25.21 50-54 23.996199809990497 26.111305565278265 24.846242312115603 25.04625231261563 55-59 24.23121156057803 25.481274063703186 25.006250312515625 25.281264063203164 60-64 24.62 25.085 24.91 25.385 65-69 24.7097678142514 26.36108887109688 24.209367493995195 24.719775820656526 70-74 24.21 26.085 24.815 24.89 75-79 24.725 26.340000000000003 24.7 24.235 80-84 24.51 25.96 24.58 24.95 85-89 24.51 26.015 24.37 25.105 90-94 24.695 25.564999999999998 24.84 24.9 95-99 23.945 25.86 25.1 25.095 100-104 24.654999999999998 26.055 24.490000000000002 24.8 105-109 24.529999999999998 25.025 25.230000000000004 25.215 110-114 24.14 25.165 25.509999999999998 25.185000000000002 115-119 25.695 25.064999999999998 24.495 24.745 120-124 24.335 25.91 24.6 25.155 125-129 24.795 25.575 24.560000000000002 25.069999999999997 130-134 24.990000000000002 25.915 24.19 24.905 135-139 24.154999999999998 26.455000000000002 24.415 24.975 140-144 25.41135283820955 26.326581645411352 23.895973993498373 24.36609152288072 145-149 25.681420355088775 26.771692923230805 23.710927731932983 23.835958989747436 150 25.2 27.474999999999998 23.974999999999998 23.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 1.0 24 1.5 25 1.5 26 2.0 27 5.5 28 7.5 29 9.0 30 10.5 31 14.0 32 20.0 33 26.0 34 35.0 35 42.5 36 51.0 37 67.5 38 83.5 39 111.0 40 150.5 41 181.5 42 208.0 43 219.0 44 200.0 45 208.0 46 202.0 47 179.5 48 164.5 49 135.5 50 124.5 51 105.5 52 86.5 53 74.5 54 58.5 55 48.0 56 48.0 57 54.5 58 77.0 59 100.5 60 95.5 61 83.5 62 81.5 63 97.5 64 126.0 65 114.5 66 87.5 67 73.0 68 63.5 69 41.0 70 10.5 71 2.5 72 2.0 73 1.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 37.775 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.005 55-59 0.005 60-64 0.0 65-69 0.08 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.025 145-149 0.025 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.85 #Duplication Level Percentage of deduplicated Percentage of total 1 91.755768148565 81.525 2 5.993247045582442 10.65 3 1.4068655036578503 3.75 4 0.39392234102419804 1.4000000000000001 5 0.14068655036578503 0.625 6 0.14068655036578503 0.75 7 0.056274620146314014 0.35000000000000003 8 0.056274620146314014 0.4 9 0.0 0.0 >10 0.056274620146314014 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTAGAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTC 12 0.3 No Hit GGAAATTCGAGCTCCGCTTTACTTGTACAGCTCGTCCATGCCGTGAGTGA 10 0.25 No Hit GCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTG 8 0.2 No Hit AGAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCAC 8 0.2 No Hit NTAGAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTC 7 0.17500000000000002 No Hit GATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGG 7 0.17500000000000002 No Hit CCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAG 6 0.15 No Hit NGAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCAC 6 0.15 No Hit NGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACG 6 0.15 No Hit NTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGC 6 0.15 No Hit CCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAAC 6 0.15 No Hit CTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGC 5 0.125 No Hit GTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGC 5 0.125 No Hit NTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGT 5 0.125 No Hit NAGGATCCCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACC 5 0.125 No Hit NCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0125 0.0 0.0 0.0 108-109 0.0 0.025 0.0 0.0 0.0 110-111 0.0 0.025 0.0 0.0 0.0 112-113 0.0 0.025 0.0 0.0 0.0 114-115 0.025 0.025 0.0 0.0 0.0 116-117 0.025 0.025 0.0 0.0 0.0 118-119 0.025 0.025 0.0 0.0 0.0 120-121 0.025 0.025 0.0 0.0 0.0 122-123 0.025 0.025 0.0 0.0 0.0 124-125 0.025 0.025 0.0 0.0 0.0 126-127 0.025 0.025 0.0 0.0 0.0 128-129 0.05 0.025 0.0 0.0 0.0 130-131 0.05 0.025 0.0 0.0 0.0 132-133 0.05 0.025 0.0 0.0 0.0 134-135 0.28750000000000003 0.025 0.0 0.0 0.0 136-137 1.3625 0.025 0.0 0.0 0.0 138 2.175 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGCAA 10 0.007030057 143.6125 4 TGTAGCA 10 0.007030057 143.6125 9 ATGTAGC 10 0.007030057 143.6125 8 GGTGCAT 10 0.007030057 143.6125 3 >>END_MODULE Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866306 READS because READLEN < 1 Read 866306 spots for SRR12192583.sra Written 866306 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra Rejected 866300 READS because READLEN < 1 Read 866300 spots for SRR12192583.sra Written 866300 spots for SRR12192583.sra SRR ids: ['SRR12192583.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n5kgpztz SRR12192583.sra spots: 17326006 blocks: [[1, 866300], [866301, 1732600], [1732601, 2598900], [2598901, 3465200], [3465201, 4331500], [4331501, 5197800], [5197801, 6064100], [6064101, 6930400], [6930401, 7796700], [7796701, 8663000], [8663001, 9529300], [9529301, 10395600], [10395601, 11261900], [11261901, 12128200], [12128201, 12994500], [12994501, 13860800], [13860801, 14727100], [14727101, 15593400], [15593401, 16459700], [16459701, 17326006]] SRR12192583 file size 5832594 SRR12192583 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192583 SRR12192583_2.fastq Input file: SRR12192583_2.fastq trimmed: SRR12192583-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 07:33:06 2025 >> started Fri Feb 14 07:33:16 2025 >> done (9.937s) 17326006 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 17326006 (100.00%) reads available; of these: 359520 ( 2.08%) trimmed reads available after processing 16966486 (97.92%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 66 1 0.00% 67 0 0.00% 68 0 0.00% 69 0 0.00% 70 0 0.00% 71 0 0.00% 72 0 0.00% 73 0 0.00% 74 0 0.00% 75 0 0.00% 76 0 0.00% 77 0 0.00% 78 1 0.00% 79 0 0.00% 80 0 0.00% 81 0 0.00% 82 0 0.00% 83 0 0.00% 84 0 0.00% 85 0 0.00% 86 0 0.00% 87 0 0.00% 88 0 0.00% 89 0 0.00% 90 0 0.00% 91 0 0.00% 92 0 0.00% 93 0 0.00% 94 0 0.00% 95 0 0.00% 96 0 0.00% 97 0 0.00% 98 0 0.00% 99 0 0.00% 100 0 0.00% 101 0 0.00% 102 0 0.00% 103 0 0.00% 104 0 0.00% 105 0 0.00% 106 0 0.00% 107 0 0.00% 108 0 0.00% 109 0 0.00% 110 0 0.00% 111 0 0.00% 112 0 0.00% 113 0 0.00% 114 0 0.00% 115 0 0.00% 116 0 0.00% 117 0 0.00% 118 0 0.00% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 1 0.00% 135 2 0.00% 136 2 0.00% 137 5 0.00% 138 1 0.00% 139 7 0.00% 140 21 0.00% 141 30 0.00% 142 71 0.00% 143 199 0.00% 144 461 0.00% 145 1325 0.01% 146 3777 0.02% 147 11792 0.07% 148 51654 0.30% 149 290170 1.67% 150 16966486 97.92% 17326006 reads passed initial QC criterion=sequence-density sequence-density=1.85 sequence-density-rank=1 fanout-score=76.13 fanout-score-rank=2 prefix-density=3.32 prefix-fanout=42.5 sequence=AGATCGGAAGAGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=8 fanout-score=270.19 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=17.6 sequence=TTCTTCTCTTTACCTTGCAGAGTTTAACAAAACCAGCAGCTTAGTATATATATCTTTCTCCTGCATATCAGCCCAATGGCCACCTCCAAGATCTTAGCACCCTTATGTTTGATGGTCCTCGTTTTCGGTCTTTGCTTGTCAATGGTTGAATCTCAAAGTTATGGTGTGTGTGAAGGATTCGATCCTGAAGCACCTCGATGCGCAGTTAGATGCAGCGTTCCTGACTATGTTTGTGGGACTGACGGTGTCACCTACACTTGTGGTTGCAAAGACGCTTTCTGCAATGGTGTTGATGTTGTCAAGAAAGGGAAATGCTAGGCCTGTACATTTGTGTCCATGAAGTGTTAATGCCCGCCCCATCGTCCGCCTCCGTTAATGTCTTCTAGAGTTCAGTAATAACGTGTTTTAGTACCACTTGAAATCATTTCAAGCAGTTTGGATCAGCTGTCTGTTGTTGTT Started job on | Feb 14 07:33:50 Started mapping on | Feb 14 07:33:50 Finished on | Feb 14 07:36:22 Mapping speed, Million of reads per hour | 410.35 Number of input reads | 17326006 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 11440123 Uniquely mapped reads % | 66.03% Average mapped length | 148.74 Number of splices: Total | 5521875 Number of splices: Annotated (sjdb) | 5372066 Number of splices: GT/AG | 5429061 Number of splices: GC/AG | 73086 Number of splices: AT/AC | 4587 Number of splices: Non-canonical | 15141 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.74 Insertion rate per base | 0.01% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 535189 % of reads mapped to multiple loci | 3.09% Number of reads mapped to too many loci | 174634 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 29.83% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5350694 5350694 5350694 N_multimapping 535189 535189 535189 N_noFeature 429304 5869459 5949347 N_ambiguous 86921 18467 18074 UnstrandedReadsAssigned:10923898 PositiveStrandReadsAssigned:5552197 NegativeStrandReadsAssigned:5472702 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192583 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192583-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,326,006 reads, 11,584,956 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 996 rounds 52401 SRR12192583.ke.tsv 34699 SRR12192583.se.tsv 87100 total ==> SRR12192583.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2485 130.517 Potri.005G024800.1.v4.1 1035 936 1049 112.958 Potri.004G059700.1.v4.1 961 862 3 0.350776 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 361.246 12.8023 Potri.016G087400.1.v4.1 270 171 718 423.198 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 211 12.7041 Potri.012G127500.1.v4.1 977 878 745 85.5219 ==> SRR12192583.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 200 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 3 SRR12192583 completed mapping pipeline successfully