Starting /dee2/code/volunteer_pipeline.sh SRR12192584 current disk space = 3085101109248 free memory = 1482505652 SRR12192584 SRAfilesize f4758b11365d586ff16a481285ff8141 SRR12192584.sra SRR12192584.sra file validated SRR12192584 is single end SRR12192584 is conventional basespace SRR12192584 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192584_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.74625 32.0 2.0 32.0 2.0 32.0 2 31.67375 32.0 32.0 32.0 32.0 32.0 3 34.7075 37.0 32.0 37.0 32.0 37.0 4 36.3125 37.0 37.0 37.0 37.0 37.0 5 36.62 37.0 37.0 37.0 37.0 37.0 6 40.249 41.0 41.0 41.0 37.0 41.0 7 40.38825 41.0 41.0 41.0 41.0 41.0 8 40.4615 41.0 41.0 41.0 41.0 41.0 9 40.434 41.0 41.0 41.0 41.0 41.0 10-14 40.44735 41.0 41.0 41.0 40.2 41.0 15-19 40.3658 41.0 41.0 41.0 41.0 41.0 20-24 40.42640000000001 41.0 41.0 41.0 41.0 41.0 25-29 40.38095 41.0 41.0 41.0 40.2 41.0 30-34 40.14450000000001 41.0 41.0 41.0 37.8 41.0 35-39 40.1819 41.0 41.0 41.0 37.8 41.0 40-44 39.98989999999999 41.0 41.0 41.0 37.0 41.0 45-49 39.9962 41.0 41.0 41.0 37.0 41.0 50-54 39.7726 41.0 41.0 41.0 37.0 41.0 55-59 39.5306 41.0 41.0 41.0 37.0 41.0 60-64 39.1314 41.0 41.0 41.0 36.0 41.0 65-69 38.517900000000004 41.0 37.0 41.0 32.0 41.0 70-74 38.343849999999996 41.0 37.0 41.0 32.0 41.0 75-79 37.39545 40.2 36.0 41.0 31.0 41.0 80-84 38.44345 41.0 37.0 41.0 32.0 41.0 85-89 38.825 41.0 37.8 41.0 34.0 41.0 90-94 38.94395 41.0 41.0 41.0 35.0 41.0 95-99 39.046949999999995 41.0 41.0 41.0 36.0 41.0 100-104 39.0816 41.0 41.0 41.0 37.0 41.0 105-109 39.1045 41.0 41.0 41.0 36.0 41.0 110-114 39.0537 41.0 41.0 41.0 35.0 41.0 115-119 39.1974 41.0 41.0 41.0 36.0 41.0 120-124 38.8906 41.0 41.0 41.0 37.0 41.0 125-129 38.8414 41.0 39.4 41.0 35.0 41.0 130-134 38.6045 41.0 37.0 41.0 32.0 41.0 135-139 38.4453 41.0 37.0 41.0 32.0 41.0 140-144 38.49905 41.0 37.0 41.0 33.0 41.0 145-149 38.16725 41.0 37.0 41.0 32.0 41.0 150 38.245 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 3.0 25 8.0 26 7.0 27 14.0 28 18.0 29 16.0 30 16.0 31 28.0 32 44.0 33 48.0 34 67.0 35 96.0 36 145.0 37 172.0 38 392.0 39 1156.0 40 1769.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.759914255091108 16.648803143979993 10.861021793497677 44.73026080743123 2 21.8 21.75 35.475 20.974999999999998 3 23.674999999999997 24.975 26.650000000000002 24.7 4 26.619964973730298 29.772329246935204 20.765574180635475 22.842131598699027 5 25.825 35.449999999999996 21.2 17.525 6 19.55 37.95 22.525000000000002 19.975 7 19.425 18.375 41.0 21.2 8 20.0 24.2 28.449999999999996 27.35 9 22.3 22.15 30.375000000000004 25.174999999999997 10-14 21.785 28.935 26.51 22.770000000000003 15-19 22.36 27.22 27.185 23.235 20-24 22.45 27.185 27.435 22.93 25-29 22.49 27.200000000000003 27.625 22.685 30-34 21.95 27.355 27.384999999999998 23.31 35-39 22.255 27.694999999999997 27.089999999999996 22.96 40-44 22.37 27.450000000000003 27.435 22.745 45-49 22.465 26.91 27.43 23.195 50-54 22.17 27.33 27.48 23.02 55-59 22.365 27.034999999999997 27.62 22.98 60-64 22.56 26.924999999999997 27.05 23.465 65-69 22.720000000000002 27.07 26.995 23.215 70-74 23.119999999999997 27.655 26.674999999999997 22.55 75-79 22.29 27.235 27.555000000000003 22.919999999999998 80-84 22.46 27.310000000000002 27.24 22.99 85-89 22.36 27.134999999999998 27.48 23.025000000000002 90-94 23.23 26.87 27.200000000000003 22.7 95-99 22.81 27.58 27.255000000000003 22.355 100-104 22.601951463597697 27.5806855141356 27.195396547410557 22.62196647485614 105-109 22.645 27.355 27.284999999999997 22.715 110-114 23.197398048536403 27.34550913184889 27.555666750062546 21.901426069552162 115-119 23.31282205212867 27.290009505227875 26.564610535794685 22.832557906848766 120-124 21.96306121427499 27.55393162820962 27.04339556534361 23.43961159217178 125-129 22.21999799819838 27.20448403563207 27.119407466720048 23.456110499449505 130-134 22.426396955738035 26.797516523132387 27.96414980973363 22.811936711395955 135-139 23.08192783143987 27.866473149492016 27.07572193583905 21.97587708322907 140-144 22.96 28.005000000000003 27.055 21.98 145-149 24.31621581079054 28.206410320516024 25.35626781339067 22.121106055302764 150 22.525000000000002 29.825000000000003 25.25 22.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 1.0 23 1.0 24 1.5 25 2.5 26 2.0 27 3.5 28 6.5 29 9.5 30 12.0 31 13.5 32 20.5 33 31.0 34 36.5 35 49.5 36 68.0 37 92.5 38 131.5 39 176.5 40 211.5 41 224.5 42 245.5 43 260.5 44 287.0 45 284.5 46 258.0 47 230.0 48 189.5 49 173.0 50 139.0 51 117.0 52 103.0 53 82.5 54 70.0 55 50.0 56 40.0 57 35.5 58 27.0 59 29.5 60 33.0 61 28.5 62 28.0 63 37.5 64 35.5 65 29.5 66 31.0 67 23.0 68 15.0 69 9.5 70 4.0 71 2.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 30.025000000000002 2 0.0 3 0.0 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.075 105-109 0.0 110-114 0.075 115-119 0.055 120-124 0.105 125-129 0.09 130-134 0.13999999999999999 135-139 0.095 140-144 0.0 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.45 #Duplication Level Percentage of deduplicated Percentage of total 1 97.63981528989225 95.15 2 2.1549512570549 4.2 3 0.1539250897896357 0.44999999999999996 4 0.0513083632632119 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.2125 0.0 0.0 0.0 0.0 136-137 1.0875 0.0 0.0 0.0 0.0 138 1.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804674 READS because READLEN < 1 Read 804674 spots for SRR12192584.sra Written 804674 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192584.sra Written 804661 spots for SRR12192584.sra SRR ids: ['SRR12192584.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v1fs3c6s SRR12192584.sra spots: 16093233 blocks: [[1, 804661], [804662, 1609322], [1609323, 2413983], [2413984, 3218644], [3218645, 4023305], [4023306, 4827966], [4827967, 5632627], [5632628, 6437288], [6437289, 7241949], [7241950, 8046610], [8046611, 8851271], [8851272, 9655932], [9655933, 10460593], [10460594, 11265254], [11265255, 12069915], [12069916, 12874576], [12874577, 13679237], [13679238, 14483898], [14483899, 15288559], [15288560, 16093233]] SRR12192584 file size 5416052 SRR12192584 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192584 SRR12192584_1.fastq Input file: SRR12192584_1.fastq trimmed: SRR12192584-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 06:42:43 2025 >> started Fri Feb 14 06:42:53 2025 >> done (9.598s) 16093233 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 16093233 (100.00%) reads available; of these: 149452 ( 0.93%) trimmed reads available after processing 15943781 (99.07%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 1 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 1 0.00% 39 1 0.00% 40 1 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 1 0.00% 47 0 0.00% 48 1 0.00% 49 1 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 1 0.00% 54 0 0.00% 55 1 0.00% 56 2 0.00% 57 2 0.00% 58 1 0.00% 59 1 0.00% 60 1 0.00% 61 0 0.00% 62 0 0.00% 63 1 0.00% 64 1 0.00% 65 0 0.00% 66 4 0.00% 67 2 0.00% 68 2 0.00% 69 0 0.00% 70 1 0.00% 71 2 0.00% 72 3 0.00% 73 0 0.00% 74 0 0.00% 75 3 0.00% 76 2 0.00% 77 1 0.00% 78 3 0.00% 79 0 0.00% 80 1 0.00% 81 1 0.00% 82 2 0.00% 83 2 0.00% 84 1 0.00% 85 2 0.00% 86 1 0.00% 87 1 0.00% 88 4 0.00% 89 3 0.00% 90 2 0.00% 91 2 0.00% 92 2 0.00% 93 3 0.00% 94 2 0.00% 95 6 0.00% 96 4 0.00% 97 6 0.00% 98 4 0.00% 99 2 0.00% 100 5 0.00% 101 3 0.00% 102 12 0.00% 103 4 0.00% 104 7 0.00% 105 10 0.00% 106 8 0.00% 107 10 0.00% 108 11 0.00% 109 12 0.00% 110 11 0.00% 111 16 0.00% 112 10 0.00% 113 15 0.00% 114 9 0.00% 115 24 0.00% 116 21 0.00% 117 29 0.00% 118 9 0.00% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 1 0.00% 138 1 0.00% 139 5 0.00% 140 16 0.00% 141 24 0.00% 142 55 0.00% 143 102 0.00% 144 278 0.00% 145 584 0.00% 146 1451 0.01% 147 4667 0.03% 148 18758 0.12% 149 123189 0.77% 150 15943781 99.07% 16093233 reads passed initial QC criterion=sequence-density sequence-density=1.37 sequence-density-rank=1 fanout-score=75.27 fanout-score-rank=2 prefix-density=2.50 prefix-fanout=41.3 sequence=AGATCGGAAGAGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=107.91 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=9.4 sequence=TCTTTTTCTTCGAATAAATTCATGGCAGATGACAAGGGTTTATTAGAATATGTTAGAAAATCAACCCCGCCACCTTTTTTATTAAAAACCTACATGTTAGTGGAGGATCTGGCGACCGATGATGTGATATCATGGAACGGGGAGGGGACCGGATTTGTGGTGTGGCAGCCGGCAGAGTTCTCTCGTGATCTCCTACCAACACTCTTCAAGCATAGCAATTTCTCTAGCTTTGTCCGGCAACTCAATACTTATGGTTTTCGAAAAGTTGCAACGAGCCGGTGGGAGTTTTGCAATGACATGTTTCGGAAGGGAGAAAGAGAGCTACTACGCCAAATTCGTCGAAGAAAAGCTTGGACTAACAAGCAACAACCTATTGCACCGTTAATTCAAGTCGCACCACAAGAGTTTGAAGAAGATCAAAGATCATCATCCACTTTATCATCGTCCGAATACACTTCTCTAGTTGATGAAAATAAACGACTCAAGAAAGAAAATGGGGTCTTGAGCACTG Started job on | Feb 14 06:43:19 Started mapping on | Feb 14 06:43:19 Finished on | Feb 14 06:44:28 Mapping speed, Million of reads per hour | 839.65 Number of input reads | 16093233 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 13277841 Uniquely mapped reads % | 82.51% Average mapped length | 148.85 Number of splices: Total | 6188942 Number of splices: Annotated (sjdb) | 6025897 Number of splices: GT/AG | 6094849 Number of splices: GC/AG | 75250 Number of splices: AT/AC | 4272 Number of splices: Non-canonical | 14571 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1073795 % of reads mapped to multiple loci | 6.67% Number of reads mapped to too many loci | 102127 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.16% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1741597 1741597 1741597 N_multimapping 1073795 1073795 1073795 N_noFeature 492574 6925125 6802627 N_ambiguous 87314 22327 22556 UnstrandedReadsAssigned:12697953 PositiveStrandReadsAssigned:6330389 NegativeStrandReadsAssigned:6452658 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192584 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192584-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,093,233 reads, 13,818,504 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,007 rounds 52401 SRR12192584.ke.tsv 34699 SRR12192584.se.tsv 87100 total ==> SRR12192584.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 6421.48 315.621 Potri.005G024800.1.v4.1 1035 936 371 37.3856 Potri.004G059700.1.v4.1 961 862 2 0.218841 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 141 4.67623 Potri.016G087400.1.v4.1 270 171 341 188.09 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 192 10.8181 Potri.012G127500.1.v4.1 977 878 2007 215.605 ==> SRR12192584.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 104 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 9 Potri.001G452600.v4.1 6 SRR12192584 completed mapping pipeline successfully