Starting /dee2/code/volunteer_pipeline.sh SRR12192585 current disk space = 3085101289472 free memory = 1449537412 SRR12192585 SRAfilesize a3b440f1c99d7de0b0687d53cdf647b0 SRR12192585.sra SRR12192585.sra file validated SRR12192585 is single end SRR12192585 is conventional basespace SRR12192585 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192585_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.66125 32.0 2.0 32.0 2.0 32.0 2 30.90125 32.0 32.0 32.0 32.0 32.0 3 33.49875 32.0 32.0 37.0 32.0 37.0 4 35.24625 37.0 37.0 37.0 32.0 37.0 5 35.9275 37.0 37.0 37.0 37.0 37.0 6 39.011 41.0 41.0 41.0 37.0 41.0 7 39.214 41.0 41.0 41.0 37.0 41.0 8 39.24475 41.0 41.0 41.0 37.0 41.0 9 38.9775 41.0 41.0 41.0 37.0 41.0 10-14 39.237049999999996 41.0 41.0 41.0 37.0 41.0 15-19 39.3657 41.0 41.0 41.0 37.0 41.0 20-24 39.509499999999996 41.0 41.0 41.0 37.0 41.0 25-29 39.083600000000004 41.0 41.0 41.0 37.0 41.0 30-34 38.49615 41.0 38.6 41.0 33.0 41.0 35-39 38.810249999999996 41.0 40.2 41.0 35.0 41.0 40-44 38.77145 41.0 41.0 41.0 34.0 41.0 45-49 38.91245 41.0 41.0 41.0 35.0 41.0 50-54 39.010850000000005 41.0 41.0 41.0 35.0 41.0 55-59 38.94315 41.0 41.0 41.0 34.0 41.0 60-64 39.05365 41.0 41.0 41.0 37.0 41.0 65-69 38.6815 41.0 41.0 41.0 33.0 41.0 70-74 38.69895 41.0 40.2 41.0 32.0 41.0 75-79 38.40875 41.0 39.4 41.0 32.0 41.0 80-84 38.83905 41.0 41.0 41.0 33.0 41.0 85-89 38.759550000000004 41.0 41.0 41.0 32.0 41.0 90-94 38.79344999999999 41.0 40.2 41.0 32.0 41.0 95-99 38.56625 41.0 37.8 41.0 32.0 41.0 100-104 38.31165 41.0 37.0 41.0 32.0 41.0 105-109 38.10825 41.0 37.0 41.0 32.0 41.0 110-114 37.77435 41.0 37.0 41.0 30.0 41.0 115-119 37.591750000000005 41.0 37.0 41.0 31.0 41.0 120-124 37.2674 41.0 37.0 41.0 28.0 41.0 125-129 36.88785 41.0 37.0 41.0 27.0 41.0 130-134 36.37845 41.0 34.0 41.0 25.0 41.0 135-139 35.59994999999999 41.0 32.0 41.0 23.0 41.0 140-144 35.10205 39.4 32.0 41.0 22.0 41.0 145-149 34.7273 37.8 32.0 41.0 22.0 41.0 150 34.15275 37.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 11.0 24 12.0 25 20.0 26 20.0 27 30.0 28 46.0 29 44.0 30 56.0 31 73.0 32 75.0 33 102.0 34 115.0 35 173.0 36 217.0 37 288.0 38 519.0 39 1048.0 40 1148.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.982899339292654 17.25612125923047 9.172172561212593 45.58880684026428 2 20.150000000000002 22.375 35.775 21.7 3 22.125 25.25 27.1 25.525 4 25.28132033008252 29.507376844211052 21.205301325331334 24.006001500375092 5 26.825 33.475 20.75 18.95 6 19.175 37.7 22.675 20.45 7 18.25 18.525 41.925000000000004 21.3 8 18.65 22.05 29.549999999999997 29.75 9 19.950000000000003 23.625 30.7 25.724999999999998 10-14 21.775 29.270000000000003 26.13 22.825 15-19 21.795 27.860000000000003 27.145000000000003 23.200000000000003 20-24 22.085 27.63 27.155 23.13 25-29 22.61 27.095000000000002 27.310000000000002 22.985 30-34 22.43 27.415 27.29 22.865 35-39 21.545 27.555000000000003 27.595 23.305 40-44 22.225 27.915 26.985 22.875 45-49 22.655 27.3 27.389999999999997 22.655 50-54 22.33 28.01 27.084999999999997 22.575 55-59 22.216110805540275 27.78638931946597 27.13635681784089 22.86114305715286 60-64 21.82 28.235 27.045 22.900000000000002 65-69 22.27227227227227 27.912912912912912 27.27727727727728 22.53753753753754 70-74 22.63 26.86 27.589999999999996 22.919999999999998 75-79 22.07 27.37 27.925 22.634999999999998 80-84 22.445 27.045 27.425 23.085 85-89 22.475 27.345000000000002 27.16 23.02 90-94 22.595000000000002 27.725 27.189999999999998 22.49 95-99 22.515 28.084999999999997 26.69 22.71 100-104 22.64 27.150000000000002 27.165 23.044999999999998 105-109 22.439999999999998 27.744999999999997 26.995 22.82 110-114 22.8 27.36 27.224999999999998 22.615 115-119 22.97 27.655 27.139999999999997 22.235 120-124 22.55 28.225 26.995 22.23 125-129 22.59 27.195000000000004 27.175 23.04 130-134 22.759999999999998 27.384999999999998 27.560000000000002 22.295 135-139 22.955000000000002 27.089999999999996 26.93 23.025000000000002 140-144 23.211963589076724 27.34320296088827 26.607982394718416 22.836851055316597 145-149 23.76212863859158 27.923377013103934 26.32289686906072 21.991597479243772 150 24.349999999999998 27.0 26.900000000000002 21.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 2.0 24 2.5 25 1.0 26 2.0 27 6.0 28 8.0 29 5.0 30 10.0 31 16.5 32 18.5 33 29.0 34 52.0 35 71.0 36 79.0 37 96.0 38 134.5 39 169.5 40 199.0 41 235.5 42 261.5 43 262.5 44 261.0 45 261.0 46 254.5 47 237.5 48 217.0 49 184.5 50 143.0 51 115.5 52 90.5 53 82.5 54 64.5 55 44.0 56 41.5 57 35.0 58 32.0 59 30.0 60 23.5 61 30.0 62 32.0 63 28.0 64 26.0 65 22.0 66 24.5 67 23.5 68 16.5 69 9.0 70 4.0 71 1.0 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 35.675000000000004 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.1 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.03 145-149 0.03 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 97.85166240409208 95.65 2 1.9948849104859334 3.9 3 0.1534526854219949 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.23750000000000002 0.0 0.0 0.0 0.0 136-137 1.1125 0.0 0.0 0.0 0.0 138 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTTGA 10 0.007044714 143.5125 4 >>END_MODULE Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804674 READS because READLEN < 1 Read 804674 spots for SRR12192585.sra Written 804674 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra Rejected 804661 READS because READLEN < 1 Read 804661 spots for SRR12192585.sra Written 804661 spots for SRR12192585.sra SRR ids: ['SRR12192585.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4_o2yvu7 SRR12192585.sra spots: 16093233 blocks: [[1, 804661], [804662, 1609322], [1609323, 2413983], [2413984, 3218644], [3218645, 4023305], [4023306, 4827966], [4827967, 5632627], [5632628, 6437288], [6437289, 7241949], [7241950, 8046610], [8046611, 8851271], [8851272, 9655932], [9655933, 10460593], [10460594, 11265254], [11265255, 12069915], [12069916, 12874576], [12874577, 13679237], [13679238, 14483898], [14483899, 15288559], [15288560, 16093233]] SRR12192585 file size 5416052 SRR12192585 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192585 SRR12192585_2.fastq Input file: SRR12192585_2.fastq trimmed: SRR12192585-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 06:48:14 2025 >> started Fri Feb 14 06:48:23 2025 >> done (9.152s) 16093233 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 16093233 (100.00%) reads available; of these: 331333 ( 2.06%) trimmed reads available after processing 15761900 (97.94%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 134 1 0.00% 135 1 0.00% 136 0 0.00% 137 1 0.00% 138 7 0.00% 139 11 0.00% 140 21 0.00% 141 35 0.00% 142 87 0.00% 143 217 0.00% 144 461 0.00% 145 1255 0.01% 146 3553 0.02% 147 11556 0.07% 148 49323 0.31% 149 264804 1.65% 150 15761900 97.94% 16093233 reads passed initial QC criterion=sequence-density sequence-density=1.36 sequence-density-rank=1 fanout-score=73.53 fanout-score-rank=3 prefix-density=2.48 prefix-fanout=40.4 sequence=AGATCGGAAGAGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=136.38 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.5 sequence=TCTTTTTCTTCGAATAAATTCATGGCAGATGACAAGGGTTTATTAGAATATGTTAGAAAATCAACCCCGCCACCTTTTTTATTAAAAACCTACATGTTAGTGGAGGATCTGGCGACCGATGATGTGATATCATGGAACGGGGAGGGGACCGGATTTGTGGTGTGGCAGCCGGCAGAGTTCTCTCGTGATCTCCTACCAACACTCTTCAAGCATAGCAATTTCTCTAGCTTTGTCCGGCAACTCAATACTTATGGTTTTCGAAAAGTTGCAACGAGCCGGTGGGAGTTTTGCAATGACATGTTTCGGAAGGGAGAAAGAGAGCTACTACGCCAAATTCGTCGAAGAAAAGCTTGGACTAACAAGCAACAACCTATTGCACCGTTAATTCAAGTCGCACCACAAGAGTTTGAAGAAGATCAAAGATCATCATCCACTTTATCATCGTCCGAATACACTTCTCTAGTTGATGAAAATAAACGACTCAAGAAAGAAAATGGGGTCTTGAGCACTG Started job on | Feb 14 06:48:58 Started mapping on | Feb 14 06:48:58 Finished on | Feb 14 06:50:08 Mapping speed, Million of reads per hour | 827.65 Number of input reads | 16093233 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 13222985 Uniquely mapped reads % | 82.16% Average mapped length | 148.71 Number of splices: Total | 6135461 Number of splices: Annotated (sjdb) | 5971554 Number of splices: GT/AG | 6042050 Number of splices: GC/AG | 73986 Number of splices: AT/AC | 4177 Number of splices: Non-canonical | 15248 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1084023 % of reads mapped to multiple loci | 6.74% Number of reads mapped to too many loci | 101201 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.42% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1786225 1786225 1786225 N_multimapping 1084023 1084023 1084023 N_noFeature 491211 6822501 6849263 N_ambiguous 87081 22823 22079 UnstrandedReadsAssigned:12644693 PositiveStrandReadsAssigned:6377661 NegativeStrandReadsAssigned:6351643 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192585 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192585-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,093,233 reads, 13,788,548 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR12192585.ke.tsv 34699 SRR12192585.se.tsv 87100 total ==> SRR12192585.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 6415.96 316.254 Potri.005G024800.1.v4.1 1035 936 366 36.9875 Potri.004G059700.1.v4.1 961 862 2 0.219469 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 144.107 4.79297 Potri.016G087400.1.v4.1 270 171 339.634 187.873 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 187 10.5666 Potri.012G127500.1.v4.1 977 878 2007 216.223 ==> SRR12192585.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 102 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 10 Potri.001G452600.v4.1 6 SRR12192585 completed mapping pipeline successfully