Starting /dee2/code/volunteer_pipeline.sh SRR12192586 current disk space = 3118813138944 free memory = 1582256688 SRR12192586 SRAfilesize aa6b26ad0f28e2a2f3670610f10f7784 SRR12192586.sra SRR12192586.sra file validated SRR12192586 is single end SRR12192586 is conventional basespace SRR12192586 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192586_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.47 32.0 2.0 32.0 2.0 32.0 2 31.64125 32.0 32.0 32.0 32.0 32.0 3 34.71375 37.0 32.0 37.0 32.0 37.0 4 36.30125 37.0 37.0 37.0 37.0 37.0 5 36.605 37.0 37.0 37.0 37.0 37.0 6 40.2925 41.0 41.0 41.0 37.0 41.0 7 40.2915 41.0 41.0 41.0 37.0 41.0 8 40.48375 41.0 41.0 41.0 41.0 41.0 9 40.36325 41.0 41.0 41.0 41.0 41.0 10-14 40.41575 41.0 41.0 41.0 40.2 41.0 15-19 40.31365 41.0 41.0 41.0 40.2 41.0 20-24 40.346 41.0 41.0 41.0 41.0 41.0 25-29 40.36185 41.0 41.0 41.0 41.0 41.0 30-34 40.208999999999996 41.0 41.0 41.0 39.4 41.0 35-39 40.278099999999995 41.0 41.0 41.0 40.2 41.0 40-44 40.2525 41.0 41.0 41.0 40.2 41.0 45-49 40.25915 41.0 41.0 41.0 40.2 41.0 50-54 40.16255 41.0 41.0 41.0 38.6 41.0 55-59 40.21865 41.0 41.0 41.0 40.2 41.0 60-64 40.0426 41.0 41.0 41.0 37.0 41.0 65-69 40.003049999999995 41.0 41.0 41.0 37.0 41.0 70-74 39.952 41.0 41.0 41.0 37.0 41.0 75-79 39.6276 41.0 40.2 41.0 37.0 41.0 80-84 40.03465 41.0 41.0 41.0 37.0 41.0 85-89 40.087450000000004 41.0 41.0 41.0 37.0 41.0 90-94 40.030049999999996 41.0 41.0 41.0 37.0 41.0 95-99 39.861450000000005 41.0 41.0 41.0 37.0 41.0 100-104 39.917449999999995 41.0 41.0 41.0 37.0 41.0 105-109 39.7961 41.0 41.0 41.0 37.0 41.0 110-114 39.55055 41.0 41.0 41.0 37.0 41.0 115-119 39.5945 41.0 41.0 41.0 37.0 41.0 120-124 39.356399999999994 41.0 41.0 41.0 37.0 41.0 125-129 39.1613 41.0 41.0 41.0 37.0 41.0 130-134 38.94055 41.0 41.0 41.0 36.0 41.0 135-139 38.821799999999996 41.0 40.2 41.0 36.0 41.0 140-144 38.6626 41.0 38.6 41.0 33.0 41.0 145-149 38.467600000000004 41.0 37.0 41.0 32.0 41.0 150 38.17275 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 2.0 26 7.0 27 6.0 28 6.0 29 13.0 30 18.0 31 16.0 32 26.0 33 30.0 34 52.0 35 66.0 36 104.0 37 138.0 38 241.0 39 639.0 40 2635.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.533379215416378 15.17549896765313 14.143152099105299 45.147969717825184 2 20.375 20.325 37.625 21.675 3 23.549999999999997 24.375 28.000000000000004 24.075 4 24.275 29.875 21.575 24.275 5 24.6 34.325 22.675 18.4 6 19.35 37.4 23.150000000000002 20.1 7 17.150000000000002 18.2 43.675000000000004 20.974999999999998 8 18.9 23.1 30.65 27.35 9 19.7 22.825 32.824999999999996 24.65 10-14 21.275 28.470000000000002 26.784999999999997 23.47 15-19 22.134999999999998 27.33 27.18 23.355 20-24 21.55 27.950000000000003 27.265 23.235 25-29 22.09 27.694999999999997 27.334999999999997 22.88 30-34 22.685 27.215 26.625 23.474999999999998 35-39 22.145 27.465 27.73 22.66 40-44 22.869999999999997 27.205000000000002 26.905 23.02 45-49 22.74 26.555 27.48 23.225 50-54 21.68 27.68 27.6 23.04 55-59 22.045 27.62 27.37 22.965 60-64 22.245 26.640000000000004 28.244999999999997 22.869999999999997 65-69 22.869999999999997 27.66 26.71 22.759999999999998 70-74 22.62 27.185 27.405 22.79 75-79 22.245 27.11 27.224999999999998 23.419999999999998 80-84 22.39 27.67 27.21 22.73 85-89 22.34 27.805000000000003 27.165 22.689999999999998 90-94 22.61 27.595 27.425 22.37 95-99 22.55 27.04 28.095 22.314999999999998 100-104 22.21499674853684 26.922114951728275 28.167675453954278 22.695212845780603 105-109 23.044999999999998 27.034999999999997 27.389999999999997 22.53 110-114 22.88144072036018 27.688844422211105 26.66833416708354 22.761380690345174 115-119 22.925731432858214 27.196799199799948 27.16679169792448 22.710677669417354 120-124 22.52851711026616 27.751650990594356 27.176305783470085 22.5435261156694 125-129 22.72022410084538 26.782051923365515 27.917562903306486 22.580161072482618 130-134 23.48291560358197 26.829756366001302 27.194957226474557 22.49237080394217 135-139 23.056917075122538 27.443232969890968 26.778033410023006 22.721816544963488 140-144 23.145 27.400000000000002 26.645000000000003 22.81 145-149 23.525 28.26 26.715 21.5 150 22.15 27.775 26.775 23.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 1.0 24 1.0 25 2.0 26 3.5 27 4.5 28 7.0 29 8.5 30 15.5 31 20.0 32 23.5 33 32.5 34 46.5 35 65.0 36 77.0 37 100.5 38 131.5 39 167.0 40 216.5 41 239.5 42 254.5 43 264.0 44 266.5 45 265.5 46 247.0 47 228.5 48 201.0 49 169.0 50 139.0 51 118.5 52 100.0 53 75.0 54 50.0 55 44.0 56 42.5 57 32.5 58 28.0 59 28.0 60 28.5 61 25.5 62 20.0 63 34.0 64 45.0 65 32.5 66 29.0 67 28.5 68 17.5 69 9.5 70 5.0 71 0.5 72 1.0 73 1.0 74 0.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 27.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.045 105-109 0.0 110-114 0.05 115-119 0.025 120-124 0.06 125-129 0.045 130-134 0.055 135-139 0.03 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.4034401876466 92.475 2 3.2577534532186605 6.25 3 0.18243419338024497 0.525 4 0.10424811050299713 0.4 5 0.0 0.0 6 0.026062027625749284 0.15 7 0.0 0.0 8 0.026062027625749284 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGT 8 0.2 No Hit TCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.025 0.0 0.0 0.0 2 0.0 0.025 0.0 0.0 0.0 3 0.0 0.025 0.0 0.0 0.0 4 0.0 0.025 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88-89 0.0 0.025 0.0 0.0 0.0 90-91 0.0 0.025 0.0 0.0 0.0 92-93 0.0 0.025 0.0 0.0 0.0 94-95 0.0 0.025 0.0 0.0 0.0 96-97 0.0 0.025 0.0 0.0 0.0 98-99 0.0 0.025 0.0 0.0 0.0 100-101 0.0 0.025 0.0 0.0 0.0 102-103 0.0 0.025 0.0 0.0 0.0 104-105 0.0 0.025 0.0 0.0 0.0 106-107 0.0 0.025 0.0 0.0 0.0 108-109 0.0 0.025 0.0 0.0 0.0 110-111 0.0 0.025 0.0 0.0 0.0 112-113 0.0 0.025 0.0 0.0 0.0 114-115 0.0 0.025 0.0 0.0 0.0 116-117 0.0 0.025 0.0 0.0 0.0 118-119 0.0 0.025 0.0 0.0 0.0 120-121 0.0 0.025 0.0 0.0 0.0 122-123 0.0 0.025 0.0 0.0 0.0 124-125 0.0 0.025 0.0 0.0 0.0 126-127 0.0 0.025 0.0 0.0 0.0 128-129 0.0 0.025 0.0 0.0 0.0 130-131 0.0 0.025 0.0 0.0 0.0 132-133 0.0 0.025 0.0 0.0 0.0 134-135 0.175 0.025 0.0 0.0 0.0 136-137 0.8375 0.025 0.0 0.0 0.0 138 1.275 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCTCT 10 0.007079686 143.275 5 >>END_MODULE Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745047 READS because READLEN < 1 Read 745047 spots for SRR12192586.sra Written 745047 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192586.sra Written 745030 spots for SRR12192586.sra SRR ids: ['SRR12192586.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_06oodbnx SRR12192586.sra spots: 14900617 blocks: [[1, 745030], [745031, 1490060], [1490061, 2235090], [2235091, 2980120], [2980121, 3725150], [3725151, 4470180], [4470181, 5215210], [5215211, 5960240], [5960241, 6705270], [6705271, 7450300], [7450301, 8195330], [8195331, 8940360], [8940361, 9685390], [9685391, 10430420], [10430421, 11175450], [11175451, 11920480], [11920481, 12665510], [12665511, 13410540], [13410541, 14155570], [14155571, 14900617]] SRR12192586 file size 5013078 SRR12192586 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192586 SRR12192586_1.fastq Input file: SRR12192586_1.fastq trimmed: SRR12192586-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 07:55:50 2025 >> started Fri Feb 14 07:55:59 2025 >> done (8.180s) 14900617 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 14900617 (100.00%) reads available; of these: 94116 ( 0.63%) trimmed reads available after processing 14806501 (99.37%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 1 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 1 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 1 0.00% 49 0 0.00% 50 1 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 1 0.00% 57 0 0.00% 58 2 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 1 0.00% 64 2 0.00% 65 1 0.00% 66 1 0.00% 67 0 0.00% 68 2 0.00% 69 0 0.00% 70 1 0.00% 71 0 0.00% 72 0 0.00% 73 1 0.00% 74 1 0.00% 75 1 0.00% 76 1 0.00% 77 2 0.00% 78 2 0.00% 79 3 0.00% 80 2 0.00% 81 0 0.00% 82 1 0.00% 83 2 0.00% 84 1 0.00% 85 2 0.00% 86 0 0.00% 87 2 0.00% 88 0 0.00% 89 1 0.00% 90 2 0.00% 91 1 0.00% 92 3 0.00% 93 0 0.00% 94 3 0.00% 95 1 0.00% 96 1 0.00% 97 2 0.00% 98 2 0.00% 99 1 0.00% 100 0 0.00% 101 3 0.00% 102 1 0.00% 103 0 0.00% 104 2 0.00% 105 3 0.00% 106 4 0.00% 107 8 0.00% 108 3 0.00% 109 5 0.00% 110 5 0.00% 111 4 0.00% 112 6 0.00% 113 9 0.00% 114 6 0.00% 115 7 0.00% 116 17 0.00% 117 16 0.00% 118 5 0.00% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 1 0.00% 138 0 0.00% 139 1 0.00% 140 5 0.00% 141 10 0.00% 142 20 0.00% 143 73 0.00% 144 168 0.00% 145 367 0.00% 146 898 0.01% 147 2796 0.02% 148 11948 0.08% 149 77671 0.52% 150 14806501 99.37% 14900617 reads passed initial QC criterion=sequence-density sequence-density=1.08 sequence-density-rank=1 fanout-score=75.00 fanout-score-rank=3 prefix-density=1.95 prefix-fanout=41.4 sequence=AGATCGGAAGAGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=455.89 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=21.0 sequence=TCTTCTCTTTACCTTGCAGAGTTTAACAAAACCAGCAGCTTAGTATATATATCTTTCTCCTGCATATCAGCCCAATGGCCACCTCCAAGATCTTAGCACCCTTATGTTTGATGGTCCTCGTTTTCGGTCTTTGCTTGTCAATGGTTGAATCTCAAAGTTATGGTGTGTGTGAAGGATTCGATCCTGAAGCACCTCGATGCGCAGTTAGATGCAGCGTTCCTGACTATGTTTGTGGGACTGACGGTGTCACCTACACTTGTGGTTGCAAAGACGCTTTCTGCAATGGTGTTGAT Started job on | Feb 14 07:56:25 Started mapping on | Feb 14 07:56:25 Finished on | Feb 14 07:57:20 Mapping speed, Million of reads per hour | 975.31 Number of input reads | 14900617 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 12603072 Uniquely mapped reads % | 84.58% Average mapped length | 148.97 Number of splices: Total | 6179326 Number of splices: Annotated (sjdb) | 6006508 Number of splices: GT/AG | 6082171 Number of splices: GC/AG | 79437 Number of splices: AT/AC | 4500 Number of splices: Non-canonical | 13218 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 660857 % of reads mapped to multiple loci | 4.44% Number of reads mapped to too many loci | 188879 % of reads mapped to too many loci | 1.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.70% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1636688 1636688 1636688 N_multimapping 660857 660857 660857 N_noFeature 509835 6603776 6467935 N_ambiguous 81320 20371 19966 UnstrandedReadsAssigned:12011917 PositiveStrandReadsAssigned:5978925 NegativeStrandReadsAssigned:6115171 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192586 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192586-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,900,617 reads, 12,864,522 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR12192586.ke.tsv 34699 SRR12192586.se.tsv 87100 total ==> SRR12192586.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 4911.45 262.666 Potri.005G024800.1.v4.1 1035 936 534 58.5509 Potri.004G059700.1.v4.1 961 862 1 0.119059 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 330.209 11.9159 Potri.016G087400.1.v4.1 270 171 366 219.661 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 169.901 10.4162 Potri.012G127500.1.v4.1 977 878 684 79.9521 ==> SRR12192586.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 156 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 8 Potri.001G452600.v4.1 1 SRR12192586 completed mapping pipeline successfully