Starting /dee2/code/volunteer_pipeline.sh SRR12192587 current disk space = 3117837025280 free memory = 1582291760 SRR12192587 SRAfilesize 7bc33bf62119cb1b5558111859af9489 SRR12192587.sra SRR12192587.sra file validated SRR12192587 is single end SRR12192587 is conventional basespace SRR12192587 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192587_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.6625 32.0 2.0 32.0 2.0 32.0 2 30.7075 32.0 32.0 32.0 27.0 32.0 3 32.9425 32.0 32.0 37.0 32.0 37.0 4 33.78375 37.0 32.0 37.0 27.0 37.0 5 35.58625 37.0 37.0 37.0 32.0 37.0 6 38.671 41.0 37.0 41.0 32.0 41.0 7 39.11325 41.0 41.0 41.0 37.0 41.0 8 39.2415 41.0 41.0 41.0 37.0 41.0 9 39.51225 41.0 41.0 41.0 37.0 41.0 10-14 39.2179 41.0 41.0 41.0 37.0 41.0 15-19 39.42655 41.0 41.0 41.0 37.0 41.0 20-24 39.4273 41.0 41.0 41.0 37.0 41.0 25-29 39.2923 41.0 41.0 41.0 37.0 41.0 30-34 39.086499999999994 41.0 41.0 41.0 37.0 41.0 35-39 39.20395 41.0 41.0 41.0 37.0 41.0 40-44 39.14555 41.0 41.0 41.0 36.0 41.0 45-49 38.9364 41.0 41.0 41.0 35.0 41.0 50-54 38.83795 41.0 41.0 41.0 32.0 41.0 55-59 38.77475 41.0 41.0 41.0 32.0 41.0 60-64 38.79055 41.0 41.0 41.0 32.0 41.0 65-69 38.583349999999996 41.0 39.4 41.0 32.0 41.0 70-74 38.6875 41.0 41.0 41.0 32.0 41.0 75-79 38.2061 41.0 38.6 41.0 32.0 41.0 80-84 38.866 41.0 40.2 41.0 33.0 41.0 85-89 38.8266 41.0 41.0 41.0 34.0 41.0 90-94 38.7642 41.0 40.2 41.0 32.0 41.0 95-99 38.60355 41.0 38.6 41.0 32.0 41.0 100-104 38.410199999999996 41.0 37.0 41.0 32.0 41.0 105-109 37.98035 41.0 37.0 41.0 32.0 41.0 110-114 37.71 41.0 37.0 41.0 31.0 41.0 115-119 37.54939999999999 41.0 37.0 41.0 32.0 41.0 120-124 37.230650000000004 41.0 37.0 41.0 29.0 41.0 125-129 36.80005 41.0 37.0 41.0 27.0 41.0 130-134 36.1214 41.0 34.0 41.0 25.0 41.0 135-139 35.41675 41.0 32.0 41.0 22.0 41.0 140-144 34.9671 38.6 32.0 41.0 22.0 41.0 145-149 34.4231 37.0 32.0 41.0 20.0 41.0 150 34.06475 37.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 5.0 23 8.0 24 19.0 25 21.0 26 33.0 27 34.0 28 41.0 29 45.0 30 41.0 31 58.0 32 68.0 33 99.0 34 115.0 35 159.0 36 204.0 37 321.0 38 540.0 39 1206.0 40 983.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.118855465884078 13.719735876742481 15.003668378576668 45.15774027879677 2 20.674999999999997 21.6 36.55 21.175 3 24.05 25.474999999999998 26.450000000000003 24.025 4 24.775 29.675 20.25 25.3 5 24.349999999999998 32.875 23.875 18.9 6 19.375 35.675000000000004 24.0 20.95 7 17.75 19.275000000000002 42.625 20.349999999999998 8 18.7 23.849999999999998 31.025000000000002 26.424999999999997 9 20.45 23.150000000000002 31.075000000000003 25.324999999999996 10-14 22.075 28.794999999999998 26.555 22.575 15-19 22.075 26.93 27.595 23.400000000000002 20-24 21.84 27.800000000000004 27.32 23.04 25-29 21.935 27.229999999999997 27.46 23.375 30-34 22.07 27.375 27.51 23.044999999999998 35-39 21.595 27.384999999999998 27.415 23.605 40-44 22.49 27.800000000000004 27.139999999999997 22.57 45-49 22.215 27.779999999999998 26.26 23.745 50-54 22.275 26.775 28.005000000000003 22.945 55-59 21.68 27.685 27.725 22.91 60-64 22.37 27.215 27.315 23.1 65-69 22.893736241745046 26.861116670002 27.22133279967981 23.023814288573146 70-74 21.95 27.68 27.205000000000002 23.165 75-79 21.82 27.155 27.425 23.599999999999998 80-84 22.545 27.76 27.465 22.23 85-89 22.86 27.065 27.365000000000002 22.71 90-94 21.92 27.685 27.474999999999998 22.919999999999998 95-99 22.314999999999998 27.985 27.11 22.59 100-104 22.335 27.865000000000002 26.87 22.93 105-109 22.485 27.35 27.47 22.695 110-114 22.835 27.805000000000003 27.055 22.305 115-119 23.015 27.63 26.740000000000002 22.615 120-124 22.795 27.084999999999997 27.279999999999998 22.84 125-129 22.27 27.445000000000004 27.37 22.915 130-134 23.115 26.724999999999998 27.37 22.79 135-139 22.715 27.43 27.150000000000002 22.705000000000002 140-144 23.086154307715386 27.626381319065953 27.011350567528375 22.276113805690283 145-149 24.001200060003 28.046402320116005 26.18630931546577 21.76608830441522 150 23.25 28.050000000000004 27.0 21.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 2.5 25 2.5 26 2.5 27 3.5 28 4.5 29 7.0 30 15.0 31 22.0 32 24.0 33 29.0 34 43.0 35 56.5 36 89.0 37 122.0 38 144.5 39 175.0 40 203.5 41 233.0 42 238.0 43 247.5 44 252.5 45 263.5 46 251.0 47 222.0 48 215.5 49 190.0 50 148.5 51 115.0 52 102.0 53 78.0 54 54.5 55 41.5 56 33.0 57 30.0 58 33.0 59 35.5 60 33.5 61 27.0 62 26.0 63 29.5 64 35.5 65 37.5 66 28.5 67 19.0 68 15.0 69 9.0 70 2.0 71 0.5 72 0.0 73 0.5 74 1.0 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 31.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.06 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.325 #Duplication Level Percentage of deduplicated Percentage of total 1 96.60005190760447 93.05 2 3.140410070075266 6.05 3 0.12976901116013498 0.375 4 0.10381520892810796 0.4 5 0.02595380223202699 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1625 0.0 0.0 0.0 0.0 136-137 0.775 0.0 0.0 0.0 0.0 138 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTGC 10 0.0070227426 143.6625 4 >>END_MODULE Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745047 READS because READLEN < 1 Read 745047 spots for SRR12192587.sra Written 745047 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra Rejected 745030 READS because READLEN < 1 Read 745030 spots for SRR12192587.sra Written 745030 spots for SRR12192587.sra SRR ids: ['SRR12192587.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zj72m669 SRR12192587.sra spots: 14900617 blocks: [[1, 745030], [745031, 1490060], [1490061, 2235090], [2235091, 2980120], [2980121, 3725150], [3725151, 4470180], [4470181, 5215210], [5215211, 5960240], [5960241, 6705270], [6705271, 7450300], [7450301, 8195330], [8195331, 8940360], [8940361, 9685390], [9685391, 10430420], [10430421, 11175450], [11175451, 11920480], [11920481, 12665510], [12665511, 13410540], [13410541, 14155570], [14155571, 14900617]] SRR12192587 file size 5013078 SRR12192587 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192587 SRR12192587_2.fastq Input file: SRR12192587_2.fastq trimmed: SRR12192587-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 08:28:10 2025 >> started Fri Feb 14 08:28:19 2025 >> done (8.583s) 14900617 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 14900617 (100.00%) reads available; of these: 305523 ( 2.05%) trimmed reads available after processing 14595094 (97.95%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 91 1 0.00% 92 0 0.00% 93 0 0.00% 94 0 0.00% 95 0 0.00% 96 0 0.00% 97 0 0.00% 98 0 0.00% 99 0 0.00% 100 0 0.00% 101 0 0.00% 102 0 0.00% 103 0 0.00% 104 0 0.00% 105 0 0.00% 106 0 0.00% 107 0 0.00% 108 0 0.00% 109 0 0.00% 110 0 0.00% 111 0 0.00% 112 0 0.00% 113 0 0.00% 114 0 0.00% 115 0 0.00% 116 0 0.00% 117 0 0.00% 118 0 0.00% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 2 0.00% 136 2 0.00% 137 2 0.00% 138 4 0.00% 139 6 0.00% 140 9 0.00% 141 26 0.00% 142 68 0.00% 143 169 0.00% 144 440 0.00% 145 1199 0.01% 146 3384 0.02% 147 10819 0.07% 148 45032 0.30% 149 244360 1.64% 150 14595094 97.95% 14900617 reads passed initial QC criterion=sequence-density sequence-density=1.07 sequence-density-rank=1 fanout-score=74.38 fanout-score-rank=4 prefix-density=1.95 prefix-fanout=40.9 sequence=AGATCGGAAGAGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=458.37 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=21.7 sequence=TTCTTCTCTTTACCTTGCAGAGTTTAACAAAACCAGCAGCTTAGTATATATATCTTTCTCCTGCATATCAGCCCAATGGCCACCTCCAAGATCTTAGCACCCTTATGTTTGATGGTCCTCGTTTTCGGTCTTTGCTTGTCAATGGTTGAATCTCAAAGTTATGGTGTGTGTGAAGGATTCGATCCTGAAGCACCTCGATGCGCAGTTAGATGCAGCGTTCCTGACTATGTTTGTGGGACTGACGGTGTCACCTACACTTGTGGTTGCAAAGACGCTTTCTGCAATGGTGTTGAT Started job on | Feb 14 08:28:54 Started mapping on | Feb 14 08:28:55 Finished on | Feb 14 08:29:55 Mapping speed, Million of reads per hour | 894.04 Number of input reads | 14900617 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 12495971 Uniquely mapped reads % | 83.86% Average mapped length | 148.76 Number of splices: Total | 6095263 Number of splices: Annotated (sjdb) | 5921826 Number of splices: GT/AG | 5998147 Number of splices: GC/AG | 77660 Number of splices: AT/AC | 4364 Number of splices: Non-canonical | 15092 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.01% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 668957 % of reads mapped to multiple loci | 4.49% Number of reads mapped to too many loci | 185671 % of reads mapped to too many loci | 1.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.36% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1735689 1735689 1735689 N_multimapping 668957 668957 668957 N_noFeature 502825 6484912 6473098 N_ambiguous 80498 20349 19587 UnstrandedReadsAssigned:11912648 PositiveStrandReadsAssigned:5990710 NegativeStrandReadsAssigned:6003286 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192587 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192587-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,900,617 reads, 12,825,176 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR12192587.ke.tsv 34699 SRR12192587.se.tsv 87100 total ==> SRR12192587.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 4889 262.32 Potri.005G024800.1.v4.1 1035 936 529 58.1925 Potri.004G059700.1.v4.1 961 862 1 0.119448 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 330.208 11.9549 Potri.016G087400.1.v4.1 270 171 362 217.971 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 174 10.7024 Potri.012G127500.1.v4.1 977 878 679 79.6273 ==> SRR12192587.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 158 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 8 Potri.001G452600.v4.1 1 SRR12192587 completed mapping pipeline successfully