Starting /dee2/code/volunteer_pipeline.sh SRR12192588 current disk space = 3119332069376 free memory = 1492313952 SRR12192588 SRAfilesize d598150cfc3d05bf5612070eff8d33c6 SRR12192588.sra SRR12192588.sra file validated SRR12192588 is single end SRR12192588 is conventional basespace SRR12192588 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192588_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.76875 32.0 2.0 32.0 2.0 32.0 2 31.70625 32.0 32.0 32.0 32.0 32.0 3 34.92 37.0 32.0 37.0 32.0 37.0 4 36.24875 37.0 37.0 37.0 32.0 37.0 5 36.64875 37.0 37.0 37.0 37.0 37.0 6 40.338 41.0 41.0 41.0 37.0 41.0 7 40.334 41.0 41.0 41.0 41.0 41.0 8 40.48925 41.0 41.0 41.0 41.0 41.0 9 40.39225 41.0 41.0 41.0 41.0 41.0 10-14 40.433499999999995 41.0 41.0 41.0 41.0 41.0 15-19 40.304 41.0 41.0 41.0 39.4 41.0 20-24 40.347150000000006 41.0 41.0 41.0 41.0 41.0 25-29 40.4091 41.0 41.0 41.0 41.0 41.0 30-34 40.2311 41.0 41.0 41.0 38.6 41.0 35-39 40.36495000000001 41.0 41.0 41.0 40.2 41.0 40-44 40.197900000000004 41.0 41.0 41.0 40.2 41.0 45-49 40.3154 41.0 41.0 41.0 41.0 41.0 50-54 40.2188 41.0 41.0 41.0 40.2 41.0 55-59 40.2335 41.0 41.0 41.0 39.4 41.0 60-64 40.022949999999994 41.0 41.0 41.0 37.8 41.0 65-69 40.039699999999996 41.0 41.0 41.0 37.0 41.0 70-74 40.0195 41.0 41.0 41.0 37.0 41.0 75-79 39.7736 41.0 41.0 41.0 37.0 41.0 80-84 40.1481 41.0 41.0 41.0 38.6 41.0 85-89 40.14125 41.0 41.0 41.0 38.6 41.0 90-94 40.10085 41.0 41.0 41.0 38.6 41.0 95-99 40.0431 41.0 41.0 41.0 37.0 41.0 100-104 40.01455 41.0 41.0 41.0 37.0 41.0 105-109 39.868300000000005 41.0 41.0 41.0 37.0 41.0 110-114 39.65304999999999 41.0 41.0 41.0 37.0 41.0 115-119 39.7923 41.0 41.0 41.0 37.0 41.0 120-124 39.52785 41.0 41.0 41.0 37.0 41.0 125-129 39.39645 41.0 41.0 41.0 37.0 41.0 130-134 39.2303 41.0 41.0 41.0 37.0 41.0 135-139 39.074850000000005 41.0 41.0 41.0 37.0 41.0 140-144 38.96485 41.0 41.0 41.0 36.0 41.0 145-149 38.6733 41.0 41.0 41.0 32.0 41.0 150 38.39525 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 5.0 26 6.0 27 6.0 28 5.0 29 11.0 30 14.0 31 17.0 32 22.0 33 34.0 34 40.0 35 68.0 36 75.0 37 136.0 38 198.0 39 533.0 40 2827.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.716723549488055 13.72013651877133 12.081911262798634 43.48122866894198 2 22.275 20.974999999999998 33.324999999999996 23.425 3 24.224999999999998 22.525000000000002 25.674999999999997 27.575 4 26.450000000000003 29.775000000000002 19.0 24.775 5 25.775 33.875 22.075 18.275 6 21.275 35.325 22.85 20.549999999999997 7 19.275000000000002 18.55 40.275 21.9 8 18.75 24.025 29.475 27.750000000000004 9 21.85 21.55 31.5 25.1 10-14 22.905 27.975 26.13 22.99 15-19 23.080000000000002 26.334999999999997 26.845000000000002 23.74 20-24 22.365 27.575 26.93 23.13 25-29 22.68 27.075 26.46 23.785 30-34 22.95 26.58 26.8 23.669999999999998 35-39 22.21 26.525 27.944999999999997 23.32 40-44 22.689999999999998 26.8 26.740000000000002 23.77 45-49 23.47 26.57 26.615 23.345 50-54 22.785 26.93 27.22 23.064999999999998 55-59 22.57 26.950000000000003 26.91 23.57 60-64 22.915 26.895000000000003 26.41 23.78 65-69 23.175 27.155 26.36 23.31 70-74 23.54 27.525 26.26 22.675 75-79 22.830000000000002 26.924999999999997 26.995 23.25 80-84 22.475 27.04 27.169999999999998 23.315 85-89 23.01 26.939999999999998 26.93 23.119999999999997 90-94 22.93 27.35 26.99 22.73 95-99 23.06 26.69 27.145000000000003 23.105 100-104 22.79253589474211 26.059332632948124 27.685226874781126 23.46290459752864 105-109 23.34 26.665 26.810000000000002 23.185 110-114 22.83984589983489 27.01255816280582 27.122629709311052 23.024966228048232 115-119 23.999599839935975 26.270508203281313 26.735694277711087 22.99419767907163 120-124 22.88360450563204 26.733416770963704 27.2090112640801 23.173967459324153 125-129 22.7611753516544 27.081143314812035 26.69570005506332 23.46198127847024 130-134 22.891747159801813 26.75541764676443 26.83048896451629 23.52234622891747 135-139 23.31865492393915 27.34187349879904 26.566253002401925 22.77321857485989 140-144 24.02 27.415 26.090000000000003 22.475 145-149 24.185000000000002 28.535 24.845 22.435 150 23.325000000000003 28.9 25.85 21.925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 2.5 25 3.0 26 4.0 27 8.0 28 8.5 29 8.5 30 14.0 31 24.0 32 27.5 33 27.0 34 34.5 35 55.5 36 69.5 37 87.0 38 124.5 39 151.5 40 177.0 41 191.5 42 214.5 43 251.0 44 259.5 45 259.0 46 241.0 47 210.0 48 201.0 49 177.0 50 151.0 51 136.0 52 102.0 53 75.5 54 63.0 55 53.5 56 44.0 57 42.5 58 42.0 59 46.0 60 45.5 61 36.0 62 40.0 63 57.0 64 60.0 65 45.0 66 36.0 67 32.0 68 27.0 69 16.0 70 8.5 71 5.5 72 1.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 26.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.055 105-109 0.0 110-114 0.065 115-119 0.04 120-124 0.125 125-129 0.11499999999999999 130-134 0.095 135-139 0.08 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.53972024280813 90.5 2 3.879651623119557 7.35 3 0.3430984428609132 0.975 4 0.13196093956188967 0.5 5 0.0 0.0 6 0.052784375824755876 0.3 7 0.026392187912377938 0.17500000000000002 8 0.026392187912377938 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGT 8 0.2 No Hit GCAAGACCGGCAACAGGATTCAATCTTAAGAAACTTTATTGCCAAATGTT 7 0.17500000000000002 No Hit CTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGT 6 0.15 No Hit TCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.25 0.0 0.0 0.0 0.0 136-137 1.2375 0.0 0.0 0.0 0.0 138 2.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGCAG 10 0.0070190914 143.6875 8 >>END_MODULE Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670458 READS because READLEN < 1 Read 670458 spots for SRR12192588.sra Written 670458 spots for SRR12192588.sra Rejected 670463 READS because READLEN < 1 Read 670463 spots for SRR12192588.sra Written 670463 spots for SRR12192588.sra SRR ids: ['SRR12192588.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_id_ffa80 SRR12192588.sra spots: 13409165 blocks: [[1, 670458], [670459, 1340916], [1340917, 2011374], [2011375, 2681832], [2681833, 3352290], [3352291, 4022748], [4022749, 4693206], [4693207, 5363664], [5363665, 6034122], [6034123, 6704580], [6704581, 7375038], [7375039, 8045496], [8045497, 8715954], [8715955, 9386412], [9386413, 10056870], [10056871, 10727328], [10727329, 11397786], [11397787, 12068244], [12068245, 12738702], [12738703, 13409165]] SRR12192588 file size 4509130 SRR12192588 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192588 SRR12192588_1.fastq Input file: SRR12192588_1.fastq trimmed: SRR12192588-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 07:35:12 2025 >> started Fri Feb 14 07:35:19 2025 >> done (7.323s) 13409165 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 13409165 (100.00%) reads available; of these: 83236 ( 0.62%) trimmed reads available after processing 13325929 (99.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 1 0.00% 42 0 0.00% 43 1 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 1 0.00% 50 1 0.00% 51 1 0.00% 52 1 0.00% 53 1 0.00% 54 0 0.00% 55 1 0.00% 56 1 0.00% 57 1 0.00% 58 0 0.00% 59 1 0.00% 60 2 0.00% 61 1 0.00% 62 0 0.00% 63 1 0.00% 64 2 0.00% 65 1 0.00% 66 0 0.00% 67 2 0.00% 68 0 0.00% 69 0 0.00% 70 2 0.00% 71 1 0.00% 72 1 0.00% 73 0 0.00% 74 0 0.00% 75 0 0.00% 76 1 0.00% 77 3 0.00% 78 0 0.00% 79 1 0.00% 80 0 0.00% 81 2 0.00% 82 1 0.00% 83 2 0.00% 84 2 0.00% 85 5 0.00% 86 3 0.00% 87 1 0.00% 88 2 0.00% 89 2 0.00% 90 0 0.00% 91 1 0.00% 92 3 0.00% 93 1 0.00% 94 3 0.00% 95 4 0.00% 96 3 0.00% 97 2 0.00% 98 6 0.00% 99 1 0.00% 100 7 0.00% 101 4 0.00% 102 4 0.00% 103 9 0.00% 104 6 0.00% 105 6 0.00% 106 9 0.00% 107 5 0.00% 108 8 0.00% 109 5 0.00% 110 8 0.00% 111 10 0.00% 112 11 0.00% 113 16 0.00% 114 17 0.00% 115 21 0.00% 116 22 0.00% 117 15 0.00% 118 10 0.00% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 0 0.00% 140 4 0.00% 141 15 0.00% 142 22 0.00% 143 47 0.00% 144 140 0.00% 145 366 0.00% 146 787 0.01% 147 2467 0.02% 148 10367 0.08% 149 68754 0.51% 150 13325929 99.38% 13409165 reads passed initial QC criterion=sequence-density sequence-density=2.00 sequence-density-rank=1 fanout-score=77.50 fanout-score-rank=1 prefix-density=3.62 prefix-fanout=42.9 sequence=AGATCGGAAGAGCACA criterion=fanout-score sequence-density=2.00 sequence-density-rank=1 fanout-score=77.50 fanout-score-rank=1 prefix-density=3.62 prefix-fanout=42.9 sequence=AGATCGGAAGAGCACA Started job on | Feb 14 07:35:51 Started mapping on | Feb 14 07:35:51 Finished on | Feb 14 07:37:07 Mapping speed, Million of reads per hour | 635.17 Number of input reads | 13409165 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 10560646 Uniquely mapped reads % | 78.76% Average mapped length | 148.65 Number of splices: Total | 4992579 Number of splices: Annotated (sjdb) | 4845351 Number of splices: GT/AG | 4912634 Number of splices: GC/AG | 63596 Number of splices: AT/AC | 3746 Number of splices: Non-canonical | 12603 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 622551 % of reads mapped to multiple loci | 4.64% Number of reads mapped to too many loci | 186614 % of reads mapped to too many loci | 1.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.19% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2225968 2225968 2225968 N_multimapping 622551 622551 622551 N_noFeature 470846 5548602 5447596 N_ambiguous 69304 17104 17107 UnstrandedReadsAssigned:10020496 PositiveStrandReadsAssigned:4994940 NegativeStrandReadsAssigned:5095943 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192588 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192588-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,409,165 reads, 10,847,162 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR12192588.ke.tsv 34699 SRR12192588.se.tsv 87100 total ==> SRR12192588.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 4952.43 302.952 Potri.005G024800.1.v4.1 1035 936 544 68.2265 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 177.15 7.31209 Potri.016G087400.1.v4.1 270 171 348 238.898 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 107 7.5034 Potri.012G127500.1.v4.1 977 878 748 100.009 ==> SRR12192588.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 126 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 3 SRR12192588 completed mapping pipeline successfully