Starting /dee2/code/volunteer_pipeline.sh SRR12192590 current disk space = 3084865060864 free memory = 1449546488 SRR12192590 SRAfilesize e4120faa33165fa82669054215064c2a SRR12192590.sra SRR12192590.sra file validated SRR12192590 is single end SRR12192590 is conventional basespace SRR12192590 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192590_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.0725 32.0 2.0 32.0 2.0 32.0 2 31.595 32.0 32.0 32.0 32.0 32.0 3 34.795 37.0 32.0 37.0 32.0 37.0 4 36.24125 37.0 37.0 37.0 32.0 37.0 5 36.61875 37.0 37.0 37.0 37.0 37.0 6 40.278 41.0 41.0 41.0 37.0 41.0 7 40.39375 41.0 41.0 41.0 41.0 41.0 8 40.44525 41.0 41.0 41.0 41.0 41.0 9 40.444 41.0 41.0 41.0 41.0 41.0 10-14 40.4286 41.0 41.0 41.0 40.2 41.0 15-19 40.2491 41.0 41.0 41.0 38.6 41.0 20-24 40.319599999999994 41.0 41.0 41.0 39.4 41.0 25-29 40.4404 41.0 41.0 41.0 41.0 41.0 30-34 40.12515 41.0 41.0 41.0 38.6 41.0 35-39 40.2916 41.0 41.0 41.0 40.2 41.0 40-44 40.21985 41.0 41.0 41.0 40.2 41.0 45-49 40.337849999999996 41.0 41.0 41.0 41.0 41.0 50-54 40.193250000000006 41.0 41.0 41.0 38.6 41.0 55-59 40.2144 41.0 41.0 41.0 40.2 41.0 60-64 40.0137 41.0 41.0 41.0 38.6 41.0 65-69 39.9624 41.0 41.0 41.0 37.0 41.0 70-74 40.0538 41.0 41.0 41.0 37.0 41.0 75-79 39.8002 41.0 41.0 41.0 37.0 41.0 80-84 40.05929999999999 41.0 41.0 41.0 37.8 41.0 85-89 40.120799999999996 41.0 41.0 41.0 38.6 41.0 90-94 40.07015 41.0 41.0 41.0 37.8 41.0 95-99 39.95129999999999 41.0 41.0 41.0 37.0 41.0 100-104 40.000750000000004 41.0 41.0 41.0 37.8 41.0 105-109 39.9072 41.0 41.0 41.0 37.0 41.0 110-114 39.763349999999996 41.0 41.0 41.0 37.0 41.0 115-119 39.8906 41.0 41.0 41.0 37.0 41.0 120-124 39.70784999999999 41.0 41.0 41.0 37.0 41.0 125-129 39.484750000000005 41.0 41.0 41.0 37.0 41.0 130-134 39.3029 41.0 41.0 41.0 37.0 41.0 135-139 39.121 41.0 41.0 41.0 37.0 41.0 140-144 39.1945 41.0 41.0 41.0 37.0 41.0 145-149 38.9742 41.0 41.0 41.0 36.0 41.0 150 38.89 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 4.0 25 2.0 26 4.0 27 2.0 28 15.0 29 12.0 30 7.0 31 21.0 32 23.0 33 25.0 34 47.0 35 53.0 36 73.0 37 126.0 38 202.0 39 575.0 40 2808.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.585759382672745 15.22272886706419 9.961417046650297 44.230094703612764 2 22.375 22.625 34.225 20.775 3 22.35 24.75 27.1 25.8 4 25.650650650650654 31.431431431431434 20.37037037037037 22.54754754754755 5 25.374999999999996 34.0 22.625 18.0 6 19.825 37.125 22.175 20.875 7 18.275 16.900000000000002 42.199999999999996 22.625 8 18.075 23.3 30.049999999999997 28.575 9 21.0 21.75 31.874999999999996 25.374999999999996 10-14 22.720000000000002 28.895 25.935000000000002 22.45 15-19 23.080000000000002 26.465 27.04 23.415 20-24 22.384999999999998 27.075 27.6 22.939999999999998 25-29 22.62 26.63 27.04 23.71 30-34 23.044999999999998 27.42 26.27 23.265 35-39 22.865 26.91 26.979999999999997 23.244999999999997 40-44 23.13 26.795 26.685 23.39 45-49 22.745 27.065 26.640000000000004 23.549999999999997 50-54 23.080000000000002 26.840000000000003 27.02 23.06 55-59 22.795 26.96 27.0 23.244999999999997 60-64 22.725 26.200000000000003 27.485 23.59 65-69 22.869999999999997 26.665 27.515 22.95 70-74 23.315 26.755000000000003 26.995 22.935 75-79 23.04 26.784999999999997 27.505000000000003 22.67 80-84 22.7 27.32 26.765 23.215 85-89 23.655 27.205000000000002 26.700000000000003 22.439999999999998 90-94 23.119999999999997 26.77 27.095000000000002 23.015 95-99 23.055 26.939999999999998 26.99 23.015 100-104 23.710411767648974 26.927502876869962 26.952519137439335 22.409566218041725 105-109 23.365 27.089999999999996 26.69 22.855 110-114 23.150047530895083 27.09761344874168 26.972532145894835 22.779806874468406 115-119 23.540593266970138 27.262268020609277 26.11175028762943 23.085388424791155 120-124 22.475341711310268 27.02147899664547 27.371952135382767 23.131227156661495 125-129 22.957549058870644 26.9573488185823 27.26271525830997 22.822386864237085 130-134 23.388065678814577 26.85722867440929 27.35782939527433 22.3968762515018 135-139 23.254766551568835 27.42330981334134 27.00295250963319 22.31897112545664 140-144 24.39 27.985 25.77 21.855 145-149 25.147514751475146 28.28282828282828 24.77747774777478 21.79217921792179 150 23.9 29.7 24.575 21.825 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.5 25 1.5 26 0.5 27 3.0 28 4.5 29 4.0 30 6.0 31 11.5 32 22.5 33 35.5 34 44.5 35 49.5 36 66.5 37 91.0 38 113.0 39 152.0 40 171.5 41 187.5 42 235.5 43 256.5 44 260.5 45 288.0 46 274.5 47 231.5 48 217.0 49 175.5 50 153.0 51 139.5 52 110.5 53 92.5 54 65.5 55 52.5 56 44.5 57 35.0 58 36.0 59 49.5 60 42.5 61 26.5 62 35.0 63 41.5 64 38.5 65 30.5 66 27.0 67 27.5 68 20.5 69 14.0 70 6.0 71 1.0 72 0.0 73 1.5 74 1.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 28.725 2 0.0 3 0.0 4 0.1 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.065 105-109 0.0 110-114 0.065 115-119 0.045 120-124 0.135 125-129 0.12 130-134 0.12 135-139 0.08499999999999999 140-144 0.0 145-149 0.01 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.55 #Duplication Level Percentage of deduplicated Percentage of total 1 95.91836734693877 91.64999999999999 2 3.6630036630036633 7.000000000000001 3 0.28780743066457354 0.8250000000000001 4 0.10465724751439037 0.4 5 0.026164311878597593 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.4375 0.0 0.0 0.0 0.0 136-137 1.9874999999999998 0.0 0.0 0.0 0.0 138 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755914 READS because READLEN < 1 Read 755914 spots for SRR12192590.sra Written 755914 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192590.sra Written 755895 spots for SRR12192590.sra SRR ids: ['SRR12192590.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bb_eliau SRR12192590.sra spots: 15117919 blocks: [[1, 755895], [755896, 1511790], [1511791, 2267685], [2267686, 3023580], [3023581, 3779475], [3779476, 4535370], [4535371, 5291265], [5291266, 6047160], [6047161, 6803055], [6803056, 7558950], [7558951, 8314845], [8314846, 9070740], [9070741, 9826635], [9826636, 10582530], [10582531, 11338425], [11338426, 12094320], [12094321, 12850215], [12850216, 13606110], [13606111, 14362005], [14362006, 15117919]] SRR12192590 file size 5086502 SRR12192590 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192590 SRR12192590_1.fastq Input file: SRR12192590_1.fastq trimmed: SRR12192590-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 07:09:40 2025 >> started Fri Feb 14 07:09:49 2025 >> done (8.559s) 15117919 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 15117919 (100.00%) reads available; of these: 93751 ( 0.62%) trimmed reads available after processing 15024168 (99.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 1 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 3 0.00% 42 1 0.00% 43 1 0.00% 44 2 0.00% 45 0 0.00% 46 0 0.00% 47 1 0.00% 48 0 0.00% 49 1 0.00% 50 0 0.00% 51 0 0.00% 52 1 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 1 0.00% 62 1 0.00% 63 1 0.00% 64 1 0.00% 65 0 0.00% 66 1 0.00% 67 0 0.00% 68 0 0.00% 69 1 0.00% 70 0 0.00% 71 4 0.00% 72 4 0.00% 73 0 0.00% 74 2 0.00% 75 2 0.00% 76 3 0.00% 77 2 0.00% 78 0 0.00% 79 1 0.00% 80 2 0.00% 81 2 0.00% 82 3 0.00% 83 3 0.00% 84 1 0.00% 85 1 0.00% 86 1 0.00% 87 3 0.00% 88 0 0.00% 89 3 0.00% 90 1 0.00% 91 0 0.00% 92 1 0.00% 93 2 0.00% 94 2 0.00% 95 1 0.00% 96 5 0.00% 97 5 0.00% 98 5 0.00% 99 4 0.00% 100 7 0.00% 101 6 0.00% 102 6 0.00% 103 9 0.00% 104 4 0.00% 105 15 0.00% 106 20 0.00% 107 7 0.00% 108 16 0.00% 109 22 0.00% 110 20 0.00% 111 25 0.00% 112 31 0.00% 113 25 0.00% 114 22 0.00% 115 31 0.00% 116 49 0.00% 117 36 0.00% 118 17 0.00% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 2 0.00% 140 4 0.00% 141 11 0.00% 142 24 0.00% 143 60 0.00% 144 189 0.00% 145 402 0.00% 146 860 0.01% 147 2839 0.02% 148 11874 0.08% 149 77036 0.51% 150 15024168 99.38% 15117919 reads passed initial QC criterion=sequence-density sequence-density=2.75 sequence-density-rank=1 fanout-score=68.81 fanout-score-rank=1 prefix-density=4.79 prefix-fanout=39.5 sequence=AGATCGGAAGAGCACA criterion=fanout-score sequence-density=2.75 sequence-density-rank=1 fanout-score=68.81 fanout-score-rank=1 prefix-density=4.79 prefix-fanout=39.5 sequence=AGATCGGAAGAGCACA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACA -o SRR12192590 - Input file: STDIN trimmed: SRR12192590-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Feb 14 07:10:36 2025 >> started Fri Feb 14 07:10:40 2025 >> done (4.818s) 5039306 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 5039306 (100.00%) reads available; of these: 676218 (13.42%) trimmed reads available after processing 4363088 (86.58%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 41 1 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 1 0.00% 48 0 0.00% 49 1 0.00% 50 1 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 1 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 1 0.00% 70 0 0.00% 71 2 0.00% 72 2 0.00% 73 1 0.00% 74 0 0.00% 75 1 0.00% 76 2 0.00% 77 0 0.00% 78 0 0.00% 79 1 0.00% 80 1 0.00% 81 1 0.00% 82 1 0.00% 83 0 0.00% 84 0 0.00% 85 1 0.00% 86 2 0.00% 87 1 0.00% 88 0 0.00% 89 1 0.00% 90 1 0.00% 91 0 0.00% 92 2 0.00% 93 1 0.00% 94 1 0.00% 95 3 0.00% 96 0 0.00% 97 3 0.00% 98 0 0.00% 99 0 0.00% 100 5 0.00% 101 4 0.00% 102 2 0.00% 103 5 0.00% 104 2 0.00% 105 4 0.00% 106 7 0.00% 107 1 0.00% 108 9 0.00% 109 5 0.00% 110 5 0.00% 111 8 0.00% 112 10 0.00% 113 13 0.00% 114 8 0.00% 115 14 0.00% 116 15 0.00% 117 9 0.00% 118 14 0.00% 119 14 0.00% 120 15 0.00% 121 20 0.00% 122 22 0.00% 123 25 0.00% 124 31 0.00% 125 30 0.00% 126 24 0.00% 127 38 0.00% 128 24 0.00% 129 36 0.00% 130 35 0.00% 131 28 0.00% 132 39 0.00% 133 28 0.00% 134 36851 0.73% 135 37892 0.75% 136 38606 0.77% 137 38336 0.76% 138 37831 0.75% 139 36630 0.73% 140 36661 0.73% 141 37521 0.74% 142 38816 0.77% 143 40011 0.79% 144 41686 0.83% 145 47199 0.94% 146 65709 1.30% 147 143386 2.85% 148 3778 0.07% 149 23493 0.47% 150 4334317 86.01% criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=25.19 fanout-score-rank=8 prefix-density=0.30 prefix-fanout=9.3 sequence=GAGAGAGAAAATCCTCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=193.23 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=14.3 sequence=TCTTCTCTTTACCTTGCAGAGTTTAACAAAACCAGCAGCTTAGTATATATATCTTTCTCCTGCATATCAGCCCAATGGCCACCTCCAAGATCTTAGCACCCTTATGTTTGATGGTCCTCGTTTTCGGTCTTTGCTTGTCAATGGTTGAATCTCAAAGTTATGGTGTGTGTGAAGGATTCGATCCTGAAGC Started job on | Feb 14 07:11:14 Started mapping on | Feb 14 07:11:14 Finished on | Feb 14 07:12:17 Mapping speed, Million of reads per hour | 863.88 Number of input reads | 15117919 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 12853654 Uniquely mapped reads % | 85.02% Average mapped length | 148.36 Number of splices: Total | 6201406 Number of splices: Annotated (sjdb) | 6054987 Number of splices: GT/AG | 6107390 Number of splices: GC/AG | 75564 Number of splices: AT/AC | 4179 Number of splices: Non-canonical | 14273 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.84 Insertion rate per base | 0.01% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 671660 % of reads mapped to multiple loci | 4.44% Number of reads mapped to too many loci | 89959 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.92% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1592605 1592605 1592605 N_multimapping 671660 671660 671660 N_noFeature 442050 6692981 6560938 N_ambiguous 78955 18783 18631 UnstrandedReadsAssigned:12332649 PositiveStrandReadsAssigned:6141890 NegativeStrandReadsAssigned:6274085 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192590 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192590-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,117,919 reads, 13,013,216 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR12192590.ke.tsv 34699 SRR12192590.se.tsv 87100 total ==> SRR12192590.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2493 137.017 Potri.005G024800.1.v4.1 1035 936 344 38.7623 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 273.17 10.1305 Potri.016G087400.1.v4.1 270 171 530 326.894 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 399.886 25.1946 Potri.012G127500.1.v4.1 977 878 1288 154.72 ==> SRR12192590.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 193 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 3 SRR12192590 completed mapping pipeline successfully