Starting /dee2/code/volunteer_pipeline.sh SRR12192591 current disk space = 3117425729536 free memory = 1582144620 SRR12192591 SRAfilesize 9d8388d6d025fb29dca519985687f4be SRR12192591.sra SRR12192591.sra file validated SRR12192591 is single end SRR12192591 is conventional basespace SRR12192591 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192591_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.46125 32.0 2.0 32.0 2.0 32.0 2 31.27125 32.0 32.0 32.0 32.0 32.0 3 32.35875 32.0 32.0 37.0 27.0 37.0 4 35.0175 37.0 37.0 37.0 32.0 37.0 5 35.8225 37.0 37.0 37.0 32.0 37.0 6 39.2595 41.0 41.0 41.0 37.0 41.0 7 39.04525 41.0 37.0 41.0 37.0 41.0 8 39.5845 41.0 41.0 41.0 37.0 41.0 9 39.85375 41.0 41.0 41.0 37.0 41.0 10-14 39.779250000000005 41.0 41.0 41.0 37.8 41.0 15-19 39.856100000000005 41.0 41.0 41.0 37.0 41.0 20-24 39.8121 41.0 41.0 41.0 37.0 41.0 25-29 39.737199999999994 41.0 41.0 41.0 37.0 41.0 30-34 39.65795000000001 41.0 41.0 41.0 37.0 41.0 35-39 39.7159 41.0 41.0 41.0 37.0 41.0 40-44 39.4738 41.0 41.0 41.0 37.0 41.0 45-49 39.26285 41.0 41.0 41.0 37.0 41.0 50-54 39.336949999999995 41.0 41.0 41.0 37.0 41.0 55-59 39.34085 41.0 41.0 41.0 37.0 41.0 60-64 39.28325 41.0 41.0 41.0 37.0 41.0 65-69 39.0253 41.0 41.0 41.0 35.0 41.0 70-74 39.121249999999996 41.0 41.0 41.0 37.0 41.0 75-79 38.690000000000005 41.0 39.4 41.0 35.0 41.0 80-84 39.1964 41.0 41.0 41.0 36.0 41.0 85-89 39.052899999999994 41.0 41.0 41.0 36.0 41.0 90-94 38.97385 41.0 41.0 41.0 35.0 41.0 95-99 38.9984 41.0 41.0 41.0 37.0 41.0 100-104 38.6755 41.0 38.6 41.0 33.0 41.0 105-109 38.516999999999996 41.0 37.8 41.0 33.0 41.0 110-114 38.150000000000006 41.0 37.0 41.0 32.0 41.0 115-119 37.97475 41.0 37.0 41.0 32.0 41.0 120-124 37.786 41.0 37.0 41.0 30.0 41.0 125-129 37.4943 41.0 37.0 41.0 29.0 41.0 130-134 36.76584999999999 41.0 37.0 41.0 27.0 41.0 135-139 36.23075000000001 41.0 36.0 41.0 26.0 41.0 140-144 35.70635 41.0 32.0 41.0 22.0 41.0 145-149 35.334149999999994 40.2 32.0 41.0 22.0 41.0 150 34.56775 37.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 3.0 24 15.0 25 11.0 26 28.0 27 23.0 28 28.0 29 29.0 30 35.0 31 43.0 32 63.0 33 77.0 34 94.0 35 130.0 36 191.0 37 275.0 38 455.0 39 1143.0 40 1353.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.04068682344158 15.528182157521464 8.995893990294885 46.435237028742065 2 21.25 21.425 36.325 21.0 3 24.325 24.9 26.450000000000003 24.325 4 25.95648912228057 29.532383095773945 21.405351337834457 23.10577644411103 5 25.4 34.75 21.7 18.15 6 20.125 36.4 21.775 21.7 7 19.5 18.05 40.925 21.525 8 18.55 22.275 31.574999999999996 27.6 9 20.3 22.650000000000002 31.35 25.7 10-14 23.005 28.360000000000003 25.665 22.97 15-19 22.185 27.134999999999998 27.29 23.39 20-24 22.36 27.43 26.545 23.665 25-29 22.95 26.900000000000002 26.815 23.335 30-34 22.485 27.625 26.625 23.265 35-39 21.93 27.515 27.169999999999998 23.385 40-44 22.115000000000002 27.334999999999997 27.215 23.335 45-49 22.805 27.155 27.05 22.99 50-54 22.39 27.384999999999998 27.235 22.99 55-59 22.451122556127807 27.31136556827841 27.176358817940898 23.061153057652884 60-64 22.71 26.784999999999997 27.29 23.215 65-69 22.857142857142858 27.37553164873655 26.79009256942707 22.97723292469352 70-74 22.7 27.185 26.765 23.35 75-79 22.675 27.1 26.945000000000004 23.28 80-84 22.16 27.68 26.784999999999997 23.375 85-89 22.814999999999998 27.63 26.229999999999997 23.325000000000003 90-94 22.895 27.155 26.685 23.265 95-99 22.445 27.155 27.060000000000002 23.34 100-104 22.6 27.700000000000003 26.895000000000003 22.805 105-109 23.46 26.740000000000002 26.655 23.145 110-114 22.52 27.315 27.22 22.945 115-119 22.945 27.134999999999998 26.865 23.055 120-124 23.175 27.465 26.900000000000002 22.46 125-129 22.725 27.229999999999997 26.355 23.69 130-134 23.16 27.0 26.93 22.91 135-139 22.939999999999998 27.675 26.640000000000004 22.745 140-144 24.09843445205822 27.414595108287898 25.71399989996499 22.77297053968889 145-149 24.59360776271695 28.3149102185765 25.158805581953686 21.932676436752864 150 25.0 27.425 24.8 22.775000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 2.0 26 1.0 27 3.5 28 6.0 29 7.5 30 10.0 31 12.5 32 22.5 33 34.5 34 40.5 35 63.5 36 87.5 37 98.5 38 140.0 39 175.0 40 178.0 41 203.5 42 233.5 43 229.5 44 239.0 45 253.0 46 245.5 47 236.0 48 211.0 49 177.0 50 150.0 51 132.5 52 110.0 53 93.5 54 83.0 55 52.5 56 37.5 57 40.5 58 31.5 59 29.0 60 35.5 61 32.0 62 27.0 63 32.0 64 41.5 65 46.0 66 39.0 67 30.0 68 20.5 69 12.0 70 6.0 71 2.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 33.025 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.075 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.034999999999999996 145-149 0.034999999999999996 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.05 #Duplication Level Percentage of deduplicated Percentage of total 1 96.38209266007289 92.575 2 3.4096824570536177 6.550000000000001 3 0.15616866215512754 0.44999999999999996 4 0.026028110359187923 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026028110359187923 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGT 13 0.325 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.4125 0.0 0.0 0.0 0.0 136-137 1.9625 0.0 0.0 0.0 0.0 138 3.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTATGC 10 0.0070318864 143.6 8 >>END_MODULE Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755914 READS because READLEN < 1 Read 755914 spots for SRR12192591.sra Written 755914 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra Rejected 755895 READS because READLEN < 1 Read 755895 spots for SRR12192591.sra Written 755895 spots for SRR12192591.sra SRR ids: ['SRR12192591.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_do0uvjrz SRR12192591.sra spots: 15117919 blocks: [[1, 755895], [755896, 1511790], [1511791, 2267685], [2267686, 3023580], [3023581, 3779475], [3779476, 4535370], [4535371, 5291265], [5291266, 6047160], [6047161, 6803055], [6803056, 7558950], [7558951, 8314845], [8314846, 9070740], [9070741, 9826635], [9826636, 10582530], [10582531, 11338425], [11338426, 12094320], [12094321, 12850215], [12850216, 13606110], [13606111, 14362005], [14362006, 15117919]] SRR12192591 file size 5086502 SRR12192591 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192591 SRR12192591_2.fastq Input file: SRR12192591_2.fastq trimmed: SRR12192591-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 08:46:39 2025 >> started Fri Feb 14 08:46:48 2025 >> done (9.163s) 15117919 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 15117919 (100.00%) reads available; of these: 298165 ( 1.97%) trimmed reads available after processing 14819754 (98.03%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 131 1 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 2 0.00% 137 2 0.00% 138 1 0.00% 139 7 0.00% 140 12 0.00% 141 39 0.00% 142 85 0.00% 143 172 0.00% 144 426 0.00% 145 1144 0.01% 146 3162 0.02% 147 10360 0.07% 148 43474 0.29% 149 239278 1.58% 150 14819754 98.03% 15117919 reads passed initial QC criterion=sequence-density sequence-density=2.71 sequence-density-rank=1 fanout-score=68.25 fanout-score-rank=1 prefix-density=4.73 prefix-fanout=39.1 sequence=AGATCGGAAGAGCGTC criterion=fanout-score sequence-density=2.71 sequence-density-rank=1 fanout-score=68.25 fanout-score-rank=1 prefix-density=4.73 prefix-fanout=39.1 sequence=AGATCGGAAGAGCGTC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTC -o SRR12192591 - Input file: STDIN trimmed: SRR12192591-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Feb 14 08:47:27 2025 >> started Fri Feb 14 08:47:33 2025 >> done (5.274s) 5039306 reads processed; of these: 4 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 5039302 (100.00%) reads available; of these: 674735 (13.39%) trimmed reads available after processing 4364567 (86.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 2 0.00% 21 0 0.00% 22 5 0.00% 23 2 0.00% 24 1 0.00% 25 3 0.00% 26 3 0.00% 27 5 0.00% 28 2 0.00% 29 5 0.00% 30 8 0.00% 31 7 0.00% 32 6 0.00% 33 9 0.00% 34 4 0.00% 35 5 0.00% 36 7 0.00% 37 11 0.00% 38 5 0.00% 39 5 0.00% 40 9 0.00% 41 9 0.00% 42 10 0.00% 43 6 0.00% 44 16 0.00% 45 11 0.00% 46 10 0.00% 47 21 0.00% 48 19 0.00% 49 10 0.00% 50 13 0.00% 51 18 0.00% 52 19 0.00% 53 14 0.00% 54 16 0.00% 55 16 0.00% 56 13 0.00% 57 14 0.00% 58 11 0.00% 59 16 0.00% 60 14 0.00% 61 8 0.00% 62 19 0.00% 63 12 0.00% 64 18 0.00% 65 13 0.00% 66 22 0.00% 67 12 0.00% 68 17 0.00% 69 14 0.00% 70 19 0.00% 71 14 0.00% 72 15 0.00% 73 23 0.00% 74 17 0.00% 75 18 0.00% 76 13 0.00% 77 14 0.00% 78 18 0.00% 79 14 0.00% 80 15 0.00% 81 9 0.00% 82 17 0.00% 83 7 0.00% 84 7 0.00% 85 16 0.00% 86 13 0.00% 87 9 0.00% 88 15 0.00% 89 18 0.00% 90 14 0.00% 91 7 0.00% 92 10 0.00% 93 18 0.00% 94 12 0.00% 95 18 0.00% 96 9 0.00% 97 19 0.00% 98 17 0.00% 99 12 0.00% 100 20 0.00% 101 14 0.00% 102 20 0.00% 103 11 0.00% 104 11 0.00% 105 20 0.00% 106 23 0.00% 107 14 0.00% 108 17 0.00% 109 15 0.00% 110 14 0.00% 111 23 0.00% 112 20 0.00% 113 30 0.00% 114 24 0.00% 115 31 0.00% 116 24 0.00% 117 26 0.00% 118 16 0.00% 119 29 0.00% 120 31 0.00% 121 29 0.00% 122 36 0.00% 123 45 0.00% 124 42 0.00% 125 41 0.00% 126 42 0.00% 127 46 0.00% 128 30 0.00% 129 56 0.00% 130 38 0.00% 131 40 0.00% 132 47 0.00% 133 29 0.00% 134 36838 0.73% 135 37886 0.75% 136 38585 0.77% 137 38348 0.76% 138 37811 0.75% 139 36600 0.73% 140 36542 0.73% 141 37450 0.74% 142 38791 0.77% 143 40130 0.80% 144 41364 0.82% 145 46788 0.93% 146 66439 1.32% 147 144094 2.86% 148 13056 0.26% 149 68746 1.36% 150 4277932 84.89% criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=21.17 fanout-score-rank=7 prefix-density=0.29 prefix-fanout=8.3 sequence=GAGAGAGAAAATCCTCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=160.35 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=13.4 sequence=TCTTCTCTTTACCTTGCAGAGTTTAACAAAACCAGCAGCTTAGTATATATATCTTTCTCCTGCATATCAGCCCAATGGCCACCTCCAAGATCTTAGCACCCTTATGTTTGATGGTCCTCGTTTTCGGTCTTTGCTTGTCAATGGTTGAATCTCAAAGTTATGGTGTGTGTGAAGGATTCGATCCTGAAGC Started job on | Feb 14 08:48:06 Started mapping on | Feb 14 08:48:06 Finished on | Feb 14 08:49:07 Mapping speed, Million of reads per hour | 892.20 Number of input reads | 15117915 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 12796012 Uniquely mapped reads % | 84.64% Average mapped length | 148.23 Number of splices: Total | 6155861 Number of splices: Annotated (sjdb) | 6008684 Number of splices: GT/AG | 6062187 Number of splices: GC/AG | 74276 Number of splices: AT/AC | 4107 Number of splices: Non-canonical | 15291 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.86 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 680125 % of reads mapped to multiple loci | 4.50% Number of reads mapped to too many loci | 89015 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.23% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1641778 1641778 1641778 N_multimapping 680125 680125 680125 N_noFeature 439005 6574406 6618876 N_ambiguous 78657 19082 18106 UnstrandedReadsAssigned:12278350 PositiveStrandReadsAssigned:6202524 NegativeStrandReadsAssigned:6159030 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192591 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192591-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,117,915 reads, 12,993,887 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,017 rounds 52401 SRR12192591.ke.tsv 34699 SRR12192591.se.tsv 87100 total ==> SRR12192591.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2491 137.148 Potri.005G024800.1.v4.1 1035 936 344 38.8306 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 268.167 9.9625 Potri.016G087400.1.v4.1 270 171 506 312.641 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 406.888 25.6809 Potri.012G127500.1.v4.1 977 878 1290 155.234 ==> SRR12192591.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 182 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 3 SRR12192591 completed mapping pipeline successfully