Starting /dee2/code/volunteer_pipeline.sh SRR12192592 current disk space = 3118922190848 free memory = 1487411048 SRR12192592 SRAfilesize 5a56c21aa98795fc56a29258cae19bdb SRR12192592.sra SRR12192592.sra file validated SRR12192592 is single end SRR12192592 is conventional basespace SRR12192592 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192592_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.935 32.0 2.0 32.0 2.0 32.0 2 31.68 32.0 32.0 32.0 32.0 32.0 3 34.74375 37.0 32.0 37.0 32.0 37.0 4 36.34 37.0 37.0 37.0 37.0 37.0 5 36.62625 37.0 37.0 37.0 37.0 37.0 6 40.321 41.0 41.0 41.0 37.0 41.0 7 40.42075 41.0 41.0 41.0 41.0 41.0 8 40.451 41.0 41.0 41.0 41.0 41.0 9 40.4155 41.0 41.0 41.0 41.0 41.0 10-14 40.4269 41.0 41.0 41.0 41.0 41.0 15-19 40.393600000000006 41.0 41.0 41.0 41.0 41.0 20-24 40.45375 41.0 41.0 41.0 41.0 41.0 25-29 40.475049999999996 41.0 41.0 41.0 41.0 41.0 30-34 40.2819 41.0 41.0 41.0 40.2 41.0 35-39 40.35915 41.0 41.0 41.0 41.0 41.0 40-44 40.30085 41.0 41.0 41.0 40.2 41.0 45-49 40.40474999999999 41.0 41.0 41.0 41.0 41.0 50-54 40.3202 41.0 41.0 41.0 41.0 41.0 55-59 40.316199999999995 41.0 41.0 41.0 41.0 41.0 60-64 40.1983 41.0 41.0 41.0 40.2 41.0 65-69 40.126250000000006 41.0 41.0 41.0 37.8 41.0 70-74 40.166250000000005 41.0 41.0 41.0 38.6 41.0 75-79 39.8928 41.0 41.0 41.0 37.0 41.0 80-84 40.19064999999999 41.0 41.0 41.0 39.4 41.0 85-89 40.212 41.0 41.0 41.0 40.2 41.0 90-94 40.14515 41.0 41.0 41.0 40.2 41.0 95-99 40.01485 41.0 41.0 41.0 37.0 41.0 100-104 40.06 41.0 41.0 41.0 38.6 41.0 105-109 40.0486 41.0 41.0 41.0 37.0 41.0 110-114 39.91705 41.0 41.0 41.0 37.0 41.0 115-119 39.943149999999996 41.0 41.0 41.0 37.8 41.0 120-124 39.6572 41.0 41.0 41.0 37.0 41.0 125-129 39.5985 41.0 41.0 41.0 37.0 41.0 130-134 39.411300000000004 41.0 41.0 41.0 37.0 41.0 135-139 39.2811 41.0 41.0 41.0 37.0 41.0 140-144 39.19975 41.0 41.0 41.0 37.0 41.0 145-149 38.9514 41.0 41.0 41.0 34.0 41.0 150 38.9205 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 4.0 27 7.0 28 7.0 29 9.0 30 12.0 31 20.0 32 20.0 33 26.0 34 47.0 35 58.0 36 80.0 37 115.0 38 161.0 39 466.0 40 2966.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.601769911504427 14.690265486725664 12.991150442477876 43.716814159292035 2 20.775 18.85 37.5 22.875 3 22.75 22.25 27.825 27.175 4 24.26820115086315 27.72079059294471 21.94145609206905 26.069552164123095 5 26.924999999999997 31.724999999999998 23.3 18.05 6 20.9 35.675000000000004 22.725 20.7 7 19.325 20.45 39.725 20.5 8 19.3 23.125 29.875 27.700000000000003 9 19.15 24.325 31.724999999999998 24.8 10-14 21.615000000000002 27.965 27.015 23.405 15-19 22.634999999999998 26.85 27.189999999999998 23.325000000000003 20-24 22.735 27.01 27.060000000000002 23.195 25-29 22.264999999999997 27.339999999999996 26.965 23.43 30-34 22.835 26.795 27.405 22.965 35-39 22.64 26.950000000000003 26.834999999999997 23.575 40-44 22.495 26.740000000000002 27.325 23.44 45-49 23.044999999999998 26.995 27.18 22.78 50-54 23.115 26.790000000000003 27.245 22.85 55-59 22.655 27.275 26.705000000000002 23.365 60-64 23.205000000000002 26.205000000000002 27.22 23.369999999999997 65-69 23.265 26.68 26.900000000000002 23.155 70-74 23.425 26.96 26.5 23.115 75-79 22.759999999999998 26.895000000000003 26.705000000000002 23.64 80-84 22.345000000000002 26.995 26.915 23.745 85-89 23.380000000000003 27.185 26.87 22.564999999999998 90-94 22.39 26.945000000000004 27.615000000000002 23.05 95-99 22.925 26.745 27.415 22.915 100-104 23.70014512335485 26.627633488465197 26.947905719861883 22.72431566831807 105-109 23.02 26.295 27.55 23.135 110-114 23.35835835835836 27.24724724724725 26.816816816816818 22.57757757757758 115-119 24.098073555166373 26.474856142106578 26.9402051538654 22.486865148861646 120-124 22.977913557369657 27.239945910752745 26.8893674563029 22.8927730755747 125-129 22.442541685443892 26.78884382354414 27.60002002904211 23.168594461969857 130-134 23.434525598637414 27.191664161907624 26.59052199178439 22.783288247670576 135-139 23.598317981577893 27.89347216659992 26.256507809371243 22.25170204245094 140-144 24.154999999999998 26.779999999999998 26.865 22.2 145-149 24.338650797619643 28.104215632344854 25.443816572485872 22.11331699754963 150 25.15 28.4 24.5 21.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.5 24 3.0 25 2.0 26 1.5 27 1.5 28 4.5 29 9.5 30 12.0 31 11.5 32 14.5 33 23.0 34 37.0 35 57.0 36 67.5 37 87.5 38 121.5 39 141.5 40 166.5 41 210.0 42 238.0 43 247.5 44 268.0 45 274.5 46 258.0 47 225.5 48 210.0 49 199.0 50 166.5 51 143.5 52 120.0 53 90.5 54 68.5 55 61.5 56 50.0 57 35.5 58 32.5 59 33.5 60 34.0 61 31.0 62 27.5 63 32.0 64 39.5 65 38.0 66 36.5 67 29.0 68 14.5 69 10.0 70 5.0 71 1.5 72 1.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 29.375 2 0.0 3 0.0 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08499999999999999 105-109 0.0 110-114 0.1 115-119 0.075 120-124 0.165 125-129 0.145 130-134 0.19 135-139 0.12 140-144 0.0 145-149 0.015 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.575 #Duplication Level Percentage of deduplicated Percentage of total 1 96.97126585555267 93.65 2 2.6922081283976182 5.2 3 0.18120631633445508 0.525 4 0.12943308309603935 0.5 5 0.025886616619207874 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.2875 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138 2.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGAG 20 0.006194221 28.747498 140-144 >>END_MODULE Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760154 READS because READLEN < 1 Read 760154 spots for SRR12192592.sra Written 760154 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192592.sra Written 760135 spots for SRR12192592.sra SRR ids: ['SRR12192592.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o707i88d SRR12192592.sra spots: 15202719 blocks: [[1, 760135], [760136, 1520270], [1520271, 2280405], [2280406, 3040540], [3040541, 3800675], [3800676, 4560810], [4560811, 5320945], [5320946, 6081080], [6081081, 6841215], [6841216, 7601350], [7601351, 8361485], [8361486, 9121620], [9121621, 9881755], [9881756, 10641890], [10641891, 11402025], [11402026, 12162160], [12162161, 12922295], [12922296, 13682430], [13682431, 14442565], [14442566, 15202719]] SRR12192592 file size 5115155 SRR12192592 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192592 SRR12192592_1.fastq Input file: SRR12192592_1.fastq trimmed: SRR12192592-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 07:43:45 2025 >> started Fri Feb 14 07:43:55 2025 >> done (10.417s) 15202719 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 15202719 (100.00%) reads available; of these: 88923 ( 0.58%) trimmed reads available after processing 15113796 (99.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 37 1 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 1 0.00% 45 1 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 1 0.00% 52 1 0.00% 53 0 0.00% 54 0 0.00% 55 1 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 1 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 1 0.00% 65 0 0.00% 66 1 0.00% 67 1 0.00% 68 0 0.00% 69 1 0.00% 70 0 0.00% 71 1 0.00% 72 1 0.00% 73 1 0.00% 74 1 0.00% 75 1 0.00% 76 0 0.00% 77 1 0.00% 78 1 0.00% 79 1 0.00% 80 4 0.00% 81 0 0.00% 82 1 0.00% 83 1 0.00% 84 1 0.00% 85 2 0.00% 86 2 0.00% 87 2 0.00% 88 0 0.00% 89 0 0.00% 90 3 0.00% 91 2 0.00% 92 2 0.00% 93 1 0.00% 94 0 0.00% 95 6 0.00% 96 2 0.00% 97 1 0.00% 98 2 0.00% 99 1 0.00% 100 3 0.00% 101 2 0.00% 102 3 0.00% 103 4 0.00% 104 6 0.00% 105 2 0.00% 106 5 0.00% 107 10 0.00% 108 9 0.00% 109 9 0.00% 110 5 0.00% 111 12 0.00% 112 11 0.00% 113 18 0.00% 114 18 0.00% 115 19 0.00% 116 23 0.00% 117 27 0.00% 118 11 0.00% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 1 0.00% 140 2 0.00% 141 10 0.00% 142 22 0.00% 143 48 0.00% 144 108 0.00% 145 272 0.00% 146 762 0.01% 147 2464 0.02% 148 10540 0.07% 149 74445 0.49% 150 15113796 99.42% 15202719 reads passed initial QC criterion=sequence-density sequence-density=2.42 sequence-density-rank=1 fanout-score=74.20 fanout-score-rank=1 prefix-density=4.31 prefix-fanout=41.7 sequence=AGATCGGAAGAGCACA criterion=fanout-score sequence-density=2.42 sequence-density-rank=1 fanout-score=74.20 fanout-score-rank=1 prefix-density=4.31 prefix-fanout=41.7 sequence=AGATCGGAAGAGCACA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACA -o SRR12192592 - Input file: STDIN trimmed: SRR12192592-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Feb 14 07:44:43 2025 >> started Fri Feb 14 07:44:50 2025 >> done (7.128s) 5067573 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 5067573 (100.00%) reads available; of these: 645818 (12.74%) trimmed reads available after processing 4421755 (87.26%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 44 1 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 1 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 1 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 0 0.00% 70 0 0.00% 71 0 0.00% 72 2 0.00% 73 1 0.00% 74 1 0.00% 75 0 0.00% 76 0 0.00% 77 0 0.00% 78 1 0.00% 79 1 0.00% 80 4 0.00% 81 0 0.00% 82 0 0.00% 83 1 0.00% 84 1 0.00% 85 0 0.00% 86 2 0.00% 87 1 0.00% 88 0 0.00% 89 0 0.00% 90 1 0.00% 91 2 0.00% 92 1 0.00% 93 0 0.00% 94 0 0.00% 95 3 0.00% 96 1 0.00% 97 0 0.00% 98 1 0.00% 99 1 0.00% 100 3 0.00% 101 0 0.00% 102 1 0.00% 103 0 0.00% 104 2 0.00% 105 1 0.00% 106 3 0.00% 107 4 0.00% 108 4 0.00% 109 9 0.00% 110 5 0.00% 111 4 0.00% 112 4 0.00% 113 9 0.00% 114 9 0.00% 115 5 0.00% 116 8 0.00% 117 12 0.00% 118 5 0.00% 119 6 0.00% 120 9 0.00% 121 5 0.00% 122 14 0.00% 123 8 0.00% 124 16 0.00% 125 16 0.00% 126 17 0.00% 127 18 0.00% 128 24 0.00% 129 25 0.00% 130 16 0.00% 131 26 0.00% 132 15 0.00% 133 13 0.00% 134 32169 0.63% 135 33463 0.66% 136 34574 0.68% 137 34893 0.69% 138 34634 0.68% 139 34641 0.68% 140 34290 0.68% 141 35889 0.71% 142 36875 0.73% 143 38341 0.76% 144 40402 0.80% 145 46222 0.91% 146 65110 1.28% 147 145229 2.87% 148 3320 0.07% 149 22585 0.45% 150 4394592 86.72% criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=11.33 fanout-score-rank=16 prefix-density=0.92 prefix-fanout=1.5 sequence=TTCTTCTGCTTCAGTAAGAAGCCCTCTCTTCAAGTCAGGGCGAAGATAATTAGTCCAACGAAGCCGGCAACTCTTGCCGCATCGTCGGAGTCCTGCAAGCTTAGGGACAGCTCTCCAACAGCACTGGCCATTGGTGAGGATGAAATTGATGAGTTTTTTATCCTCCTCGGCTGTCCATGGACCTTTCTTGACCCCAAGTTTGTCACAGCAAGGTTGCCTTCCCATACTGCACACAGTACTAGCTAGCTCGCTGACTATAGCTAAGTTTACACCACTAAAACAAATTAAACCTCGCCAATATTATTACTTGTAAAGACTCAAAGCCCCACAACCACCTTTATATTTCCCACCCCAAGTGCTTATATATAAATAAATATGCACAGCCATGTATGGAGGGAGAGAAAGAGGGTGAAGGGGGCGGCCGCGGAGCCTGCTTTTTTGTACAAACTTGTTGATAACTCTAGAGTCCCCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=12 fanout-score=148.44 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=20.6 sequence=GCTGCTGCTGCT Started job on | Feb 14 07:45:27 Started mapping on | Feb 14 07:45:28 Finished on | Feb 14 07:46:44 Mapping speed, Million of reads per hour | 720.13 Number of input reads | 15202719 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 12983622 Uniquely mapped reads % | 85.40% Average mapped length | 148.61 Number of splices: Total | 6508489 Number of splices: Annotated (sjdb) | 6341269 Number of splices: GT/AG | 6407528 Number of splices: GC/AG | 82437 Number of splices: AT/AC | 4724 Number of splices: Non-canonical | 13800 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.75 Insertion rate per base | 0.01% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 514437 % of reads mapped to multiple loci | 3.38% Number of reads mapped to too many loci | 289105 % of reads mapped to too many loci | 1.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.29% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1704660 1704660 1704660 N_multimapping 514437 514437 514437 N_noFeature 440835 6751530 6625727 N_ambiguous 85186 19290 18939 UnstrandedReadsAssigned:12457601 PositiveStrandReadsAssigned:6212802 NegativeStrandReadsAssigned:6338956 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192592 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192592-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,202,719 reads, 13,184,396 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR12192592.ke.tsv 34699 SRR12192592.se.tsv 87100 total ==> SRR12192592.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1949 102.19 Potri.005G024800.1.v4.1 1035 936 703 75.5706 Potri.004G059700.1.v4.1 961 862 1 0.116726 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 427.709 15.1318 Potri.016G087400.1.v4.1 270 171 680 400.116 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 340.864 20.488 Potri.012G127500.1.v4.1 977 878 498 57.0701 ==> SRR12192592.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 280 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 0 SRR12192592 completed mapping pipeline successfully