Starting /dee2/code/volunteer_pipeline.sh SRR12192593 current disk space = 3118801620992 free memory = 1449107632 SRR12192593 SRAfilesize 4e8c481b4c53880172f2bebf1c1b2cfe SRR12192593.sra SRR12192593.sra file validated SRR12192593 is single end SRR12192593 is conventional basespace SRR12192593 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192593_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.095 32.0 2.0 32.0 2.0 32.0 2 30.545 32.0 32.0 32.0 27.0 32.0 3 33.1375 32.0 32.0 37.0 32.0 37.0 4 35.5125 37.0 37.0 37.0 32.0 37.0 5 35.225 37.0 37.0 37.0 32.0 37.0 6 37.40875 41.0 37.0 41.0 32.0 41.0 7 38.2525 41.0 37.0 41.0 32.0 41.0 8 39.643 41.0 41.0 41.0 37.0 41.0 9 39.62275 41.0 41.0 41.0 37.0 41.0 10-14 39.7769 41.0 41.0 41.0 37.0 41.0 15-19 39.837849999999996 41.0 41.0 41.0 37.0 41.0 20-24 39.888600000000004 41.0 41.0 41.0 37.0 41.0 25-29 39.77374999999999 41.0 41.0 41.0 37.0 41.0 30-34 39.76985 41.0 41.0 41.0 37.0 41.0 35-39 39.78075 41.0 41.0 41.0 37.0 41.0 40-44 39.60245 41.0 41.0 41.0 37.0 41.0 45-49 39.454750000000004 41.0 41.0 41.0 37.0 41.0 50-54 39.5469 41.0 41.0 41.0 37.0 41.0 55-59 39.46855 41.0 41.0 41.0 37.0 41.0 60-64 39.4966 41.0 41.0 41.0 37.0 41.0 65-69 39.337599999999995 41.0 41.0 41.0 37.0 41.0 70-74 39.4698 41.0 41.0 41.0 37.0 41.0 75-79 38.9827 41.0 39.4 41.0 35.0 41.0 80-84 39.567899999999995 41.0 41.0 41.0 37.0 41.0 85-89 39.5312 41.0 41.0 41.0 37.0 41.0 90-94 39.41695 41.0 41.0 41.0 37.0 41.0 95-99 39.323800000000006 41.0 41.0 41.0 37.0 41.0 100-104 39.1721 41.0 41.0 41.0 37.0 41.0 105-109 39.015699999999995 41.0 41.0 41.0 37.0 41.0 110-114 38.658899999999996 41.0 37.8 41.0 34.0 41.0 115-119 38.50605 41.0 37.0 41.0 32.0 41.0 120-124 38.3691 41.0 37.0 41.0 32.0 41.0 125-129 37.95665 41.0 37.0 41.0 31.0 41.0 130-134 37.596700000000006 41.0 37.0 41.0 29.0 41.0 135-139 37.017100000000006 41.0 37.0 41.0 27.0 41.0 140-144 36.549400000000006 41.0 37.0 41.0 27.0 41.0 145-149 36.0652 41.0 34.0 41.0 26.0 41.0 150 35.6575 41.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 8.0 24 6.0 25 8.0 26 14.0 27 16.0 28 17.0 29 25.0 30 28.0 31 32.0 32 58.0 33 58.0 34 74.0 35 131.0 36 158.0 37 223.0 38 468.0 39 1191.0 40 1484.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.633587786259543 16.14503816793893 13.511450381679388 42.70992366412214 2 20.9 19.950000000000003 36.575 22.575 3 23.45 23.150000000000002 26.900000000000002 26.5 4 26.21310655327664 27.613806903451728 21.160580290145074 25.012506253126567 5 26.081520380095025 32.808202050512634 21.605401350337583 19.504876219054765 6 20.7 36.325 22.475 20.5 7 19.15 19.625 40.949999999999996 20.275000000000002 8 19.325 24.65 29.175 26.85 9 20.275000000000002 24.25 30.425 25.05 10-14 22.72613630681534 29.156457822891145 25.876293814690737 22.24111205560278 15-19 21.966098304915246 27.486374318715935 26.981349067453376 23.566178308915443 20-24 22.759999999999998 27.950000000000003 26.705000000000002 22.585 25-29 22.465 27.215 26.810000000000002 23.51 30-34 22.505 27.384999999999998 26.955000000000002 23.155 35-39 22.17 27.845 26.82 23.165 40-44 23.12615630781539 27.086354317715887 26.71633581679084 23.071153557677885 45-49 22.761138056902848 27.231361568078405 26.736336816840844 23.27116355817791 50-54 22.866143307165355 27.11135556777839 26.856342817140856 23.166158307915396 55-59 22.442244224422442 27.532753275327533 26.907690769076908 23.117311731173118 60-64 22.541127056352817 26.64633231661583 27.166358317915893 23.646182309115456 65-69 22.579837821603764 27.02973270597657 27.184903393733105 23.205526078686557 70-74 23.125 27.27 26.729999999999997 22.875 75-79 22.7 27.265 27.0 23.035 80-84 22.720000000000002 26.93 26.99 23.36 85-89 22.55 27.52 26.75 23.18 90-94 22.915 27.68 26.66 22.745 95-99 23.425 26.700000000000003 27.35 22.525000000000002 100-104 23.181159057952897 26.95634781739087 26.511325566278316 23.35116755837792 105-109 23.095 27.415 26.57 22.919999999999998 110-114 22.985 27.525 26.6 22.89 115-119 23.61 27.584999999999997 26.314999999999998 22.49 120-124 22.919999999999998 27.325 26.57 23.185 125-129 23.025000000000002 27.83 26.3 22.845 130-134 23.34 26.805 26.784999999999997 23.07 135-139 23.43 27.96 26.125 22.485 140-144 23.645640538242212 27.787504376969636 25.536491421139512 23.030363663648643 145-149 24.991246060727327 28.492821769796407 24.766144765144315 21.74978740433195 150 24.675 26.875 25.85 22.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 2.5 25 3.5 26 4.5 27 4.5 28 5.0 29 8.5 30 12.0 31 17.5 32 26.0 33 38.0 34 49.0 35 54.0 36 61.5 37 80.5 38 109.0 39 137.5 40 167.0 41 205.5 42 233.5 43 258.0 44 266.0 45 257.0 46 267.0 47 260.0 48 233.0 49 199.5 50 155.0 51 127.0 52 109.5 53 85.0 54 67.0 55 56.0 56 41.5 57 38.5 58 45.0 59 39.0 60 32.5 61 29.5 62 22.5 63 24.5 64 34.0 65 31.0 66 30.0 67 26.5 68 17.0 69 12.0 70 4.5 71 1.5 72 1.0 73 1.5 74 2.0 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 34.5 2 0.0 3 0.0 4 0.05 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.005 50-54 0.005 55-59 0.01 60-64 0.005 65-69 0.11 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.045 145-149 0.045 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.875 #Duplication Level Percentage of deduplicated Percentage of total 1 96.98064516129033 93.95 2 2.8645161290322583 5.55 3 0.12903225806451613 0.375 4 0.0 0.0 5 0.025806451612903226 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.2875 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138 2.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 40 0.008075264 17.957813 95-99 >>END_MODULE Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760154 READS because READLEN < 1 Read 760154 spots for SRR12192593.sra Written 760154 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra Rejected 760135 READS because READLEN < 1 Read 760135 spots for SRR12192593.sra Written 760135 spots for SRR12192593.sra SRR ids: ['SRR12192593.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b6fh9qpk SRR12192593.sra spots: 15202719 blocks: [[1, 760135], [760136, 1520270], [1520271, 2280405], [2280406, 3040540], [3040541, 3800675], [3800676, 4560810], [4560811, 5320945], [5320946, 6081080], [6081081, 6841215], [6841216, 7601350], [7601351, 8361485], [8361486, 9121620], [9121621, 9881755], [9881756, 10641890], [10641891, 11402025], [11402026, 12162160], [12162161, 12922295], [12922296, 13682430], [13682431, 14442565], [14442566, 15202719]] SRR12192593 file size 5115155 SRR12192593 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192593 SRR12192593_2.fastq Input file: SRR12192593_2.fastq trimmed: SRR12192593-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 07:49:04 2025 >> started Fri Feb 14 07:49:13 2025 >> done (8.758s) 15202719 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 15202719 (100.00%) reads available; of these: 242802 ( 1.60%) trimmed reads available after processing 14959917 (98.40%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 63 1 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 0 0.00% 70 0 0.00% 71 0 0.00% 72 0 0.00% 73 0 0.00% 74 0 0.00% 75 0 0.00% 76 0 0.00% 77 0 0.00% 78 0 0.00% 79 0 0.00% 80 0 0.00% 81 0 0.00% 82 0 0.00% 83 0 0.00% 84 0 0.00% 85 0 0.00% 86 0 0.00% 87 0 0.00% 88 0 0.00% 89 0 0.00% 90 0 0.00% 91 0 0.00% 92 0 0.00% 93 0 0.00% 94 0 0.00% 95 0 0.00% 96 0 0.00% 97 0 0.00% 98 0 0.00% 99 0 0.00% 100 0 0.00% 101 0 0.00% 102 0 0.00% 103 0 0.00% 104 0 0.00% 105 0 0.00% 106 0 0.00% 107 0 0.00% 108 1 0.00% 109 0 0.00% 110 0 0.00% 111 0 0.00% 112 0 0.00% 113 0 0.00% 114 0 0.00% 115 0 0.00% 116 0 0.00% 117 0 0.00% 118 0 0.00% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 1 0.00% 136 3 0.00% 137 0 0.00% 138 3 0.00% 139 5 0.00% 140 9 0.00% 141 25 0.00% 142 41 0.00% 143 118 0.00% 144 269 0.00% 145 732 0.00% 146 2166 0.01% 147 7374 0.05% 148 33267 0.22% 149 198787 1.31% 150 14959917 98.40% 15202719 reads passed initial QC criterion=sequence-density sequence-density=2.41 sequence-density-rank=1 fanout-score=73.49 fanout-score-rank=1 prefix-density=4.28 prefix-fanout=41.4 sequence=AGATCGGAAGAGCGTC criterion=fanout-score sequence-density=2.41 sequence-density-rank=1 fanout-score=73.49 fanout-score-rank=1 prefix-density=4.28 prefix-fanout=41.4 sequence=AGATCGGAAGAGCGTC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTC -o SRR12192593 - Input file: STDIN trimmed: SRR12192593-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Feb 14 07:49:58 2025 >> started Fri Feb 14 07:50:03 2025 >> done (5.294s) 5067573 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 5067570 (100.00%) reads available; of these: 644443 (12.72%) trimmed reads available after processing 4423127 (87.28%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 4 0.00% 25 1 0.00% 26 5 0.00% 27 5 0.00% 28 2 0.00% 29 10 0.00% 30 2 0.00% 31 4 0.00% 32 2 0.00% 33 7 0.00% 34 6 0.00% 35 8 0.00% 36 9 0.00% 37 5 0.00% 38 8 0.00% 39 7 0.00% 40 6 0.00% 41 5 0.00% 42 6 0.00% 43 9 0.00% 44 7 0.00% 45 12 0.00% 46 12 0.00% 47 14 0.00% 48 12 0.00% 49 10 0.00% 50 8 0.00% 51 13 0.00% 52 14 0.00% 53 15 0.00% 54 10 0.00% 55 12 0.00% 56 19 0.00% 57 16 0.00% 58 7 0.00% 59 14 0.00% 60 11 0.00% 61 11 0.00% 62 9 0.00% 63 18 0.00% 64 17 0.00% 65 8 0.00% 66 11 0.00% 67 16 0.00% 68 15 0.00% 69 18 0.00% 70 8 0.00% 71 13 0.00% 72 11 0.00% 73 14 0.00% 74 10 0.00% 75 12 0.00% 76 16 0.00% 77 17 0.00% 78 15 0.00% 79 15 0.00% 80 12 0.00% 81 8 0.00% 82 6 0.00% 83 14 0.00% 84 13 0.00% 85 8 0.00% 86 16 0.00% 87 9 0.00% 88 9 0.00% 89 14 0.00% 90 10 0.00% 91 11 0.00% 92 10 0.00% 93 14 0.00% 94 8 0.00% 95 11 0.00% 96 14 0.00% 97 9 0.00% 98 7 0.00% 99 7 0.00% 100 11 0.00% 101 12 0.00% 102 8 0.00% 103 14 0.00% 104 11 0.00% 105 15 0.00% 106 10 0.00% 107 12 0.00% 108 8 0.00% 109 18 0.00% 110 13 0.00% 111 9 0.00% 112 12 0.00% 113 12 0.00% 114 22 0.00% 115 10 0.00% 116 12 0.00% 117 19 0.00% 118 15 0.00% 119 12 0.00% 120 11 0.00% 121 22 0.00% 122 23 0.00% 123 20 0.00% 124 29 0.00% 125 23 0.00% 126 25 0.00% 127 33 0.00% 128 29 0.00% 129 28 0.00% 130 24 0.00% 131 26 0.00% 132 20 0.00% 133 18 0.00% 134 32204 0.64% 135 33460 0.66% 136 34549 0.68% 137 34875 0.69% 138 34609 0.68% 139 34588 0.68% 140 34244 0.68% 141 35808 0.71% 142 36893 0.73% 143 38425 0.76% 144 40190 0.79% 145 46230 0.91% 146 65046 1.28% 147 145235 2.87% 148 10231 0.20% 149 57655 1.14% 150 4351946 85.88% criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=14.07 fanout-score-rank=14 prefix-density=0.93 prefix-fanout=1.6 sequence=AGCAGAAGAACAGCTGGTTATCGATCTTCATGCTCGTCTTGGCAATAGGTGGTCCAAGATTGCAGCTAGATTGCCTGGAAGGACAGACAATGAGATTAAGAATCACTGGAACACTCATATCAAGAAAAAGCTACTCAAGAGGGGAATCGATCCTGTTACACATGAACCCTTGCACAAAGAAGCCAGGCCTGAAGAAAGTTCATCGTCTCATGCTGATATTTTGCCGGAATCTAGTAACAACAATGTTATGCAAGAAAATGATGGCATCGTTATTAATTCGGACGATAATCCAAGATCACCTACTGAAAATTCTTCTAGTCCAGAGGATTCGATCTTGTTAGATAGTATTTGCAATGATGAAATGTTACTGAACAGCTTGTGGATGGAAGAGCCTCCGCTAGTTGATGCATCATGGAACAATATAATTCCTCCGGCTGCGGCGAATACTAACGACGACACGGGTTATCCTTCATGGGAGGAAAATTACACATGGTTATCGGACTGTCAAGAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=268.59 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=16.7 sequence=TCTTCTCTTTACCTTGCAGAGTTTAACAAAACCAGCAGCTTAGTATATATATCTTTCTCCTGCATATCAGCCCAATGGCCACCTCCAAGATCTTAGCACCCTTATGTTTGATGGTCCTCGTTTTCGGTCTTTGCTTGTCAATGGTTGAATCTCAAAGTTATGGTGTGTGTGAAGGATTCGATCCTGAAGCACCTCGATGCGCAGTTAGATGCAGCGTTCCTGACTATGTTTGTGGGACTGACGGTGTCACCTACACTTGTGGTTGCAAAGACGCTTTCTGCAATGGTGTTGATGTTGTCAAGAAAGGGAAATGCTAGGCCTGTACATTTGTGTCCATGAAGTGTTAATGCCCGCCCCATCGTCCGCCTCCGTTAATGTCTTCTAGAGTTCAGTAATAACGTGTTTTAGTACCACTTGAAATCATTTCAAGCAGTT Started job on | Feb 14 07:50:38 Started mapping on | Feb 14 07:50:39 Finished on | Feb 14 07:51:39 Mapping speed, Million of reads per hour | 912.16 Number of input reads | 15202716 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 12930802 Uniquely mapped reads % | 85.06% Average mapped length | 148.49 Number of splices: Total | 6465650 Number of splices: Annotated (sjdb) | 6296790 Number of splices: GT/AG | 6364146 Number of splices: GC/AG | 81045 Number of splices: AT/AC | 4585 Number of splices: Non-canonical | 15874 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 2.75 Insertion rate per base | 0.01% Insertion average length | 1.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 521211 % of reads mapped to multiple loci | 3.43% Number of reads mapped to too many loci | 287025 % of reads mapped to too many loci | 1.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.59% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1750703 1750703 1750703 N_multimapping 521211 521211 521211 N_noFeature 438730 6632299 6690158 N_ambiguous 85033 19345 18856 UnstrandedReadsAssigned:12407039 PositiveStrandReadsAssigned:6279158 NegativeStrandReadsAssigned:6221788 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192593 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192593-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,202,716 reads, 13,170,033 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR12192593.ke.tsv 34699 SRR12192593.se.tsv 87100 total ==> SRR12192593.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1945.42 102.144 Potri.005G024800.1.v4.1 1035 936 700 75.3528 Potri.004G059700.1.v4.1 961 862 1 0.116888 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 426.236 15.1007 Potri.016G087400.1.v4.1 270 171 653 384.764 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 338.863 20.396 Potri.012G127500.1.v4.1 977 878 498 57.1494 ==> SRR12192593.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 282 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 0 SRR12192593 completed mapping pipeline successfully