Starting /dee2/code/volunteer_pipeline.sh SRR12192594 current disk space = 3116914167808 free memory = 1578280216 SRR12192594 SRAfilesize acb22a2f173577572e79412c32d20951 SRR12192594.sra SRR12192594.sra file validated SRR12192594 is single end SRR12192594 is conventional basespace SRR12192594 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192594_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.03875 32.0 2.0 32.0 2.0 32.0 2 31.7175 32.0 32.0 32.0 32.0 32.0 3 34.91375 37.0 32.0 37.0 32.0 37.0 4 36.27 37.0 37.0 37.0 37.0 37.0 5 36.66125 37.0 37.0 37.0 37.0 37.0 6 40.312 41.0 41.0 41.0 37.0 41.0 7 40.3955 41.0 41.0 41.0 41.0 41.0 8 40.4215 41.0 41.0 41.0 41.0 41.0 9 40.4145 41.0 41.0 41.0 41.0 41.0 10-14 40.429700000000004 41.0 41.0 41.0 41.0 41.0 15-19 40.2801 41.0 41.0 41.0 40.2 41.0 20-24 40.4111 41.0 41.0 41.0 41.0 41.0 25-29 40.4223 41.0 41.0 41.0 41.0 41.0 30-34 40.208299999999994 41.0 41.0 41.0 39.4 41.0 35-39 40.3584 41.0 41.0 41.0 41.0 41.0 40-44 40.2107 41.0 41.0 41.0 40.2 41.0 45-49 40.316500000000005 41.0 41.0 41.0 41.0 41.0 50-54 40.21640000000001 41.0 41.0 41.0 39.4 41.0 55-59 40.2221 41.0 41.0 41.0 40.2 41.0 60-64 40.03565 41.0 41.0 41.0 38.6 41.0 65-69 40.0116 41.0 41.0 41.0 37.0 41.0 70-74 40.041799999999995 41.0 41.0 41.0 37.8 41.0 75-79 39.77759999999999 41.0 41.0 41.0 37.0 41.0 80-84 40.09935 41.0 41.0 41.0 37.0 41.0 85-89 40.1303 41.0 41.0 41.0 37.8 41.0 90-94 40.1237 41.0 41.0 41.0 38.6 41.0 95-99 39.97495 41.0 41.0 41.0 37.0 41.0 100-104 40.01915 41.0 41.0 41.0 37.0 41.0 105-109 39.9101 41.0 41.0 41.0 37.0 41.0 110-114 39.721900000000005 41.0 41.0 41.0 37.0 41.0 115-119 39.91015 41.0 41.0 41.0 37.0 41.0 120-124 39.677350000000004 41.0 41.0 41.0 37.0 41.0 125-129 39.529450000000004 41.0 41.0 41.0 37.0 41.0 130-134 39.3047 41.0 41.0 41.0 37.0 41.0 135-139 39.23965 41.0 41.0 41.0 37.0 41.0 140-144 39.106100000000005 41.0 41.0 41.0 36.0 41.0 145-149 38.7986 41.0 41.0 41.0 33.0 41.0 150 38.66925 41.0 41.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 4.0 26 4.0 27 7.0 28 8.0 29 6.0 30 16.0 31 23.0 32 17.0 33 34.0 34 44.0 35 54.0 36 79.0 37 146.0 38 189.0 39 496.0 40 2871.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.787348586810232 12.6514131897712 16.04979811574697 40.5114401076716 2 22.400000000000002 18.35 33.975 25.275 3 23.9 22.075 26.474999999999998 27.55 4 28.46423211605803 25.6128064032016 21.76088044022011 24.16208104052026 5 28.449999999999996 30.65 23.325000000000003 17.575 6 21.075 35.575 23.05 20.3 7 20.8 18.2 39.574999999999996 21.425 8 21.75 22.075 29.775000000000002 26.400000000000002 9 21.125 22.8 31.4 24.675 10-14 23.674999999999997 27.49 25.924999999999997 22.91 15-19 24.11 25.715 26.72 23.455000000000002 20-24 23.505000000000003 25.679999999999996 26.93 23.885 25-29 23.575 25.619999999999997 26.77 24.035 30-34 23.715 26.145000000000003 25.88 24.26 35-39 23.075000000000003 26.305 26.07 24.55 40-44 24.205 25.505 26.255 24.035 45-49 24.779999999999998 24.7 26.889999999999997 23.630000000000003 50-54 23.94 25.94 26.19 23.93 55-59 23.98 25.775 26.064999999999998 24.18 60-64 24.02 25.924999999999997 26.045 24.01 65-69 24.465 25.635 26.125 23.775 70-74 23.595 25.665 26.009999999999998 24.73 75-79 23.830000000000002 26.090000000000003 25.96 24.12 80-84 24.060000000000002 26.6 26.215 23.125 85-89 24.44 25.455 26.11 23.995 90-94 24.26 25.8 26.305 23.635 95-99 23.885 25.6 26.465 24.05 100-104 24.410749136766253 25.231446729720265 26.57258669869389 23.785217434819597 105-109 24.490000000000002 25.88 26.145000000000003 23.485 110-114 24.016614953458113 25.988389550595535 26.32369132218997 23.67130417375638 115-119 24.68481088653192 25.85051030618371 25.830498298979386 23.634180508304983 120-124 24.305659810839213 26.22228894560376 25.79192313466446 23.68012810889256 125-129 23.559135481288774 25.835501300780468 26.285771462877726 24.319591755053033 130-134 23.371551594652782 26.065188003805133 26.31552596004606 24.247734441496018 135-139 23.51381104883907 26.85648518815052 25.820656525220176 23.80904723779023 140-144 24.58 26.669999999999998 25.480000000000004 23.27 145-149 25.02125106255313 27.31136556827841 24.55122756137807 23.11615580779039 150 25.474999999999998 29.049999999999997 24.15 21.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 1.5 25 0.0 26 1.5 27 3.0 28 7.0 29 10.0 30 11.5 31 15.0 32 25.5 33 32.5 34 32.5 35 41.5 36 60.0 37 68.5 38 81.5 39 108.5 40 144.0 41 176.0 42 198.5 43 224.0 44 233.0 45 230.5 46 231.5 47 218.0 48 204.5 49 186.5 50 170.0 51 150.5 52 112.5 53 83.5 54 64.0 55 51.0 56 45.5 57 54.5 58 56.5 59 58.0 60 58.5 61 53.5 62 50.0 63 66.5 64 89.5 65 74.5 66 63.0 67 59.5 68 45.0 69 25.0 70 6.5 71 3.5 72 3.5 73 2.0 74 0.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 25.7 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08499999999999999 105-109 0.0 110-114 0.09 115-119 0.06 120-124 0.08499999999999999 125-129 0.06 130-134 0.135 135-139 0.08 140-144 0.0 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.025 #Duplication Level Percentage of deduplicated Percentage of total 1 94.84009674818597 88.225 2 4.192421392098898 7.8 3 0.429991937651169 1.2 4 0.2418704649287826 0.8999999999999999 5 0.13437248051599032 0.625 6 0.08062348830959419 0.44999999999999996 7 0.0 0.0 8 0.053748992206396125 0.4 9 0.0 0.0 >10 0.026874496103198062 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGT 16 0.4 No Hit CCTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGG 8 0.2 No Hit GCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTG 8 0.2 No Hit NTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGT 6 0.15 No Hit GCTTCATGTGGTCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGTGAAG 6 0.15 No Hit GCCAAATGTTTGAACGATCGGGGAAATTCGAGCTCCGCTTTACTTGTACA 6 0.15 No Hit GGAAATTCGAGCTCCGCTTTACTTGTACAGCTCGTCCATGCCGTGAGTGA 5 0.125 No Hit NCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTG 5 0.125 No Hit GTTTGAACGATCGGGGAAATTCGAGCTCCGCTTTACTTGTACAGCTCGTC 5 0.125 No Hit TCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTG 5 0.125 No Hit TGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.0 0.0 0.0 0.025 0.0 130-131 0.0 0.0 0.0 0.025 0.0 132-133 0.0 0.0 0.0 0.025 0.0 134-135 0.2375 0.0 0.0 0.025 0.0 136-137 1.075 0.0 0.0 0.025 0.0 138 1.775 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTTGC 10 0.0071056043 143.1 5 GGGGGGG 20 0.005951074 28.982279 115-119 >>END_MODULE Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642331 READS because READLEN < 1 Read 642331 spots for SRR12192594.sra Written 642331 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192594.sra Written 642312 spots for SRR12192594.sra SRR ids: ['SRR12192594.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t44b_v9i SRR12192594.sra spots: 12846259 blocks: [[1, 642312], [642313, 1284624], [1284625, 1926936], [1926937, 2569248], [2569249, 3211560], [3211561, 3853872], [3853873, 4496184], [4496185, 5138496], [5138497, 5780808], [5780809, 6423120], [6423121, 7065432], [7065433, 7707744], [7707745, 8350056], [8350057, 8992368], [8992369, 9634680], [9634681, 10276992], [10276993, 10919304], [10919305, 11561616], [11561617, 12203928], [12203929, 12846259]] SRR12192594 file size 4318930 SRR12192594 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192594 SRR12192594_1.fastq Input file: SRR12192594_1.fastq trimmed: SRR12192594-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 09:15:39 2025 >> started Fri Feb 14 09:15:57 2025 >> done (17.799s) 12846259 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 12846259 (100.00%) reads available; of these: 78260 ( 0.61%) trimmed reads available after processing 12767999 (99.39%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 2 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 1 0.00% 46 1 0.00% 47 1 0.00% 48 1 0.00% 49 1 0.00% 50 0 0.00% 51 1 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 2 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 2 0.00% 67 3 0.00% 68 2 0.00% 69 1 0.00% 70 1 0.00% 71 0 0.00% 72 0 0.00% 73 0 0.00% 74 0 0.00% 75 0 0.00% 76 0 0.00% 77 1 0.00% 78 3 0.00% 79 1 0.00% 80 1 0.00% 81 1 0.00% 82 3 0.00% 83 0 0.00% 84 2 0.00% 85 3 0.00% 86 2 0.00% 87 0 0.00% 88 1 0.00% 89 1 0.00% 90 1 0.00% 91 1 0.00% 92 1 0.00% 93 3 0.00% 94 1 0.00% 95 5 0.00% 96 0 0.00% 97 2 0.00% 98 2 0.00% 99 2 0.00% 100 3 0.00% 101 2 0.00% 102 2 0.00% 103 3 0.00% 104 4 0.00% 105 5 0.00% 106 6 0.00% 107 8 0.00% 108 4 0.00% 109 9 0.00% 110 14 0.00% 111 15 0.00% 112 10 0.00% 113 11 0.00% 114 17 0.00% 115 15 0.00% 116 23 0.00% 117 22 0.00% 118 9 0.00% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 0 0.00% 138 0 0.00% 139 1 0.00% 140 2 0.00% 141 8 0.00% 142 11 0.00% 143 55 0.00% 144 106 0.00% 145 235 0.00% 146 635 0.00% 147 2142 0.02% 148 9174 0.07% 149 65652 0.51% 150 12767999 99.39% 12846259 reads passed initial QC criterion=sequence-density sequence-density=1.88 sequence-density-rank=1 fanout-score=80.57 fanout-score-rank=2 prefix-density=3.37 prefix-fanout=45.0 sequence=AGATCGGAAGAGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=10 fanout-score=362.09 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=19.1 sequence=TTCTTCTCTTTACCTTGCAGAGTTTAACAAAACCAGCAGCTTAGTATATATATCTTTCTCCTGCATATCAGCCCAATGGCCACCTCCAAGATCTTAGCACCCTTATGTTTGATGGTCCTCGTTTTCGGTCTTTGCTTGTCAATGGTTGAATCTCAAAGTTATGGTGTGTGTGAAGGATTCGATCCTGAAGCACCTCGATGCGCAGTTAGATGCAGCGTTCCTGACTATGTTTGTGGGACTGACGGTGTCACCTACACTTGTGGTTGCAAAGACGCTTTCTGCAATGGTGTTGATGTTGTCAAGAAAGGGAAATGCTAGGCCTGTACATTTGTGTCCATGAAGTGTTAATGCCCGCCCCATCGTCCGCCTCCGTTAATGTCTTCTAGAGTTCAGTAATAACGTGTTTTAGTACCACTTGAAATCATTTCAAGCAGTTTGGATCAGCTGTCTGTTGTTGTT Started job on | Feb 14 09:16:38 Started mapping on | Feb 14 09:16:38 Finished on | Feb 14 09:18:09 Mapping speed, Million of reads per hour | 508.20 Number of input reads | 12846259 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 9779662 Uniquely mapped reads % | 76.13% Average mapped length | 148.88 Number of splices: Total | 4553849 Number of splices: Annotated (sjdb) | 4419911 Number of splices: GT/AG | 4483019 Number of splices: GC/AG | 55873 Number of splices: AT/AC | 3487 Number of splices: Non-canonical | 11470 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.80 Insertion rate per base | 0.01% Insertion average length | 1.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 440410 % of reads mapped to multiple loci | 3.43% Number of reads mapped to too many loci | 197247 % of reads mapped to too many loci | 1.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 18.89% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2626187 2626187 2626187 N_multimapping 440410 440410 440410 N_noFeature 404516 5175561 4969421 N_ambiguous 68894 15023 14900 UnstrandedReadsAssigned:9306252 PositiveStrandReadsAssigned:4589078 NegativeStrandReadsAssigned:4795341 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192594 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192594-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,846,259 reads, 9,878,758 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR12192594.ke.tsv 34699 SRR12192594.se.tsv 87100 total ==> SRR12192594.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1675 114.698 Potri.005G024800.1.v4.1 1035 936 587 82.4097 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 247 11.4126 Potri.016G087400.1.v4.1 270 171 515 395.756 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 147 11.5393 Potri.012G127500.1.v4.1 977 878 503 75.2817 ==> SRR12192594.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 316 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 4 SRR12192594 completed mapping pipeline successfully