Starting /dee2/code/volunteer_pipeline.sh SRR12192595 current disk space = 3116698427392 free memory = 1580019492 SRR12192595 SRAfilesize be198f3e7e57f94cafdda5ef389d4e6f SRR12192595.sra SRR12192595.sra file validated SRR12192595 is single end SRR12192595 is conventional basespace SRR12192595 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12192595_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.6475 32.0 2.0 32.0 2.0 32.0 2 31.17 32.0 32.0 32.0 32.0 32.0 3 32.79625 32.0 32.0 37.0 32.0 37.0 4 34.18875 37.0 32.0 37.0 32.0 37.0 5 35.8425 37.0 37.0 37.0 32.0 37.0 6 37.48275 41.0 37.0 41.0 32.0 41.0 7 38.5785 41.0 37.0 41.0 32.0 41.0 8 39.11475 41.0 41.0 41.0 37.0 41.0 9 39.47225 41.0 41.0 41.0 37.0 41.0 10-14 39.48645 41.0 41.0 41.0 37.0 41.0 15-19 39.560900000000004 41.0 41.0 41.0 37.0 41.0 20-24 39.4903 41.0 41.0 41.0 37.0 41.0 25-29 39.47365 41.0 41.0 41.0 37.0 41.0 30-34 39.328250000000004 41.0 41.0 41.0 37.0 41.0 35-39 39.3645 41.0 41.0 41.0 37.0 41.0 40-44 39.20465 41.0 41.0 41.0 36.0 41.0 45-49 38.949349999999995 41.0 41.0 41.0 35.0 41.0 50-54 39.06045 41.0 41.0 41.0 37.0 41.0 55-59 39.095749999999995 41.0 41.0 41.0 37.0 41.0 60-64 39.00435 41.0 41.0 41.0 36.0 41.0 65-69 38.8319 41.0 41.0 41.0 34.0 41.0 70-74 38.926649999999995 41.0 41.0 41.0 35.0 41.0 75-79 38.41215 41.0 39.4 41.0 33.0 41.0 80-84 38.98535 41.0 41.0 41.0 36.0 41.0 85-89 38.9111 41.0 41.0 41.0 33.0 41.0 90-94 38.79055 41.0 40.2 41.0 33.0 41.0 95-99 38.633 41.0 37.8 41.0 32.0 41.0 100-104 38.4926 41.0 37.0 41.0 32.0 41.0 105-109 38.2628 41.0 37.0 41.0 32.0 41.0 110-114 37.8989 41.0 37.0 41.0 31.0 41.0 115-119 37.6192 41.0 37.0 41.0 31.0 41.0 120-124 37.47705 41.0 37.0 41.0 30.0 41.0 125-129 36.88005 41.0 37.0 41.0 27.0 41.0 130-134 36.297250000000005 41.0 34.0 41.0 26.0 41.0 135-139 35.836 41.0 32.0 41.0 24.0 41.0 140-144 34.971 37.8 32.0 41.0 22.0 41.0 145-149 34.5632 37.8 32.0 41.0 22.0 41.0 150 33.9115 37.0 27.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 10.0 24 14.0 25 16.0 26 21.0 27 28.0 28 36.0 29 44.0 30 46.0 31 64.0 32 69.0 33 74.0 34 108.0 35 130.0 36 200.0 37 303.0 38 633.0 39 1240.0 40 961.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.52588361299536 13.887897179578722 16.52981078186362 42.056408425562296 2 23.125 20.125 32.5 24.25 3 25.05 23.525 25.525 25.900000000000002 4 26.775 27.775 19.8 25.650000000000002 5 27.200000000000003 30.925000000000004 22.275 19.6 6 21.7 35.475 23.05 19.775000000000002 7 21.6 17.875 39.0 21.525 8 21.125 23.474999999999998 27.775 27.625 9 22.1 21.8 29.875 26.224999999999998 10-14 23.165 27.935 25.83 23.07 15-19 22.905 26.83 26.105 24.16 20-24 23.16 26.810000000000002 26.005 24.025 25-29 23.315 26.915 26.240000000000002 23.53 30-34 23.315 26.889999999999997 26.119999999999997 23.674999999999997 35-39 23.445 26.52 26.479999999999997 23.555 40-44 23.995 26.1 26.384999999999998 23.52 45-49 24.19 26.724999999999998 25.81 23.275000000000002 50-54 23.44 25.924999999999997 25.979999999999997 24.654999999999998 55-59 23.69 26.224999999999998 26.16 23.925 60-64 24.279999999999998 26.27 25.64 23.810000000000002 65-69 23.6724888644212 26.575246484159955 25.51423852660027 24.238026124818575 70-74 23.955000000000002 26.619999999999997 25.245 24.18 75-79 23.705000000000002 26.655 25.94 23.7 80-84 23.145 26.895000000000003 25.365 24.595 85-89 24.349999999999998 26.525 25.385 23.74 90-94 23.77 26.919999999999998 25.715 23.595 95-99 23.665 26.155 26.424999999999997 23.755000000000003 100-104 23.799999999999997 26.245 26.095000000000002 23.86 105-109 23.64 26.41 25.785000000000004 24.165 110-114 24.625 26.045 25.52 23.810000000000002 115-119 24.125 25.95 26.235000000000003 23.69 120-124 23.78 26.525 25.419999999999998 24.275 125-129 23.215 26.045 25.869999999999997 24.87 130-134 23.995 26.915 25.445 23.645 135-139 23.515 26.790000000000003 25.455 24.240000000000002 140-144 24.90373556033405 26.428964344651696 24.978746812021804 23.68855328299245 145-149 25.53010602120424 27.235447089417885 24.0498099619924 23.184636927385476 150 24.474999999999998 27.450000000000003 24.8 23.275000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 1.5 24 1.0 25 1.0 26 3.0 27 5.0 28 5.5 29 8.0 30 12.0 31 19.5 32 25.5 33 30.0 34 34.5 35 52.0 36 72.0 37 82.5 38 97.5 39 119.0 40 142.0 41 175.5 42 211.5 43 221.0 44 230.5 45 247.5 46 230.5 47 200.5 48 188.0 49 176.5 50 161.5 51 137.0 52 104.5 53 84.0 54 71.5 55 55.5 56 52.0 57 56.0 58 54.5 59 59.5 60 57.5 61 48.0 62 51.5 63 73.5 64 81.5 65 66.0 66 53.5 67 49.5 68 43.0 69 21.5 70 8.0 71 6.0 72 4.5 73 2.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 29.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.095 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.02 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.95 #Duplication Level Percentage of deduplicated Percentage of total 1 95.4230973922299 89.64999999999999 2 3.7253858435337945 7.000000000000001 3 0.45236828100053217 1.275 4 0.2394890899414582 0.8999999999999999 5 0.026609898882384245 0.125 6 0.0 0.0 7 0.07982969664715274 0.525 8 0.026609898882384245 0.2 9 0.0 0.0 >10 0.026609898882384245 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGT 13 0.325 No Hit CTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCA 8 0.2 No Hit CTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGC 7 0.17500000000000002 No Hit NTCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGT 7 0.17500000000000002 No Hit TCGAGGTCGACATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTG 7 0.17500000000000002 No Hit CGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.2375 0.0 0.0 0.0 0.0 136-137 1.1 0.0 0.0 0.0 0.0 138 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642331 READS because READLEN < 1 Read 642331 spots for SRR12192595.sra Written 642331 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra Rejected 642312 READS because READLEN < 1 Read 642312 spots for SRR12192595.sra Written 642312 spots for SRR12192595.sra SRR ids: ['SRR12192595.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d8ktkdzm SRR12192595.sra spots: 12846259 blocks: [[1, 642312], [642313, 1284624], [1284625, 1926936], [1926937, 2569248], [2569249, 3211560], [3211561, 3853872], [3853873, 4496184], [4496185, 5138496], [5138497, 5780808], [5780809, 6423120], [6423121, 7065432], [7065433, 7707744], [7707745, 8350056], [8350057, 8992368], [8992369, 9634680], [9634681, 10276992], [10276993, 10919304], [10919305, 11561616], [11561617, 12203928], [12203929, 12846259]] SRR12192595 file size 4318930 SRR12192595 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12192595 SRR12192595_2.fastq Input file: SRR12192595_2.fastq trimmed: SRR12192595-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Feb 14 09:28:03 2025 >> started Fri Feb 14 09:28:10 2025 >> done (7.595s) 12846259 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 1 ( 0.00%) empty reads filtered out after trimming by size control 12846258 (100.00%) reads available; of these: 346206 ( 2.69%) trimmed reads available after processing 12500052 (97.31%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 137 3 0.00% 138 2 0.00% 139 12 0.00% 140 16 0.00% 141 32 0.00% 142 68 0.00% 143 169 0.00% 144 413 0.00% 145 1338 0.01% 146 3786 0.03% 147 12331 0.10% 148 51851 0.40% 149 276185 2.15% 150 12500052 97.31% 12846258 reads passed initial QC criterion=sequence-density sequence-density=1.84 sequence-density-rank=1 fanout-score=79.45 fanout-score-rank=2 prefix-density=3.30 prefix-fanout=44.3 sequence=AGATCGGAAGAGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=10 fanout-score=292.76 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=18.2 sequence=TTCTTCTCTTTACCTTGCAGAGTTTAACAAAACCAGCAGCTTAGTATATATATCTTTCTCCTGCATATCAGCCCAATGGCCACCTCCAAGATCTTAGCACCCTTATGTTTGATGGTCCTCGTTTTCGGTCTTTGCTTGTCAATGGTTGAATCTCAAAGTTATGGTGTGTGTGAAGGATTCGATCCTGAAGCACCTCGATGCGCAGTTAGATGCAGCGTTCCTGACTATGTTTGTGGGACTGACGGTGTCACCTACACTTGTGGTTGCAAAGACGCTTTCTGCAATGGTGTTGATGTTGTCAAGAAAGGGAAATGCTAGGCCTGTACATTTGTGTCCATGAAGTGTTAATGCCCGCCCCATCGTCCGCCTCCGTTAATGTCTTCTAGAGTTCAGTAATAACGTGTTTTAGTACCACTTGAAATCATTTCAAGCAGTTTGGATCAGCTGTCTGTTGTTGTT Started job on | Feb 14 09:28:42 Started mapping on | Feb 14 09:28:42 Finished on | Feb 14 09:30:15 Mapping speed, Million of reads per hour | 497.27 Number of input reads | 12846258 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 9716740 Uniquely mapped reads % | 75.64% Average mapped length | 148.66 Number of splices: Total | 4505150 Number of splices: Annotated (sjdb) | 4369596 Number of splices: GT/AG | 4434205 Number of splices: GC/AG | 54416 Number of splices: AT/AC | 3573 Number of splices: Non-canonical | 12956 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.01% Deletion average length | 2.81 Insertion rate per base | 0.01% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 447211 % of reads mapped to multiple loci | 3.48% Number of reads mapped to too many loci | 194124 % of reads mapped to too many loci | 1.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 19.32% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2682307 2682307 2682307 N_multimapping 447211 447211 447211 N_noFeature 399944 4968103 5109715 N_ambiguous 68382 15267 14489 UnstrandedReadsAssigned:9248414 PositiveStrandReadsAssigned:4733370 NegativeStrandReadsAssigned:4592536 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12192595 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12192595-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,846,258 reads, 9,857,211 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,040 rounds 52401 SRR12192595.ke.tsv 34699 SRR12192595.se.tsv 87100 total ==> SRR12192595.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1669.8 114.64 Potri.005G024800.1.v4.1 1035 936 583 82.0619 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 247.242 11.4536 Potri.016G087400.1.v4.1 270 171 507 390.625 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 147.979 11.6464 Potri.012G127500.1.v4.1 977 878 502 75.3282 ==> SRR12192595.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 315 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 4 SRR12192595 completed mapping pipeline successfully