Starting /dee2/code/volunteer_pipeline.sh SRR12560171 current disk space = 3056948670464 free memory = 1499866868 SRR12560171 SRAfilesize aa137937b014cea18f27e5b7c35c60f1 SRR12560171.sra SRR12560171.sra file validated SRR12560171 is single end SRR12560171 is conventional basespace SRR12560171 read1 length is 47-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12560171_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 47-151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8675 32.0 32.0 32.0 32.0 32.0 2 31.185 32.0 32.0 32.0 32.0 32.0 3 34.64125 37.0 32.0 37.0 32.0 37.0 4 35.8885 37.0 37.0 37.0 32.0 37.0 5 36.0465 37.0 37.0 37.0 32.0 37.0 6 39.2255 41.0 37.0 41.0 37.0 41.0 7 39.46525 41.0 41.0 41.0 37.0 41.0 8 39.612 41.0 41.0 41.0 37.0 41.0 9 39.11075 41.0 41.0 41.0 37.0 41.0 10-14 39.51925 41.0 41.0 41.0 37.0 41.0 15-19 39.46465 41.0 41.0 41.0 37.0 41.0 20-24 39.516450000000006 41.0 41.0 41.0 37.0 41.0 25-29 39.057550000000006 41.0 41.0 41.0 36.0 41.0 30-34 38.874700000000004 41.0 40.2 41.0 35.0 41.0 35-39 39.1962 41.0 41.0 41.0 37.0 41.0 40-44 39.169599999999996 41.0 41.0 41.0 36.0 41.0 45-49 39.10876436609152 41.0 41.0 41.0 36.0 41.0 50-54 38.9088272068017 41.0 40.2 41.0 35.0 41.0 55-59 38.857264316079025 41.0 41.0 41.0 34.0 41.0 60-64 38.557139284821204 41.0 39.4 41.0 32.0 41.0 65-69 38.50482620655164 41.0 39.4 41.0 33.0 41.0 70-74 38.75409371352343 41.0 41.0 41.0 32.0 41.0 75-79 38.66054554458598 41.0 39.4 41.0 32.0 41.0 80-84 38.797886529418655 41.0 41.0 41.0 32.0 41.0 85-89 38.89518902696644 41.0 41.0 41.0 34.0 41.0 90-94 39.05584773353368 41.0 41.0 41.0 36.0 41.0 95-99 38.9199098422239 41.0 41.0 41.0 34.0 41.0 100-104 38.747257700976704 41.0 41.0 41.0 32.0 41.0 105-109 38.6364260762745 41.0 41.0 41.0 32.0 41.0 110-114 38.54740536475307 41.0 39.4 41.0 32.0 41.0 115-119 38.202105790925046 41.0 37.8 41.0 32.0 41.0 120-124 38.062171561060715 41.0 37.0 41.0 32.0 41.0 125-129 37.68637128110265 41.0 37.0 41.0 29.0 41.0 130-134 37.13871253373102 41.0 37.0 41.0 27.0 41.0 135-139 36.554432569336946 41.0 37.0 41.0 25.0 41.0 140-144 36.44404679518315 41.0 37.0 41.0 25.0 41.0 145-149 36.57574021337525 41.0 36.0 41.0 27.0 41.0 150-151 37.107568004034974 41.0 34.5 41.0 29.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 3.0 23 4.0 24 11.0 25 9.0 26 15.0 27 15.0 28 20.0 29 33.0 30 34.0 31 62.0 32 67.0 33 103.0 34 134.0 35 173.0 36 220.0 37 293.0 38 411.0 39 723.0 40 1668.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.799999999999997 12.225 16.400000000000002 42.575 2 25.15 15.55 35.0 24.3 3 21.975 22.875 24.0 31.15 4 24.175 30.125 20.65 25.05 5 22.575 31.65 25.575 20.200000000000003 6 19.650000000000002 32.775 27.075 20.5 7 13.950000000000001 26.775 41.475 17.8 8 17.4 24.099999999999998 34.025 24.474999999999998 9 18.75 21.8 35.699999999999996 23.75 10-14 20.349999999999998 29.270000000000003 27.474999999999998 22.905 15-19 20.215 28.52 27.525 23.74 20-24 20.69 28.37 28.005000000000003 22.935 25-29 20.585 28.605000000000004 27.235 23.575 30-34 20.61 28.694999999999997 27.61 23.085 35-39 20.549999999999997 27.825 28.21 23.415 40-44 21.01 28.51 27.155 23.325000000000003 45-49 21.307130713071306 27.632763276327633 27.632763276327633 23.427342734273427 50-54 21.115278819704926 27.721930482620653 28.502125531382845 22.660665166291576 55-59 21.21530382595649 28.257064266066518 27.47686921730433 23.05076269067267 60-64 21.170292573143286 27.551887971993 28.177044261065266 23.10077519379845 65-69 20.310077519379846 27.936984246061513 28.69717429357339 23.055763940985248 70-74 20.83937771997399 28.172677704967235 27.72247511380121 23.265469461257567 75-79 20.636509207365894 27.742193755004003 27.942353883106485 23.67894315452362 80-84 21.237608891559027 27.65595273856013 28.261740262341046 22.844698107539802 85-89 20.937453052230957 27.672892984125397 28.158645901146777 23.23100806249687 90-94 20.686200851490106 27.78863010267969 28.404708239418987 23.12046080641122 95-99 21.282243926872027 27.32281492612071 28.29451540195342 23.100425745053844 100-104 20.886551465063864 27.95391935887804 27.768595041322314 23.39093413473579 105-109 20.574234604399457 28.090394347847873 28.115448213659366 23.2199228340933 110-114 21.363750313361745 28.18250188017047 27.34018551015292 23.113562296314864 115-119 21.30358485836049 27.846578089746803 27.81649536224618 23.033341689646527 120-124 21.848360244709657 27.69030187543877 27.494734730719085 22.966603149132485 125-129 20.87074283994583 27.56181973215629 28.13362090585344 23.43381652204444 130-134 20.921594217448046 27.708061439614497 27.723120168657765 23.647224174279692 135-139 21.32341858011355 27.43807466211124 27.53353765763955 23.70496910013566 140-144 21.651819417182548 27.107554481856155 28.04871911017162 23.191906990789672 145-149 22.20236879722279 27.256483561364103 26.960383908515418 23.58076373289769 150-151 21.38663684651943 27.42521666200727 27.564998602180594 23.623147889292703 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 71.0 1 38.5 2 3.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 0.5 24 1.0 25 2.0 26 2.0 27 3.5 28 12.0 29 18.5 30 18.5 31 25.0 32 30.5 33 33.0 34 43.5 35 52.0 36 70.0 37 99.5 38 122.5 39 139.5 40 158.0 41 174.0 42 200.0 43 230.5 44 239.0 45 252.5 46 269.5 47 260.0 48 232.0 49 191.0 50 169.0 51 155.0 52 130.5 53 112.5 54 87.5 55 72.5 56 70.0 57 56.5 58 39.5 59 35.0 60 25.0 61 16.5 62 15.5 63 11.0 64 11.0 65 9.5 66 5.5 67 3.5 68 1.5 69 0.5 70 1.0 71 1.0 72 0.0 73 1.5 74 2.0 75 1.0 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 45-49 1.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 1.0 75-79 3.0 80-84 1.0 85-89 1.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 4.0 110-114 0.0 115-119 0.0 120-124 1.0 125-129 2.0 130-134 3.0 135-139 5.0 140-144 18.0 145-149 220.0 150-152 3740.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.65 #Duplication Level Percentage of deduplicated Percentage of total 1 96.30216587427364 91.14999999999999 2 3.5393555203380873 6.7 3 0.10565240359218173 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05282620179609086 1.8499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 42 1.05 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 32 0.8 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAATA 10 0.0068555363 144.825 5 >>END_MODULE Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571268 spots for SRR12560171.sra Written 1571268 spots for SRR12560171.sra Read 1571286 spots for SRR12560171.sra Written 1571286 spots for SRR12560171.sra SRR ids: ['SRR12560171.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6w1m9ewz SRR12560171.sra spots: 31425378 blocks: [[1, 1571268], [1571269, 3142536], [3142537, 4713804], [4713805, 6285072], [6285073, 7856340], [7856341, 9427608], [9427609, 10998876], [10998877, 12570144], [12570145, 14141412], [14141413, 15712680], [15712681, 17283948], [17283949, 18855216], [18855217, 20426484], [20426485, 21997752], [21997753, 23569020], [23569021, 25140288], [25140289, 26711556], [26711557, 28282824], [28282825, 29854092], [29854093, 31425378]] SRR12560171 file size 10373251 SRR12560171 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12560171 SRR12560171_1.fastq Input file: SRR12560171_1.fastq trimmed: SRR12560171-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:25:33 2025 >> started Mon Feb 10 21:25:57 2025 >> done (24.592s) 31425378 reads processed; of these: 14 ( 0.00%) short reads filtered out after trimming by size control 9 ( 0.00%) empty reads filtered out after trimming by size control 31425355 (100.00%) reads available; of these: 5417 ( 0.02%) trimmed reads available after processing 31419938 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 5 0.00% 21 6 0.00% 22 9 0.00% 23 15 0.00% 24 13 0.00% 25 13 0.00% 26 16 0.00% 27 16 0.00% 28 20 0.00% 29 24 0.00% 30 29 0.00% 31 17 0.00% 32 26 0.00% 33 26 0.00% 34 23 0.00% 35 26 0.00% 36 38 0.00% 37 34 0.00% 38 29 0.00% 39 39 0.00% 40 164 0.00% 41 147 0.00% 42 156 0.00% 43 154 0.00% 44 140 0.00% 45 150 0.00% 46 136 0.00% 47 155 0.00% 48 165 0.00% 49 175 0.00% 50 162 0.00% 51 180 0.00% 52 200 0.00% 53 198 0.00% 54 222 0.00% 55 233 0.00% 56 245 0.00% 57 408 0.00% 58 205 0.00% 59 260 0.00% 60 241 0.00% 61 243 0.00% 62 232 0.00% 63 265 0.00% 64 262 0.00% 65 287 0.00% 66 244 0.00% 67 284 0.00% 68 274 0.00% 69 270 0.00% 70 260 0.00% 71 247 0.00% 72 291 0.00% 73 309 0.00% 74 305 0.00% 75 297 0.00% 76 344 0.00% 77 280 0.00% 78 331 0.00% 79 350 0.00% 80 347 0.00% 81 349 0.00% 82 424 0.00% 83 385 0.00% 84 363 0.00% 85 395 0.00% 86 443 0.00% 87 349 0.00% 88 380 0.00% 89 421 0.00% 90 419 0.00% 91 481 0.00% 92 450 0.00% 93 463 0.00% 94 472 0.00% 95 480 0.00% 96 507 0.00% 97 517 0.00% 98 593 0.00% 99 620 0.00% 100 589 0.00% 101 652 0.00% 102 691 0.00% 103 715 0.00% 104 781 0.00% 105 786 0.00% 106 836 0.00% 107 855 0.00% 108 944 0.00% 109 928 0.00% 110 992 0.00% 111 990 0.00% 112 1135 0.00% 113 1209 0.00% 114 1212 0.00% 115 1275 0.00% 116 1274 0.00% 117 1413 0.00% 118 1526 0.00% 119 1541 0.00% 120 1567 0.00% 121 1623 0.01% 122 1844 0.01% 123 1775 0.01% 124 1992 0.01% 125 2025 0.01% 126 2362 0.01% 127 2587 0.01% 128 2619 0.01% 129 2970 0.01% 130 3161 0.01% 131 3487 0.01% 132 3988 0.01% 133 4488 0.01% 134 5189 0.02% 135 5836 0.02% 136 6928 0.02% 137 7700 0.02% 138 8853 0.03% 139 10810 0.03% 140 11477 0.04% 141 14863 0.05% 142 19433 0.06% 143 27737 0.09% 144 42176 0.13% 145 64190 0.20% 146 88591 0.28% 147 130028 0.41% 148 258040 0.82% 149 502786 1.60% 150 2474885 7.88% 151 27670240 88.05% 31425355 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=38 prefix-density=0.15 prefix-fanout=2.0 sequence=TTACCTTGAAACTAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=312.93 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=29.1 sequence=TCTTCTTCTTCCT Started job on | Feb 10 21:26:22 Started mapping on | Feb 10 21:26:23 Finished on | Feb 10 21:28:18 Mapping speed, Million of reads per hour | 983.75 Number of input reads | 31425355 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 27638410 Uniquely mapped reads % | 87.95% Average mapped length | 150.28 Number of splices: Total | 12855937 Number of splices: Annotated (sjdb) | 12663531 Number of splices: GT/AG | 12631203 Number of splices: GC/AG | 180341 Number of splices: AT/AC | 10971 Number of splices: Non-canonical | 33422 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 977710 % of reads mapped to multiple loci | 3.11% Number of reads mapped to too many loci | 304354 % of reads mapped to too many loci | 0.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.42% % of reads unmapped: other | 1.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2809235 2809235 2809235 N_multimapping 977710 977710 977710 N_noFeature 632787 27432366 726947 N_ambiguous 203610 1961 90072 UnstrandedReadsAssigned:26802013 PositiveStrandReadsAssigned:204083 NegativeStrandReadsAssigned:26821391 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12560171 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12560171-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,425,355 reads, 27,852,650 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52401 SRR12560171.ke.tsv 34699 SRR12560171.se.tsv 87100 total ==> SRR12560171.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2184 61.8039 Potri.005G024800.1.v4.1 1035 936 211 12.2418 Potri.004G059700.1.v4.1 961 862 83 5.22888 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 812.499 15.5143 Potri.016G087400.1.v4.1 270 171 473 150.211 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 451.837 14.6577 Potri.012G127500.1.v4.1 977 878 6479 400.73 ==> SRR12560171.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 29 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 158 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 750 Potri.001G452600.v4.1 485 SRR12560171 completed mapping pipeline successfully