Starting /dee2/code/volunteer_pipeline.sh SRR12560172 current disk space = 3056383213568 free memory = 1257891008 SRR12560172 SRAfilesize 10e3ab885b55a37e5d9ac0fada59cf50 SRR12560172.sra SRR12560172.sra file validated SRR12560172 is single end SRR12560172 is conventional basespace SRR12560172 read1 length is 48-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12560172_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 48-151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8925 32.0 32.0 32.0 32.0 32.0 2 31.285 32.0 32.0 32.0 32.0 32.0 3 34.6575 37.0 32.0 37.0 32.0 37.0 4 36.01325 37.0 37.0 37.0 32.0 37.0 5 35.9585 37.0 37.0 37.0 32.0 37.0 6 39.2165 41.0 41.0 41.0 37.0 41.0 7 39.571 41.0 41.0 41.0 37.0 41.0 8 39.65775 41.0 41.0 41.0 37.0 41.0 9 39.3 41.0 41.0 41.0 37.0 41.0 10-14 39.5458 41.0 41.0 41.0 37.0 41.0 15-19 39.6204 41.0 41.0 41.0 37.0 41.0 20-24 39.5216 41.0 41.0 41.0 37.0 41.0 25-29 39.12645 41.0 41.0 41.0 37.0 41.0 30-34 39.061 41.0 41.0 41.0 35.0 41.0 35-39 39.31475 41.0 41.0 41.0 37.0 41.0 40-44 39.34815 41.0 41.0 41.0 37.0 41.0 45-49 39.26196620405101 41.0 41.0 41.0 37.0 41.0 50-54 39.06326581645411 41.0 41.0 41.0 36.0 41.0 55-59 38.95428857214303 41.0 41.0 41.0 35.0 41.0 60-64 38.674218554638664 41.0 39.4 41.0 32.0 41.0 65-69 38.65756439109778 41.0 39.4 41.0 32.0 41.0 70-74 38.742935733933486 41.0 40.2 41.0 33.0 41.0 75-79 38.82620655163792 41.0 39.4 41.0 34.0 41.0 80-84 39.03925981495373 41.0 41.0 41.0 36.0 41.0 85-89 39.04391097774444 41.0 41.0 41.0 36.0 41.0 90-94 39.14628000765456 41.0 41.0 41.0 36.0 41.0 95-99 39.02616962722042 41.0 41.0 41.0 35.0 41.0 100-104 38.961070803102324 41.0 41.0 41.0 35.0 41.0 105-109 38.76132099074305 41.0 41.0 41.0 32.0 41.0 110-114 38.66259694771078 41.0 41.0 41.0 32.0 41.0 115-119 38.23799659414682 41.0 38.6 41.0 32.0 41.0 120-124 38.28312468703054 41.0 37.0 41.0 32.0 41.0 125-129 37.88022033049574 41.0 37.0 41.0 32.0 41.0 130-134 37.26882338736071 41.0 37.0 41.0 27.0 41.0 135-139 36.770610241161975 41.0 37.0 41.0 27.0 41.0 140-144 36.65903995467848 41.0 37.0 41.0 26.0 41.0 145-149 36.78383979039444 41.0 37.0 41.0 26.0 41.0 150-151 37.115376960674595 39.0 34.5 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 1.0 23 8.0 24 5.0 25 6.0 26 8.0 27 12.0 28 30.0 29 30.0 30 36.0 31 48.0 32 64.0 33 102.0 34 116.0 35 162.0 36 213.0 37 269.0 38 401.0 39 753.0 40 1733.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.35 11.200000000000001 16.900000000000002 46.550000000000004 2 22.400000000000002 16.950000000000003 36.975 23.674999999999997 3 19.900000000000002 23.849999999999998 25.424999999999997 30.825000000000003 4 23.375 29.299999999999997 22.55 24.775 5 24.525 31.75 23.799999999999997 19.925 6 18.224999999999998 34.949999999999996 25.95 20.875 7 14.249999999999998 25.575 40.550000000000004 19.625 8 17.65 23.775 33.900000000000006 24.675 9 17.150000000000002 21.75 35.625 25.474999999999998 10-14 20.14 29.195 27.76 22.905 15-19 20.235 27.925 28.57 23.27 20-24 20.195 27.994999999999997 28.360000000000003 23.45 25-29 20.57 27.97 28.544999999999998 22.915 30-34 19.735 28.1 28.904999999999998 23.26 35-39 19.885 27.589999999999996 28.744999999999997 23.78 40-44 20.485 28.325 28.26 22.93 45-49 20.441022051102557 28.181409070453523 27.83139156957848 23.546177308865442 50-54 20.10502625656414 28.307076769192296 28.33208302075519 23.25581395348837 55-59 20.650162540635158 28.402100525131285 28.22705676419105 22.72068017004251 60-64 20.355088772193046 27.71692923230808 28.6271567891973 23.300825206301575 65-69 20.350087521880468 27.94698674668667 28.212053013253314 23.490872718179546 70-74 20.350087521880468 28.11702925731433 28.347086771692926 23.185796449112278 75-79 20.305076269067268 28.232058014503625 28.212053013253314 23.250812703175793 80-84 20.520130032508128 28.162040510127532 27.976994248562143 23.3408352088022 85-89 20.285071267816953 28.017004251062765 28.687171792948234 23.010752688172044 90-94 20.751413277302515 27.765270898994448 27.490119565761166 23.993196257941868 95-99 21.085814360770577 27.280460345258945 28.516387290467847 23.117338003502628 100-104 21.130848136102077 27.190392794595947 28.43632724543407 23.2424318238679 105-109 20.325243932949714 27.550662997247937 28.401300975731797 23.722792094070552 110-114 20.82561921441081 27.56067050287716 28.30622967225419 23.307480610457844 115-119 21.379241317185464 27.754979481533383 27.74997497747973 23.11580422380142 120-124 21.13169754631948 27.26089133700551 28.112168252378567 23.495242864296443 125-129 21.14171256885328 27.29594391587381 28.73309964947421 22.8292438657987 130-134 21.55703622063023 27.353339011071586 27.944491758929914 23.14513300936827 135-139 20.677200902934537 27.56458490092802 27.970905442688736 23.78730875344871 140-144 21.897149751168755 26.753129241441716 28.39189664706178 22.957824360327752 145-149 20.99048200743116 27.286608642540845 27.933017763526237 23.789891586501753 150-151 20.5387665800629 26.582797757418298 28.25105975659784 24.62737590592096 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 56.0 1 29.0 2 3.0 3 2.0 4 1.0 5 1.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 1.5 20 0.0 21 0.5 22 1.0 23 2.0 24 3.5 25 3.0 26 4.5 27 8.0 28 8.5 29 12.0 30 18.5 31 17.0 32 26.5 33 38.5 34 53.5 35 75.0 36 79.0 37 92.5 38 113.0 39 139.0 40 176.0 41 201.5 42 242.0 43 270.5 44 264.0 45 256.0 46 240.5 47 226.5 48 220.5 49 192.5 50 167.0 51 153.0 52 127.5 53 110.5 54 90.5 55 66.0 56 51.5 57 41.0 58 33.5 59 23.5 60 15.0 61 13.5 62 10.5 63 9.0 64 7.0 65 5.0 66 4.5 67 3.0 68 2.5 69 4.0 70 4.0 71 1.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 45-49 1.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 1.0 90-94 1.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 3.0 120-124 0.0 125-129 0.0 130-134 5.0 135-139 5.0 140-144 16.0 145-149 171.0 150-152 3797.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.8 #Duplication Level Percentage of deduplicated Percentage of total 1 96.01793248945147 91.025 2 3.8765822784810124 7.35 3 0.05274261603375527 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05274261603375527 1.4749999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 36 0.8999999999999999 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 23 0.575 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0125 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138-139 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186732 spots for SRR12560172.sra Written 2186732 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra Read 2186726 spots for SRR12560172.sra Written 2186726 spots for SRR12560172.sra SRR ids: ['SRR12560172.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wttzsxx2 SRR12560172.sra spots: 43734526 blocks: [[1, 2186726], [2186727, 4373452], [4373453, 6560178], [6560179, 8746904], [8746905, 10933630], [10933631, 13120356], [13120357, 15307082], [15307083, 17493808], [17493809, 19680534], [19680535, 21867260], [21867261, 24053986], [24053987, 26240712], [26240713, 28427438], [28427439, 30614164], [30614165, 32800890], [32800891, 34987616], [34987617, 37174342], [37174343, 39361068], [39361069, 41547794], [41547795, 43734526]] SRR12560172 file size 14420267 SRR12560172 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12560172 SRR12560172_1.fastq Input file: SRR12560172_1.fastq trimmed: SRR12560172-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:03:34 2025 >> started Mon Feb 10 21:04:01 2025 >> done (27.453s) 43734526 reads processed; of these: 19 ( 0.00%) short reads filtered out after trimming by size control 1 ( 0.00%) empty reads filtered out after trimming by size control 43734506 (100.00%) reads available; of these: 8120 ( 0.02%) trimmed reads available after processing 43726386 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 7 0.00% 21 9 0.00% 22 16 0.00% 23 14 0.00% 24 27 0.00% 25 40 0.00% 26 35 0.00% 27 25 0.00% 28 34 0.00% 29 55 0.00% 30 57 0.00% 31 51 0.00% 32 47 0.00% 33 50 0.00% 34 43 0.00% 35 61 0.00% 36 54 0.00% 37 45 0.00% 38 65 0.00% 39 56 0.00% 40 244 0.00% 41 272 0.00% 42 216 0.00% 43 258 0.00% 44 331 0.00% 45 264 0.00% 46 259 0.00% 47 259 0.00% 48 273 0.00% 49 290 0.00% 50 276 0.00% 51 276 0.00% 52 341 0.00% 53 346 0.00% 54 336 0.00% 55 362 0.00% 56 381 0.00% 57 522 0.00% 58 352 0.00% 59 449 0.00% 60 417 0.00% 61 394 0.00% 62 397 0.00% 63 418 0.00% 64 416 0.00% 65 431 0.00% 66 514 0.00% 67 452 0.00% 68 474 0.00% 69 488 0.00% 70 496 0.00% 71 455 0.00% 72 519 0.00% 73 540 0.00% 74 567 0.00% 75 575 0.00% 76 604 0.00% 77 655 0.00% 78 726 0.00% 79 713 0.00% 80 761 0.00% 81 848 0.00% 82 956 0.00% 83 957 0.00% 84 1020 0.00% 85 1080 0.00% 86 1242 0.00% 87 1177 0.00% 88 1263 0.00% 89 1474 0.00% 90 1504 0.00% 91 1514 0.00% 92 1573 0.00% 93 1516 0.00% 94 1706 0.00% 95 1727 0.00% 96 1839 0.00% 97 1999 0.00% 98 2148 0.00% 99 2287 0.01% 100 2417 0.01% 101 2340 0.01% 102 2633 0.01% 103 2836 0.01% 104 2950 0.01% 105 3289 0.01% 106 3261 0.01% 107 3328 0.01% 108 3484 0.01% 109 3642 0.01% 110 4079 0.01% 111 4290 0.01% 112 4761 0.01% 113 4836 0.01% 114 5058 0.01% 115 5418 0.01% 116 5562 0.01% 117 5964 0.01% 118 6142 0.01% 119 6520 0.01% 120 6659 0.02% 121 7415 0.02% 122 8168 0.02% 123 8617 0.02% 124 9170 0.02% 125 9448 0.02% 126 9971 0.02% 127 10709 0.02% 128 11244 0.03% 129 12608 0.03% 130 13516 0.03% 131 14746 0.03% 132 16102 0.04% 133 17191 0.04% 134 18978 0.04% 135 21084 0.05% 136 23606 0.05% 137 26609 0.06% 138 29232 0.07% 139 34884 0.08% 140 38824 0.09% 141 45917 0.10% 142 56734 0.13% 143 69711 0.16% 144 92593 0.21% 145 128021 0.29% 146 171159 0.39% 147 250053 0.57% 148 442373 1.01% 149 843003 1.93% 150 4161415 9.52% 151 36995982 84.59% 43734506 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=32 prefix-density=0.21 prefix-fanout=2.0 sequence=TTACCTTGAAACTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=142.49 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.5 sequence=GAAGAGGAAGGTGGTCTTTTATTACGAACAACCTCGTTGCAAAGCACAAGAAGGTCCAGGAAACAACAACTGCCCACAATAAATAGAACCCAGATGAAACTGGGCTGTACGGTAGCACAAACAGTAAATAAATTAGATGGAACCCCCCATTTGATCAATAATTTAAAAAGAAATTAAGAACAAACAAACAATATTCTGCTAATTAAAAGCCCACTTCCAAATCCGGGTCTCCTACTTCTCCCATCTCACTTCCTAATCTTGAGAAGGCATAGGGAACATTTTGAAGCCAAAACCAATATTTGAACATAATAAGATGATGATGTGCAAGATTGTCACGTTGAAGTTTGAGACTGGAGAATGGTAAAACTTGTAGCTTTCTGACGCAAAACTTAGACCCTTATTGAATGGATTTGGATAGGATGCTTCGTATCTACACATTTCGCTATTGGAGCCTTCCTTTATTACGTTGCTGAAACTAAAACTTGATTTTCTGTGATGAATGGAGGAGTTT Started job on | Feb 10 21:04:30 Started mapping on | Feb 10 21:04:30 Finished on | Feb 10 21:06:45 Mapping speed, Million of reads per hour | 1166.25 Number of input reads | 43734506 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 38988044 Uniquely mapped reads % | 89.15% Average mapped length | 150.08 Number of splices: Total | 17857497 Number of splices: Annotated (sjdb) | 17567372 Number of splices: GT/AG | 17541969 Number of splices: GC/AG | 251513 Number of splices: AT/AC | 16804 Number of splices: Non-canonical | 47211 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1411358 % of reads mapped to multiple loci | 3.23% Number of reads mapped to too many loci | 434897 % of reads mapped to too many loci | 0.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.13% % of reads unmapped: other | 1.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3335104 3335104 3335104 N_multimapping 1411358 1411358 1411358 N_noFeature 926724 38676230 1081003 N_ambiguous 283059 3112 122911 UnstrandedReadsAssigned:37778261 PositiveStrandReadsAssigned:308702 NegativeStrandReadsAssigned:37784130 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12560172 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12560172-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,734,506 reads, 39,243,527 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,258 rounds 52401 SRR12560172.ke.tsv 34699 SRR12560172.se.tsv 87100 total ==> SRR12560172.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 3800 78.1375 Potri.005G024800.1.v4.1 1035 936 355 14.9659 Potri.004G059700.1.v4.1 961 862 74 3.38747 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1282.11 17.7888 Potri.016G087400.1.v4.1 270 171 522 120.455 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1083.91 25.5499 Potri.012G127500.1.v4.1 977 878 8198 368.438 ==> SRR12560172.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 71 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 311 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 1311 Potri.001G452600.v4.1 842 SRR12560172 completed mapping pipeline successfully