Starting /dee2/code/volunteer_pipeline.sh SRR12560173 current disk space = 3056141639680 free memory = 1445114888 SRR12560173 SRAfilesize 260d387fd61122787cabfd16b82c3306 SRR12560173.sra SRR12560173.sra file validated SRR12560173 is single end SRR12560173 is conventional basespace SRR12560173 read1 length is 85-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12560173_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 85-151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.885 32.0 32.0 32.0 32.0 32.0 2 31.18875 32.0 32.0 32.0 32.0 32.0 3 34.6275 37.0 32.0 37.0 32.0 37.0 4 35.8735 37.0 37.0 37.0 32.0 37.0 5 35.918 37.0 37.0 37.0 32.0 37.0 6 39.132 41.0 37.0 41.0 37.0 41.0 7 39.4305 41.0 41.0 41.0 37.0 41.0 8 39.56625 41.0 41.0 41.0 37.0 41.0 9 39.3735 41.0 41.0 41.0 37.0 41.0 10-14 39.474250000000005 41.0 41.0 41.0 37.0 41.0 15-19 39.549099999999996 41.0 41.0 41.0 37.0 41.0 20-24 39.54015 41.0 41.0 41.0 37.0 41.0 25-29 39.052350000000004 41.0 41.0 41.0 37.0 41.0 30-34 38.99935 41.0 41.0 41.0 35.0 41.0 35-39 39.2147 41.0 41.0 41.0 37.0 41.0 40-44 39.16215 41.0 41.0 41.0 37.0 41.0 45-49 39.152300000000004 41.0 41.0 41.0 37.0 41.0 50-54 38.94005 41.0 40.2 41.0 36.0 41.0 55-59 38.84394999999999 41.0 41.0 41.0 34.0 41.0 60-64 38.693400000000004 41.0 40.2 41.0 33.0 41.0 65-69 38.6031 41.0 39.4 41.0 32.0 41.0 70-74 38.688950000000006 41.0 39.4 41.0 33.0 41.0 75-79 38.5932 41.0 39.4 41.0 32.0 41.0 80-84 39.00175 41.0 41.0 41.0 35.0 41.0 85-89 38.90328087021756 41.0 41.0 41.0 34.0 41.0 90-94 39.0832436098019 41.0 41.0 41.0 37.0 41.0 95-99 38.9929447085314 41.0 41.0 41.0 35.0 41.0 100-104 38.86960220165124 41.0 41.0 41.0 34.0 41.0 105-109 38.692519389542156 41.0 41.0 41.0 32.0 41.0 110-114 38.59044044044044 41.0 40.2 41.0 32.0 41.0 115-119 38.18478478478479 41.0 37.8 41.0 32.0 41.0 120-124 38.16306708540325 41.0 37.0 41.0 32.0 41.0 125-129 37.812766136130946 41.0 37.0 41.0 31.0 41.0 130-134 37.32310103891101 41.0 37.0 41.0 27.0 41.0 135-139 36.718675757874955 41.0 37.0 41.0 26.0 41.0 140-144 36.645344494804 41.0 37.0 41.0 26.0 41.0 145-149 36.67935115903062 41.0 37.0 41.0 27.0 41.0 150-151 37.154722972641935 41.0 34.5 41.0 29.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 2.0 23 1.0 24 4.0 25 7.0 26 8.0 27 10.0 28 18.0 29 35.0 30 47.0 31 54.0 32 87.0 33 104.0 34 130.0 35 160.0 36 217.0 37 272.0 38 431.0 39 736.0 40 1674.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.85 12.15 17.349999999999998 43.65 2 24.125 16.3 36.475 23.1 3 20.674999999999997 23.05 24.6 31.674999999999997 4 24.3 29.225 20.349999999999998 26.125 5 24.925 33.175 22.625 19.275000000000002 6 19.025 33.1 26.424999999999997 21.45 7 14.274999999999999 25.874999999999996 41.85 18.0 8 17.375 22.5 35.949999999999996 24.175 9 17.375 21.475 33.800000000000004 27.35 10-14 20.25 29.335 27.779999999999998 22.634999999999998 15-19 20.505000000000003 27.735 28.665000000000003 23.095 20-24 19.88 27.415 29.110000000000003 23.595 25-29 20.155 27.955000000000002 28.744999999999997 23.145 30-34 20.205000000000002 28.16 28.975 22.66 35-39 19.915 28.43 28.395 23.26 40-44 20.46 28.000000000000004 28.4 23.14 45-49 20.885 27.815 27.865000000000002 23.435 50-54 20.71 27.57 28.53 23.189999999999998 55-59 20.52 27.71 27.975 23.794999999999998 60-64 20.785 27.97 27.92 23.325000000000003 65-69 20.5 28.03 28.32 23.150000000000002 70-74 20.445 27.62 28.025 23.91 75-79 20.41 28.26 28.1 23.23 80-84 21.015 27.735 28.294999999999998 22.955000000000002 85-89 21.054210842168434 28.185637127425483 27.565513102620525 23.194638927785558 90-94 20.73725804031411 27.694693142599906 28.204871705096785 23.3631771119892 95-99 20.335251438578933 27.450587940955717 28.781586189642233 23.432574430823117 100-104 20.380285213910433 27.820865649236925 28.15111333500125 23.64773580185139 105-109 20.855641731298473 27.700775581686266 28.15111333500125 23.29246935201401 110-114 20.5005005005005 27.627627627627625 28.45845845845846 23.413413413413416 115-119 20.565565565565567 28.1981981981982 28.428428428428425 22.80780780780781 120-124 20.974120238274015 27.696851379085945 27.63177654302448 23.697251839615557 125-129 20.462972241707586 27.52279787553863 28.114039482914123 23.900190399839662 130-134 20.702792119905762 27.37480575467442 28.562835229836082 23.35956689558374 135-139 20.95228538457679 27.550047664442328 28.448146104059003 23.04952084692188 140-144 20.975683279742764 26.979501607717044 27.999397106109324 24.045418006430868 145-149 21.008829798031055 27.326702527149095 28.321323454785347 23.343144220034507 150-151 20.36068281938326 27.2852422907489 27.698237885462557 24.65583700440529 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 48.0 1 24.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 2.0 23 3.5 24 3.5 25 3.5 26 5.0 27 6.0 28 12.5 29 15.0 30 14.0 31 25.0 32 30.0 33 38.0 34 52.5 35 67.5 36 80.0 37 100.0 38 128.5 39 146.0 40 171.0 41 192.0 42 210.0 43 250.5 44 258.0 45 254.5 46 262.0 47 251.0 48 238.0 49 211.5 50 171.5 51 140.5 52 122.5 53 104.0 54 85.5 55 66.0 56 50.0 57 40.0 58 28.5 59 21.0 60 19.5 61 14.5 62 12.0 63 10.5 64 5.5 65 3.5 66 5.5 67 5.0 68 2.5 69 2.0 70 1.5 71 1.0 72 0.5 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 84-85 1.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 1.0 94-95 1.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 1.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 2.0 124-125 2.0 126-127 1.0 128-129 0.0 130-131 1.0 132-133 1.0 134-135 2.0 136-137 1.0 138-139 1.0 140-141 3.0 142-143 6.0 144-145 10.0 146-147 39.0 148-149 132.0 150-151 3795.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.075 #Duplication Level Percentage of deduplicated Percentage of total 1 97.13765287535779 93.325 2 2.784283112151965 5.35 3 0.026021337496747333 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.052042674993494666 1.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 30 0.75 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 20 0.5 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTAAAT 10 0.006864391 144.7625 5 AGTGGAT 10 0.006864391 144.7625 8 >>END_MODULE Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095662 spots for SRR12560173.sra Written 2095662 spots for SRR12560173.sra Read 2095672 spots for SRR12560173.sra Written 2095672 spots for SRR12560173.sra SRR ids: ['SRR12560173.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vd_4ghdt SRR12560173.sra spots: 41913250 blocks: [[1, 2095662], [2095663, 4191324], [4191325, 6286986], [6286987, 8382648], [8382649, 10478310], [10478311, 12573972], [12573973, 14669634], [14669635, 16765296], [16765297, 18860958], [18860959, 20956620], [20956621, 23052282], [23052283, 25147944], [25147945, 27243606], [27243607, 29339268], [29339269, 31434930], [31434931, 33530592], [33530593, 35626254], [35626255, 37721916], [37721917, 39817578], [39817579, 41913250]] SRR12560173 file size 13817963 SRR12560173 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12560173 SRR12560173_1.fastq Input file: SRR12560173_1.fastq trimmed: SRR12560173-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:47:13 2025 >> started Mon Feb 10 20:47:51 2025 >> done (37.801s) 41913250 reads processed; of these: 20 ( 0.00%) short reads filtered out after trimming by size control 3 ( 0.00%) empty reads filtered out after trimming by size control 41913227 (100.00%) reads available; of these: 5585 ( 0.01%) trimmed reads available after processing 41907642 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 10 0.00% 21 2 0.00% 22 13 0.00% 23 16 0.00% 24 25 0.00% 25 18 0.00% 26 14 0.00% 27 20 0.00% 28 26 0.00% 29 32 0.00% 30 30 0.00% 31 21 0.00% 32 24 0.00% 33 35 0.00% 34 36 0.00% 35 30 0.00% 36 36 0.00% 37 27 0.00% 38 51 0.00% 39 33 0.00% 40 124 0.00% 41 125 0.00% 42 130 0.00% 43 150 0.00% 44 295 0.00% 45 145 0.00% 46 184 0.00% 47 164 0.00% 48 154 0.00% 49 184 0.00% 50 227 0.00% 51 188 0.00% 52 206 0.00% 53 210 0.00% 54 240 0.00% 55 240 0.00% 56 278 0.00% 57 345 0.00% 58 238 0.00% 59 261 0.00% 60 262 0.00% 61 287 0.00% 62 323 0.00% 63 262 0.00% 64 272 0.00% 65 297 0.00% 66 318 0.00% 67 315 0.00% 68 367 0.00% 69 314 0.00% 70 316 0.00% 71 353 0.00% 72 346 0.00% 73 353 0.00% 74 394 0.00% 75 411 0.00% 76 482 0.00% 77 448 0.00% 78 549 0.00% 79 597 0.00% 80 610 0.00% 81 642 0.00% 82 765 0.00% 83 750 0.00% 84 847 0.00% 85 881 0.00% 86 1057 0.00% 87 1001 0.00% 88 1042 0.00% 89 1213 0.00% 90 1343 0.00% 91 1405 0.00% 92 1446 0.00% 93 1394 0.00% 94 1489 0.00% 95 1607 0.00% 96 1656 0.00% 97 1767 0.00% 98 1924 0.00% 99 1992 0.00% 100 2208 0.01% 101 2385 0.01% 102 2497 0.01% 103 2573 0.01% 104 2816 0.01% 105 3035 0.01% 106 3112 0.01% 107 3147 0.01% 108 3311 0.01% 109 3556 0.01% 110 3914 0.01% 111 4171 0.01% 112 4601 0.01% 113 4863 0.01% 114 5059 0.01% 115 5324 0.01% 116 5501 0.01% 117 5915 0.01% 118 6199 0.01% 119 6499 0.02% 120 6687 0.02% 121 7722 0.02% 122 8461 0.02% 123 9035 0.02% 124 9677 0.02% 125 9783 0.02% 126 10392 0.02% 127 11095 0.03% 128 11957 0.03% 129 13272 0.03% 130 14424 0.03% 131 16080 0.04% 132 17360 0.04% 133 18771 0.04% 134 20372 0.05% 135 22348 0.05% 136 25003 0.06% 137 28088 0.07% 138 31219 0.07% 139 35986 0.09% 140 40253 0.10% 141 47894 0.11% 142 58613 0.14% 143 70934 0.17% 144 93798 0.22% 145 126241 0.30% 146 168919 0.40% 147 246818 0.59% 148 431123 1.03% 149 834407 1.99% 150 4162786 9.93% 151 35186325 83.95% 41913227 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.13 fanout-score-rank=23 prefix-density=0.23 prefix-fanout=2.9 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=393.53 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=30.6 sequence=TCTTCTTCTTCCT Started job on | Feb 10 20:48:22 Started mapping on | Feb 10 20:48:23 Finished on | Feb 10 20:51:06 Mapping speed, Million of reads per hour | 925.69 Number of input reads | 41913227 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 36589041 Uniquely mapped reads % | 87.30% Average mapped length | 150.07 Number of splices: Total | 17478945 Number of splices: Annotated (sjdb) | 17172377 Number of splices: GT/AG | 17168564 Number of splices: GC/AG | 247454 Number of splices: AT/AC | 15224 Number of splices: Non-canonical | 47703 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1626722 % of reads mapped to multiple loci | 3.88% Number of reads mapped to too many loci | 199387 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.26% % of reads unmapped: other | 1.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3697464 3697464 3697464 N_multimapping 1626722 1626722 1626722 N_noFeature 962335 36290239 1103456 N_ambiguous 286482 1862 127443 UnstrandedReadsAssigned:35340224 PositiveStrandReadsAssigned:296940 NegativeStrandReadsAssigned:35358142 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12560173 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12560173-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,913,227 reads, 36,608,512 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,288 rounds 52401 SRR12560173.ke.tsv 34699 SRR12560173.se.tsv 87100 total ==> SRR12560173.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 5033 111.857 Potri.005G024800.1.v4.1 1035 936 578 26.3368 Potri.004G059700.1.v4.1 961 862 46 2.27594 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1428.35 21.4198 Potri.016G087400.1.v4.1 270 171 504 125.703 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1554.66 39.6087 Potri.012G127500.1.v4.1 977 878 8237 400.115 ==> SRR12560173.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 34 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 344 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 44 Potri.001G416900.v4.1 250 Potri.001G452600.v4.1 420 SRR12560173 completed mapping pipeline successfully