Starting /dee2/code/volunteer_pipeline.sh SRR12560174 current disk space = 3056421326848 free memory = 1317149884 SRR12560174 SRAfilesize 8ad78ae0c2a2471877fbd886c84a9d84 SRR12560174.sra SRR12560174.sra file validated SRR12560174 is single end SRR12560174 is conventional basespace SRR12560174 read1 length is 81-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12560174_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 81-151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.88375 32.0 32.0 32.0 32.0 32.0 2 31.141 32.0 32.0 32.0 32.0 32.0 3 34.461 37.0 32.0 37.0 32.0 37.0 4 35.82425 37.0 37.0 37.0 32.0 37.0 5 35.97875 37.0 37.0 37.0 32.0 37.0 6 39.1495 41.0 37.0 41.0 37.0 41.0 7 39.4435 41.0 41.0 41.0 37.0 41.0 8 39.4225 41.0 41.0 41.0 37.0 41.0 9 38.93525 41.0 41.0 41.0 32.0 41.0 10-14 39.40050000000001 41.0 41.0 41.0 37.0 41.0 15-19 39.47395 41.0 41.0 41.0 37.0 41.0 20-24 39.4996 41.0 41.0 41.0 37.0 41.0 25-29 38.996249999999996 41.0 41.0 41.0 37.0 41.0 30-34 38.9255 41.0 40.2 41.0 34.0 41.0 35-39 39.2706 41.0 41.0 41.0 36.0 41.0 40-44 39.163650000000004 41.0 41.0 41.0 36.0 41.0 45-49 39.17155 41.0 41.0 41.0 37.0 41.0 50-54 38.95635 41.0 41.0 41.0 35.0 41.0 55-59 38.862 41.0 41.0 41.0 33.0 41.0 60-64 38.54655 41.0 38.6 41.0 32.0 41.0 65-69 38.54225 41.0 39.4 41.0 32.0 41.0 70-74 38.6237 41.0 39.4 41.0 33.0 41.0 75-79 38.68245 41.0 39.4 41.0 35.0 41.0 80-84 38.950897649412354 41.0 41.0 41.0 34.0 41.0 85-89 38.983495873968494 41.0 41.0 41.0 35.0 41.0 90-94 39.06431607901975 41.0 41.0 41.0 36.0 41.0 95-99 38.93963490872718 41.0 41.0 41.0 35.0 41.0 100-104 38.84852426213106 41.0 41.0 41.0 32.0 41.0 105-109 38.60020846049745 41.0 41.0 41.0 32.0 41.0 110-114 38.54270703027271 41.0 39.4 41.0 32.0 41.0 115-119 38.166124593445076 41.0 37.0 41.0 32.0 41.0 120-124 38.03882033146481 41.0 37.0 41.0 32.0 41.0 125-129 37.83698084818235 41.0 37.0 41.0 32.0 41.0 130-134 37.137657513066486 41.0 37.0 41.0 27.0 41.0 135-139 36.53047305973218 41.0 37.0 41.0 26.0 41.0 140-144 36.546308185168606 41.0 37.0 41.0 25.0 41.0 145-149 36.55706802839426 41.0 37.0 41.0 26.0 41.0 150-151 37.043430493411165 39.0 34.5 41.0 29.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 5.0 23 4.0 24 4.0 25 5.0 26 2.0 27 18.0 28 26.0 29 26.0 30 38.0 31 57.0 32 69.0 33 114.0 34 126.0 35 179.0 36 230.0 37 323.0 38 433.0 39 715.0 40 1626.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.625 11.774999999999999 14.499999999999998 47.099999999999994 2 22.650000000000002 15.075 38.15 24.125 3 21.275 22.5 24.275 31.95 4 23.775 29.349999999999998 21.3 25.575 5 23.575 30.45 24.5 21.475 6 18.375 33.425 26.0 22.2 7 15.375 25.124999999999996 40.65 18.85 8 16.75 22.275 33.050000000000004 27.925 9 18.575 21.125 34.775 25.525 10-14 20.34 28.49 27.735 23.435 15-19 20.745 27.425 27.97 23.86 20-24 21.165 27.655 27.42 23.76 25-29 21.05 27.555000000000003 27.810000000000002 23.585 30-34 20.78 27.994999999999997 27.405 23.82 35-39 20.544999999999998 27.685 28.04 23.73 40-44 21.095 27.515 27.839999999999996 23.549999999999997 45-49 21.58 27.955000000000002 26.63 23.835 50-54 21.22 28.050000000000004 27.150000000000002 23.580000000000002 55-59 21.725 27.584999999999997 27.305 23.385 60-64 21.265 27.395000000000003 27.47 23.87 65-69 21.38 27.48 27.63 23.51 70-74 22.285 27.215 27.36 23.14 75-79 21.485000000000003 27.37 27.029999999999998 24.115000000000002 80-84 21.22318347752163 27.839175876381457 27.19407911186678 23.743561534230135 85-89 21.615403850962743 27.266816704176044 27.656914228557138 23.460865216304075 90-94 22.260565141285323 26.63165791447862 26.55163790947737 24.55613903475869 95-99 21.380345086271568 28.00200050012503 27.291822955738937 23.325831457864467 100-104 21.030515257628814 27.533766883441718 27.51375687843922 23.921960980490244 105-109 21.482889733840306 27.121272763658194 27.556533920352212 23.83930358214929 110-114 21.591193395046286 26.95521641230923 27.650738053540152 23.802852139104328 115-119 21.806354766074556 26.609957468101076 27.33049787340505 24.253189892419314 120-124 22.04984486037434 26.278650785707136 27.744970473426083 23.926533880492443 125-129 21.64380818900791 27.505255781359494 26.779457403143457 24.07147862648914 130-134 21.653563022685162 26.836596724923634 27.522660123190946 23.98718012920026 135-139 22.11138402927465 26.282019148829516 28.216953230738383 23.38964359115745 140-144 22.24959774738536 26.397827835880932 27.086685438455348 24.265888978278358 145-149 22.505221333605014 26.402119097346034 28.12897967500382 22.963679894045132 150-151 21.782178217821784 27.145214521452143 25.948844884488448 25.123762376237625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 1.0 24 1.5 25 1.5 26 3.5 27 7.5 28 11.5 29 11.5 30 17.5 31 25.5 32 29.5 33 35.0 34 41.5 35 58.0 36 76.0 37 97.5 38 114.0 39 138.5 40 167.0 41 198.0 42 229.5 43 240.0 44 255.5 45 251.5 46 250.0 47 244.5 48 217.0 49 188.5 50 180.0 51 154.0 52 120.5 53 105.5 54 97.5 55 88.5 56 65.5 57 56.5 58 44.5 59 35.0 60 28.0 61 20.5 62 16.0 63 16.0 64 14.0 65 7.0 66 4.0 67 5.0 68 5.0 69 4.5 70 3.0 71 2.5 72 2.5 73 2.5 74 2.0 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 80-81 1.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 1.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 1.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 1.0 122-123 0.0 124-125 0.0 126-127 1.0 128-129 1.0 130-131 0.0 132-133 1.0 134-135 2.0 136-137 2.0 138-139 6.0 140-141 5.0 142-143 6.0 144-145 17.0 146-147 44.0 148-149 122.0 150-151 3789.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.825 #Duplication Level Percentage of deduplicated Percentage of total 1 96.74670797831139 93.675 2 3.2274722437387036 6.25 3 0.02581977794990963 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138-139 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTCAT 10 0.006894607 144.55 7 >>END_MODULE Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158462 spots for SRR12560174.sra Written 2158462 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra Read 2158444 spots for SRR12560174.sra Written 2158444 spots for SRR12560174.sra SRR ids: ['SRR12560174.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qjo52elu SRR12560174.sra spots: 43168898 blocks: [[1, 2158444], [2158445, 4316888], [4316889, 6475332], [6475333, 8633776], [8633777, 10792220], [10792221, 12950664], [12950665, 15109108], [15109109, 17267552], [17267553, 19425996], [19425997, 21584440], [21584441, 23742884], [23742885, 25901328], [25901329, 28059772], [28059773, 30218216], [30218217, 32376660], [32376661, 34535104], [34535105, 36693548], [36693549, 38851992], [38851993, 41010436], [41010437, 43168898]] SRR12560174 file size 14228595 SRR12560174 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12560174 SRR12560174_1.fastq Input file: SRR12560174_1.fastq trimmed: SRR12560174-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:05:04 2025 >> started Mon Feb 10 21:05:31 2025 >> done (26.980s) 43168898 reads processed; of these: 16 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 43168882 (100.00%) reads available; of these: 8447 ( 0.02%) trimmed reads available after processing 43160435 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 5 0.00% 20 14 0.00% 21 13 0.00% 22 10 0.00% 23 24 0.00% 24 29 0.00% 25 33 0.00% 26 43 0.00% 27 44 0.00% 28 48 0.00% 29 45 0.00% 30 51 0.00% 31 56 0.00% 32 45 0.00% 33 48 0.00% 34 56 0.00% 35 67 0.00% 36 49 0.00% 37 48 0.00% 38 90 0.00% 39 65 0.00% 40 220 0.00% 41 227 0.00% 42 221 0.00% 43 238 0.00% 44 322 0.00% 45 240 0.00% 46 255 0.00% 47 263 0.00% 48 277 0.00% 49 276 0.00% 50 253 0.00% 51 284 0.00% 52 302 0.00% 53 307 0.00% 54 308 0.00% 55 296 0.00% 56 333 0.00% 57 475 0.00% 58 343 0.00% 59 366 0.00% 60 370 0.00% 61 365 0.00% 62 375 0.00% 63 401 0.00% 64 337 0.00% 65 383 0.00% 66 407 0.00% 67 393 0.00% 68 373 0.00% 69 439 0.00% 70 414 0.00% 71 419 0.00% 72 425 0.00% 73 476 0.00% 74 422 0.00% 75 541 0.00% 76 561 0.00% 77 538 0.00% 78 581 0.00% 79 659 0.00% 80 748 0.00% 81 807 0.00% 82 892 0.00% 83 1009 0.00% 84 1054 0.00% 85 1072 0.00% 86 1171 0.00% 87 1164 0.00% 88 1335 0.00% 89 1365 0.00% 90 1540 0.00% 91 1664 0.00% 92 1639 0.00% 93 1613 0.00% 94 1740 0.00% 95 1814 0.00% 96 1947 0.00% 97 2119 0.00% 98 2338 0.01% 99 2426 0.01% 100 2614 0.01% 101 2728 0.01% 102 2812 0.01% 103 3104 0.01% 104 3210 0.01% 105 3555 0.01% 106 3595 0.01% 107 3586 0.01% 108 3753 0.01% 109 4010 0.01% 110 4375 0.01% 111 4835 0.01% 112 5279 0.01% 113 5590 0.01% 114 5761 0.01% 115 6136 0.01% 116 6261 0.01% 117 6630 0.02% 118 7204 0.02% 119 7316 0.02% 120 7504 0.02% 121 8757 0.02% 122 9690 0.02% 123 9849 0.02% 124 10901 0.03% 125 10912 0.03% 126 11581 0.03% 127 12293 0.03% 128 13235 0.03% 129 14575 0.03% 130 16185 0.04% 131 17620 0.04% 132 18987 0.04% 133 20177 0.05% 134 22359 0.05% 135 24656 0.06% 136 27195 0.06% 137 30850 0.07% 138 34228 0.08% 139 39906 0.09% 140 44735 0.10% 141 52803 0.12% 142 64308 0.15% 143 78134 0.18% 144 102498 0.24% 145 138355 0.32% 146 184932 0.43% 147 273436 0.63% 148 474679 1.10% 149 896814 2.08% 150 4440898 10.29% 151 35918441 83.20% 43168882 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=35 prefix-density=0.23 prefix-fanout=2.0 sequence=TTACCTTGAAACTAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=127.28 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=10.7 sequence=AACAACAACTGCCCACAATAAATAGAACCCAGATGAAACTGGGCTGTACGGTAGCACAAACAGTAAATAAATTAGATGGAACCCCCCATTTGATCAATAATTTAAAAAGAAATTAAGAACAAACAAACAATATTCTGCTAATTAAAAGCCCACTTCCAAATCCGGGTCTCCTACTTCTCCCATCTCACTTCCTAATCTTGAGAAGGCATAGGGAACATTTTGAAGCCAAAACCAATATTTGAACATAATAAGATGATGATGTGCAAGATTGTCACGTTGAAGTTTGAGACTGGAGAATGGTAAAACTTGTAGCTTTCTGACGCAAAACTTAGACCCTTATTGAATGGATTTGGATAGGATGCTTCGTATCTACACATTTCGCTATTGGAGCCTTCCTTTATTACGTTGCTGAAACTAAAACTTGATTTTCTGTGATGAATGGAGGAGTTTTTCGAGCCTAGTAGTGTGTTGGTGGTGGTG Started job on | Feb 10 21:06:01 Started mapping on | Feb 10 21:06:02 Finished on | Feb 10 21:08:56 Mapping speed, Million of reads per hour | 893.15 Number of input reads | 43168882 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 36712925 Uniquely mapped reads % | 85.04% Average mapped length | 150.04 Number of splices: Total | 16920877 Number of splices: Annotated (sjdb) | 16647717 Number of splices: GT/AG | 16619273 Number of splices: GC/AG | 238406 Number of splices: AT/AC | 15229 Number of splices: Non-canonical | 47969 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1713745 % of reads mapped to multiple loci | 3.97% Number of reads mapped to too many loci | 417569 % of reads mapped to too many loci | 0.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.90% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4742212 4742212 4742212 N_multimapping 1713745 1713745 1713745 N_noFeature 854305 36398609 1004707 N_ambiguous 279038 2619 112981 UnstrandedReadsAssigned:35579582 PositiveStrandReadsAssigned:311697 NegativeStrandReadsAssigned:35595237 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12560174 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12560174-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,168,882 reads, 36,621,899 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,301 rounds 52401 SRR12560174.ke.tsv 34699 SRR12560174.se.tsv 87100 total ==> SRR12560174.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 4486 101.687 Potri.005G024800.1.v4.1 1035 936 532 24.724 Potri.004G059700.1.v4.1 961 862 142 7.16579 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1164.82 17.816 Potri.016G087400.1.v4.1 270 171 454 115.49 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 944.801 24.5509 Potri.012G127500.1.v4.1 977 878 8538 423.004 ==> SRR12560174.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 193 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 570 Potri.001G452600.v4.1 1302 SRR12560174 completed mapping pipeline successfully