Starting /dee2/code/volunteer_pipeline.sh SRR12560175 current disk space = 3056773013504 free memory = 1314714324 SRR12560175 SRAfilesize 0dbf5765e7bfaf5cdce8c5874777774c SRR12560175.sra SRR12560175.sra file validated SRR12560175 is single end SRR12560175 is conventional basespace SRR12560175 read1 length is 80-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12560175_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 80-151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.89375 32.0 32.0 32.0 32.0 32.0 2 31.20375 32.0 32.0 32.0 32.0 32.0 3 34.6525 37.0 32.0 37.0 32.0 37.0 4 35.95375 37.0 37.0 37.0 32.0 37.0 5 35.93675 37.0 37.0 37.0 32.0 37.0 6 39.28475 41.0 41.0 41.0 37.0 41.0 7 39.388 41.0 41.0 41.0 37.0 41.0 8 39.54425 41.0 41.0 41.0 37.0 41.0 9 39.087 41.0 41.0 41.0 37.0 41.0 10-14 39.3987 41.0 41.0 41.0 37.0 41.0 15-19 39.554 41.0 41.0 41.0 37.0 41.0 20-24 39.587650000000004 41.0 41.0 41.0 37.0 41.0 25-29 39.08655 41.0 41.0 41.0 37.0 41.0 30-34 39.019099999999995 41.0 41.0 41.0 35.0 41.0 35-39 39.299800000000005 41.0 41.0 41.0 37.0 41.0 40-44 39.28975 41.0 41.0 41.0 37.0 41.0 45-49 39.32215 41.0 41.0 41.0 37.0 41.0 50-54 39.0463 41.0 41.0 41.0 37.0 41.0 55-59 38.99739999999999 41.0 41.0 41.0 35.0 41.0 60-64 38.69154999999999 41.0 39.4 41.0 32.0 41.0 65-69 38.653800000000004 41.0 39.4 41.0 32.0 41.0 70-74 38.78685 41.0 40.2 41.0 33.0 41.0 75-79 38.79145 41.0 39.4 41.0 35.0 41.0 80-84 39.008892985746435 41.0 41.0 41.0 35.0 41.0 85-89 39.05091272818205 41.0 41.0 41.0 36.0 41.0 90-94 39.161890472618154 41.0 41.0 41.0 37.0 41.0 95-99 38.99120548020947 41.0 41.0 41.0 35.0 41.0 100-104 38.97093013607129 41.0 41.0 41.0 35.0 41.0 105-109 38.785689266950214 41.0 41.0 41.0 32.0 41.0 110-114 38.62842131598699 41.0 39.4 41.0 32.0 41.0 115-119 38.34107919528235 41.0 38.6 41.0 32.0 41.0 120-124 38.21109496229646 41.0 37.0 41.0 32.0 41.0 125-129 37.848890024826346 41.0 37.0 41.0 31.0 41.0 130-134 37.21360282548569 41.0 37.0 41.0 27.0 41.0 135-139 36.7069651189895 41.0 37.0 41.0 27.0 41.0 140-144 36.51040020026363 41.0 37.0 41.0 25.0 41.0 145-149 36.55968841864595 41.0 37.0 41.0 26.0 41.0 150-151 37.12062653196868 39.0 34.5 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 2.0 23 1.0 24 6.0 25 3.0 26 10.0 27 6.0 28 24.0 29 24.0 30 33.0 31 57.0 32 77.0 33 102.0 34 126.0 35 155.0 36 222.0 37 319.0 38 416.0 39 766.0 40 1648.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.775 11.725 16.1 44.4 2 24.85 16.75 34.75 23.65 3 21.075 22.35 25.074999999999996 31.5 4 24.8 28.999999999999996 20.849999999999998 25.35 5 23.525 33.35 24.125 19.0 6 20.625 32.275 25.825 21.275 7 14.274999999999999 26.724999999999998 40.775 18.224999999999998 8 18.675 23.175 32.425 25.724999999999998 9 18.825 21.675 34.325 25.174999999999997 10-14 20.560000000000002 28.799999999999997 27.43 23.21 15-19 21.065 27.42 28.095 23.419999999999998 20-24 20.025000000000002 28.110000000000003 27.97 23.895 25-29 20.75 27.99 27.54 23.72 30-34 21.04 27.73 27.47 23.76 35-39 20.674999999999997 27.77 28.18 23.375 40-44 20.995 27.935 27.625 23.445 45-49 21.245 28.265 27.134999999999998 23.355 50-54 21.34 28.044999999999998 27.515 23.1 55-59 21.01 28.395 27.38 23.215 60-64 21.45 27.665 27.279999999999998 23.605 65-69 20.995 27.325 27.72 23.96 70-74 20.785 28.720000000000002 26.96 23.535 75-79 21.165 28.144999999999996 26.935 23.755000000000003 80-84 21.094218843768754 28.035607121424285 27.40548109621924 23.464692938587717 85-89 21.180295073768445 28.132033008252062 27.571892973243312 23.115778944736185 90-94 21.350337584396097 27.71692923230808 27.136784196049014 23.795948987246813 95-99 21.452508377932276 27.54964237483119 27.659680888310913 23.338168358925625 100-104 21.167700620372223 27.906744046427857 27.451470882529517 23.4740844506704 105-109 21.596197147860895 27.020265198899175 27.820865649236925 23.562672004003 110-114 21.866399799849887 27.530647985989493 27.52064048036027 23.08231173380035 115-119 21.934741267140424 27.23451105995396 27.790011009908916 23.040736662996697 120-124 21.876251501802162 27.337805366439728 27.307769323187824 23.478173808570286 125-129 21.826648640528767 27.04922137098793 27.780281408041663 23.34384858044164 130-134 21.245366195771968 27.547339945897203 28.093377417092473 23.113916441238352 135-139 21.581110888309603 26.995187487467415 27.817325045117304 23.606376579105675 140-144 21.76118953132064 27.045762797006077 27.201486914150802 23.99156075752248 145-149 22.014015843997562 26.762136908389195 27.305504773512084 23.91834247410116 150-151 21.520033044196612 27.426683188764972 26.449125705631282 24.604158061407134 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 29.0 1 15.0 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 2.0 22 0.5 23 3.5 24 4.5 25 2.0 26 3.0 27 7.5 28 10.5 29 13.0 30 17.0 31 19.5 32 28.0 33 32.5 34 36.0 35 54.0 36 75.5 37 92.5 38 115.5 39 147.5 40 174.5 41 195.0 42 217.5 43 246.0 44 245.0 45 235.0 46 247.5 47 246.5 48 223.5 49 194.0 50 178.0 51 170.5 52 139.5 53 110.5 54 96.0 55 88.0 56 73.5 57 50.0 58 40.0 59 30.5 60 22.5 61 17.0 62 14.0 63 11.0 64 8.5 65 8.0 66 6.0 67 4.5 68 3.0 69 1.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 80-81 1.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 1.0 98-99 0.0 100-101 0.0 102-103 1.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 1.0 118-119 0.0 120-121 1.0 122-123 0.0 124-125 0.0 126-127 1.0 128-129 1.0 130-131 1.0 132-133 0.0 134-135 2.0 136-137 1.0 138-139 0.0 140-141 9.0 142-143 5.0 144-145 11.0 146-147 43.0 148-149 119.0 150-151 3802.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.05 #Duplication Level Percentage of deduplicated Percentage of total 1 96.72045809474233 92.9 2 3.071317022384175 5.8999999999999995 3 0.15616866215512754 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.052056220718375845 0.75 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 17 0.42500000000000004 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 13 0.325 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGCAG 10 0.006871484 144.71251 6 >>END_MODULE Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577338 spots for SRR12560175.sra Written 1577338 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra Read 1577325 spots for SRR12560175.sra Written 1577325 spots for SRR12560175.sra SRR ids: ['SRR12560175.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_op14pzkz SRR12560175.sra spots: 31546513 blocks: [[1, 1577325], [1577326, 3154650], [3154651, 4731975], [4731976, 6309300], [6309301, 7886625], [7886626, 9463950], [9463951, 11041275], [11041276, 12618600], [12618601, 14195925], [14195926, 15773250], [15773251, 17350575], [17350576, 18927900], [18927901, 20505225], [20505226, 22082550], [22082551, 23659875], [23659876, 25237200], [25237201, 26814525], [26814526, 28391850], [28391851, 29969175], [29969176, 31546513]] SRR12560175 file size 10413403 SRR12560175 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12560175 SRR12560175_1.fastq Input file: SRR12560175_1.fastq trimmed: SRR12560175-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:12:42 2025 >> started Mon Feb 10 21:13:01 2025 >> done (19.612s) 31546513 reads processed; of these: 12 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 31546501 (100.00%) reads available; of these: 4773 ( 0.02%) trimmed reads available after processing 31541728 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 7 0.00% 21 2 0.00% 22 8 0.00% 23 13 0.00% 24 11 0.00% 25 18 0.00% 26 19 0.00% 27 16 0.00% 28 19 0.00% 29 16 0.00% 30 14 0.00% 31 24 0.00% 32 23 0.00% 33 20 0.00% 34 22 0.00% 35 26 0.00% 36 22 0.00% 37 28 0.00% 38 31 0.00% 39 22 0.00% 40 112 0.00% 41 97 0.00% 42 97 0.00% 43 114 0.00% 44 107 0.00% 45 120 0.00% 46 108 0.00% 47 119 0.00% 48 115 0.00% 49 132 0.00% 50 126 0.00% 51 160 0.00% 52 150 0.00% 53 156 0.00% 54 178 0.00% 55 179 0.00% 56 179 0.00% 57 345 0.00% 58 164 0.00% 59 177 0.00% 60 212 0.00% 61 195 0.00% 62 191 0.00% 63 182 0.00% 64 195 0.00% 65 212 0.00% 66 215 0.00% 67 184 0.00% 68 196 0.00% 69 200 0.00% 70 239 0.00% 71 202 0.00% 72 190 0.00% 73 250 0.00% 74 218 0.00% 75 247 0.00% 76 271 0.00% 77 255 0.00% 78 278 0.00% 79 309 0.00% 80 302 0.00% 81 265 0.00% 82 320 0.00% 83 327 0.00% 84 309 0.00% 85 332 0.00% 86 422 0.00% 87 338 0.00% 88 356 0.00% 89 366 0.00% 90 382 0.00% 91 407 0.00% 92 375 0.00% 93 429 0.00% 94 471 0.00% 95 513 0.00% 96 471 0.00% 97 509 0.00% 98 526 0.00% 99 573 0.00% 100 627 0.00% 101 604 0.00% 102 576 0.00% 103 702 0.00% 104 754 0.00% 105 744 0.00% 106 803 0.00% 107 852 0.00% 108 826 0.00% 109 974 0.00% 110 966 0.00% 111 929 0.00% 112 987 0.00% 113 1052 0.00% 114 1153 0.00% 115 1209 0.00% 116 1233 0.00% 117 1248 0.00% 118 1417 0.00% 119 1456 0.00% 120 1419 0.00% 121 1563 0.00% 122 1654 0.01% 123 1719 0.01% 124 1761 0.01% 125 1925 0.01% 126 2026 0.01% 127 2271 0.01% 128 2499 0.01% 129 2603 0.01% 130 2812 0.01% 131 3252 0.01% 132 3502 0.01% 133 4044 0.01% 134 4688 0.01% 135 5564 0.02% 136 6491 0.02% 137 7566 0.02% 138 8631 0.03% 139 10792 0.03% 140 11867 0.04% 141 15295 0.05% 142 20016 0.06% 143 29149 0.09% 144 45032 0.14% 145 68487 0.22% 146 93819 0.30% 147 138326 0.44% 148 273960 0.87% 149 528320 1.67% 150 2574456 8.16% 151 27636141 87.60% 31546501 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=7.65 fanout-score-rank=19 prefix-density=0.24 prefix-fanout=4.4 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=347.22 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=31.8 sequence=TCTTCTTCTTCCT Started job on | Feb 10 21:13:32 Started mapping on | Feb 10 21:13:32 Finished on | Feb 10 21:15:42 Mapping speed, Million of reads per hour | 873.60 Number of input reads | 31546501 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 27064551 Uniquely mapped reads % | 85.79% Average mapped length | 150.28 Number of splices: Total | 12206422 Number of splices: Annotated (sjdb) | 12027203 Number of splices: GT/AG | 11993351 Number of splices: GC/AG | 169432 Number of splices: AT/AC | 10670 Number of splices: Non-canonical | 32969 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 909266 % of reads mapped to multiple loci | 2.88% Number of reads mapped to too many loci | 353795 % of reads mapped to too many loci | 1.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.59% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3572684 3572684 3572684 N_multimapping 909266 909266 909266 N_noFeature 641200 26837061 751375 N_ambiguous 204468 2316 85101 UnstrandedReadsAssigned:26218883 PositiveStrandReadsAssigned:225174 NegativeStrandReadsAssigned:26228075 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12560175 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12560175-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,546,501 reads, 26,970,813 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,231 rounds 52401 SRR12560175.ke.tsv 34699 SRR12560175.se.tsv 87100 total ==> SRR12560175.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1824 55.0247 Potri.005G024800.1.v4.1 1035 936 166 10.2669 Potri.004G059700.1.v4.1 961 862 156 10.4767 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 673.417 13.7076 Potri.016G087400.1.v4.1 270 171 451 152.682 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 233 8.05764 Potri.012G127500.1.v4.1 977 878 7458 491.74 ==> SRR12560175.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 34 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 124 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 912 Potri.001G452600.v4.1 774 SRR12560175 completed mapping pipeline successfully