Starting /dee2/code/volunteer_pipeline.sh SRR12560176 current disk space = 3056358842368 free memory = 1464182828 SRR12560176 SRAfilesize 119e825d4f743ff6cd1748f9fc458def SRR12560176.sra SRR12560176.sra file validated SRR12560176 is single end SRR12560176 is conventional basespace SRR12560176 read1 length is 114-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12560176_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 114-151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.89125 32.0 32.0 32.0 32.0 32.0 2 31.22625 32.0 32.0 32.0 32.0 32.0 3 34.58875 37.0 32.0 37.0 32.0 37.0 4 36.09325 37.0 37.0 37.0 32.0 37.0 5 35.90825 37.0 37.0 37.0 32.0 37.0 6 39.19275 41.0 41.0 41.0 37.0 41.0 7 39.53825 41.0 41.0 41.0 37.0 41.0 8 39.66825 41.0 41.0 41.0 37.0 41.0 9 39.2845 41.0 41.0 41.0 37.0 41.0 10-14 39.50865 41.0 41.0 41.0 37.0 41.0 15-19 39.592150000000004 41.0 41.0 41.0 37.0 41.0 20-24 39.46175 41.0 41.0 41.0 37.0 41.0 25-29 39.07755 41.0 41.0 41.0 37.0 41.0 30-34 38.9744 41.0 41.0 41.0 35.0 41.0 35-39 39.2769 41.0 41.0 41.0 37.0 41.0 40-44 39.28365000000001 41.0 41.0 41.0 36.0 41.0 45-49 39.2119 41.0 41.0 41.0 37.0 41.0 50-54 38.9843 41.0 41.0 41.0 36.0 41.0 55-59 38.9267 41.0 41.0 41.0 34.0 41.0 60-64 38.72265 41.0 40.2 41.0 34.0 41.0 65-69 38.662400000000005 41.0 39.4 41.0 33.0 41.0 70-74 38.63645 41.0 40.2 41.0 32.0 41.0 75-79 38.70755 41.0 39.4 41.0 34.0 41.0 80-84 38.915350000000004 41.0 41.0 41.0 33.0 41.0 85-89 38.9028 41.0 41.0 41.0 34.0 41.0 90-94 39.0676 41.0 41.0 41.0 35.0 41.0 95-99 38.8517 41.0 41.0 41.0 33.0 41.0 100-104 38.81955 41.0 41.0 41.0 35.0 41.0 105-109 38.65155 41.0 41.0 41.0 32.0 41.0 110-114 38.538 41.0 39.4 41.0 32.0 41.0 115-119 38.16959239809953 41.0 37.0 41.0 32.0 41.0 120-124 38.0944230805075 41.0 37.0 41.0 32.0 41.0 125-129 37.69583222201436 41.0 37.0 41.0 30.0 41.0 130-134 37.158866694919816 41.0 37.0 41.0 27.0 41.0 135-139 36.63806985686837 41.0 37.0 41.0 25.0 41.0 140-144 36.4225082964129 41.0 37.0 41.0 24.0 41.0 145-149 36.446608884583426 41.0 37.0 41.0 25.0 41.0 150-151 36.97519416566414 39.0 34.5 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 6.0 23 5.0 24 8.0 25 9.0 26 12.0 27 9.0 28 24.0 29 30.0 30 39.0 31 54.0 32 68.0 33 120.0 34 118.0 35 152.0 36 208.0 37 305.0 38 439.0 39 701.0 40 1693.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.700000000000003 11.975 15.65 44.675 2 24.325 15.875 35.925000000000004 23.875 3 21.325 22.725 25.825 30.125 4 24.625 28.575 20.575 26.224999999999998 5 23.925 33.225 24.025 18.825 6 18.25 33.800000000000004 26.6 21.349999999999998 7 14.374999999999998 27.05 39.375 19.2 8 17.175 25.05 33.225 24.55 9 18.425 22.95 33.175 25.45 10-14 20.080000000000002 29.57 27.384999999999998 22.965 15-19 20.48 27.99 28.095 23.435 20-24 20.485 28.405 28.34 22.770000000000003 25-29 20.055 28.53 27.97 23.445 30-34 20.01 28.675 27.994999999999997 23.32 35-39 20.395 28.544999999999998 28.349999999999998 22.71 40-44 21.099999999999998 28.78 27.384999999999998 22.735 45-49 20.89 28.205000000000002 28.16 22.745 50-54 20.96 28.46 27.839999999999996 22.74 55-59 20.89 28.060000000000002 28.33 22.720000000000002 60-64 20.755000000000003 27.975 27.939999999999998 23.330000000000002 65-69 20.865000000000002 27.58 28.38 23.175 70-74 21.785 27.735 27.750000000000004 22.73 75-79 20.055 28.565 27.735 23.645 80-84 20.674999999999997 28.715000000000003 27.82 22.79 85-89 21.145 28.904999999999998 27.224999999999998 22.725 90-94 21.17 27.83 27.66 23.34 95-99 20.74 28.325 27.935 23.0 100-104 20.72 27.334999999999997 28.335 23.61 105-109 20.9 28.46 27.455000000000002 23.185 110-114 21.2 27.634999999999998 27.465 23.7 115-119 21.745436359089773 27.591897974493623 28.307076769192296 22.355588897224308 120-124 21.55754514079928 27.084479567848746 28.089831441004353 23.268143850347624 125-129 21.028926033430086 27.925132619357424 28.34551095986388 22.700430387348614 130-134 21.256135430231392 27.221276169488128 28.528498447360512 22.994089952919964 135-139 21.866225431207383 27.366626554352187 27.93321299638989 22.833935018050543 140-144 22.446108235767046 27.355409275915783 27.82272247625747 22.375760012059693 145-149 21.643654149895553 27.375554083660266 27.813725989708054 23.16706577673613 150-151 20.329366177691668 28.037641848879048 27.968447273733737 23.664544699695544 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 76.0 1 39.5 2 1.5 3 1.0 4 1.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.5 23 0.5 24 1.0 25 4.0 26 3.5 27 5.5 28 9.5 29 9.5 30 12.5 31 16.0 32 25.5 33 29.5 34 39.5 35 55.5 36 64.0 37 87.0 38 121.5 39 147.0 40 180.5 41 210.0 42 231.0 43 251.5 44 258.5 45 260.5 46 240.0 47 243.5 48 245.5 49 206.0 50 166.0 51 146.0 52 128.5 53 98.0 54 71.5 55 64.0 56 70.5 57 54.5 58 35.5 59 33.5 60 23.0 61 12.5 62 10.5 63 7.5 64 8.0 65 7.0 66 4.0 67 3.0 68 2.5 69 3.0 70 2.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 114 1.0 115 0.0 116 0.0 117 0.0 118 0.0 119 0.0 120 0.0 121 0.0 122 1.0 123 0.0 124 1.0 125 0.0 126 1.0 127 0.0 128 0.0 129 0.0 130 2.0 131 1.0 132 1.0 133 1.0 134 1.0 135 0.0 136 1.0 137 1.0 138 1.0 139 0.0 140 3.0 141 5.0 142 2.0 143 3.0 144 7.0 145 9.0 146 17.0 147 36.0 148 49.0 149 93.0 150 300.0 151 3463.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.625 #Duplication Level Percentage of deduplicated Percentage of total 1 96.38044914134743 91.2 2 3.4610303830911495 6.550000000000001 3 0.10568031704095111 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05284015852047556 1.95 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 41 1.0250000000000001 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 37 0.9249999999999999 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138-139 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTACTA 10 0.0068537686 144.8375 5 AAGATCC 10 0.0068537686 144.8375 9 CTAGAAT 10 0.0068537686 144.8375 1 >>END_MODULE Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561138 spots for SRR12560176.sra Written 1561138 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra Read 1561136 spots for SRR12560176.sra Written 1561136 spots for SRR12560176.sra SRR ids: ['SRR12560176.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_21alqn62 SRR12560176.sra spots: 31222722 blocks: [[1, 1561136], [1561137, 3122272], [3122273, 4683408], [4683409, 6244544], [6244545, 7805680], [7805681, 9366816], [9366817, 10927952], [10927953, 12489088], [12489089, 14050224], [14050225, 15611360], [15611361, 17172496], [17172497, 18733632], [18733633, 20294768], [20294769, 21855904], [21855905, 23417040], [23417041, 24978176], [24978177, 26539312], [26539313, 28100448], [28100449, 29661584], [29661585, 31222722]] SRR12560176 file size 10304958 SRR12560176 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12560176 SRR12560176_1.fastq Input file: SRR12560176_1.fastq trimmed: SRR12560176-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:57:35 2025 >> started Mon Feb 10 20:57:56 2025 >> done (20.311s) 31222722 reads processed; of these: 22 ( 0.00%) short reads filtered out after trimming by size control 8 ( 0.00%) empty reads filtered out after trimming by size control 31222692 (100.00%) reads available; of these: 6653 ( 0.02%) trimmed reads available after processing 31216039 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 5 0.00% 21 7 0.00% 22 10 0.00% 23 17 0.00% 24 22 0.00% 25 24 0.00% 26 21 0.00% 27 14 0.00% 28 19 0.00% 29 23 0.00% 30 38 0.00% 31 31 0.00% 32 34 0.00% 33 33 0.00% 34 31 0.00% 35 46 0.00% 36 36 0.00% 37 44 0.00% 38 36 0.00% 39 55 0.00% 40 166 0.00% 41 201 0.00% 42 172 0.00% 43 215 0.00% 44 204 0.00% 45 180 0.00% 46 213 0.00% 47 226 0.00% 48 195 0.00% 49 223 0.00% 50 209 0.00% 51 220 0.00% 52 243 0.00% 53 229 0.00% 54 241 0.00% 55 225 0.00% 56 255 0.00% 57 443 0.00% 58 254 0.00% 59 318 0.00% 60 277 0.00% 61 268 0.00% 62 310 0.00% 63 297 0.00% 64 273 0.00% 65 265 0.00% 66 299 0.00% 67 322 0.00% 68 303 0.00% 69 335 0.00% 70 370 0.00% 71 305 0.00% 72 329 0.00% 73 337 0.00% 74 301 0.00% 75 306 0.00% 76 382 0.00% 77 362 0.00% 78 369 0.00% 79 394 0.00% 80 387 0.00% 81 394 0.00% 82 428 0.00% 83 392 0.00% 84 442 0.00% 85 408 0.00% 86 543 0.00% 87 432 0.00% 88 423 0.00% 89 462 0.00% 90 509 0.00% 91 534 0.00% 92 482 0.00% 93 505 0.00% 94 502 0.00% 95 515 0.00% 96 563 0.00% 97 598 0.00% 98 626 0.00% 99 626 0.00% 100 660 0.00% 101 677 0.00% 102 696 0.00% 103 795 0.00% 104 823 0.00% 105 822 0.00% 106 866 0.00% 107 867 0.00% 108 965 0.00% 109 991 0.00% 110 1041 0.00% 111 1049 0.00% 112 1037 0.00% 113 1168 0.00% 114 1235 0.00% 115 1260 0.00% 116 1282 0.00% 117 1307 0.00% 118 1430 0.00% 119 1513 0.00% 120 1558 0.00% 121 1581 0.01% 122 1686 0.01% 123 1775 0.01% 124 1947 0.01% 125 1997 0.01% 126 2231 0.01% 127 2432 0.01% 128 2536 0.01% 129 2875 0.01% 130 2927 0.01% 131 3498 0.01% 132 3898 0.01% 133 4378 0.01% 134 4990 0.02% 135 5913 0.02% 136 7053 0.02% 137 7950 0.03% 138 9294 0.03% 139 11457 0.04% 140 13085 0.04% 141 16492 0.05% 142 21396 0.07% 143 30983 0.10% 144 46485 0.15% 145 70945 0.23% 146 97139 0.31% 147 141821 0.45% 148 280309 0.90% 149 536726 1.72% 150 2586285 8.28% 151 27257205 87.30% 31222692 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=7.54 fanout-score-rank=15 prefix-density=0.25 prefix-fanout=4.4 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=59.29 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=11.9 sequence=ATCTCAGCAAACTT Started job on | Feb 10 20:58:21 Started mapping on | Feb 10 20:58:21 Finished on | Feb 10 20:59:50 Mapping speed, Million of reads per hour | 1262.94 Number of input reads | 31222692 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 28067083 Uniquely mapped reads % | 89.89% Average mapped length | 150.25 Number of splices: Total | 12696028 Number of splices: Annotated (sjdb) | 12491241 Number of splices: GT/AG | 12473968 Number of splices: GC/AG | 173896 Number of splices: AT/AC | 11872 Number of splices: Non-canonical | 36292 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 923998 % of reads mapped to multiple loci | 2.96% Number of reads mapped to too many loci | 381476 % of reads mapped to too many loci | 1.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.25% % of reads unmapped: other | 1.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2231611 2231611 2231611 N_multimapping 923998 923998 923998 N_noFeature 682352 27822865 798195 N_ambiguous 216189 2448 85639 UnstrandedReadsAssigned:27168542 PositiveStrandReadsAssigned:241770 NegativeStrandReadsAssigned:27183249 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12560176 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12560176-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,222,692 reads, 28,269,061 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,261 rounds 52401 SRR12560176.ke.tsv 34699 SRR12560176.se.tsv 87100 total ==> SRR12560176.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2050 58.8624 Potri.005G024800.1.v4.1 1035 936 213 12.539 Potri.004G059700.1.v4.1 961 862 245 15.6609 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 705.102 13.6609 Potri.016G087400.1.v4.1 270 171 349 112.457 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 181 5.95775 Potri.012G127500.1.v4.1 977 878 5121 321.38 ==> SRR12560176.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 119 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1267 Potri.001G452600.v4.1 781 SRR12560176 completed mapping pipeline successfully