Starting /dee2/code/volunteer_pipeline.sh SRR12560177 current disk space = 3056452808704 free memory = 1419318780 SRR12560177 SRAfilesize c597e18d40f68f6b27539a4555a141e0 SRR12560177.sra SRR12560177.sra file validated SRR12560177 is single end SRR12560177 is conventional basespace SRR12560177 read1 length is 96-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12560177_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 96-151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.89375 32.0 32.0 32.0 32.0 32.0 2 31.0325 32.0 32.0 32.0 32.0 32.0 3 34.755 37.0 32.0 37.0 32.0 37.0 4 36.046 37.0 37.0 37.0 32.0 37.0 5 35.97075 37.0 37.0 37.0 32.0 37.0 6 39.2035 41.0 41.0 41.0 37.0 41.0 7 39.682 41.0 41.0 41.0 37.0 41.0 8 39.7095 41.0 41.0 41.0 37.0 41.0 9 39.3895 41.0 41.0 41.0 37.0 41.0 10-14 39.5546 41.0 41.0 41.0 37.0 41.0 15-19 39.66135 41.0 41.0 41.0 37.0 41.0 20-24 39.58755 41.0 41.0 41.0 37.0 41.0 25-29 39.163650000000004 41.0 41.0 41.0 37.0 41.0 30-34 39.14635 41.0 41.0 41.0 36.0 41.0 35-39 39.35615 41.0 41.0 41.0 37.0 41.0 40-44 39.35314999999999 41.0 41.0 41.0 37.0 41.0 45-49 39.3347 41.0 41.0 41.0 37.0 41.0 50-54 39.123149999999995 41.0 41.0 41.0 36.0 41.0 55-59 39.02765 41.0 41.0 41.0 36.0 41.0 60-64 38.7846 41.0 40.2 41.0 33.0 41.0 65-69 38.80955 41.0 40.2 41.0 35.0 41.0 70-74 38.8951 41.0 41.0 41.0 33.0 41.0 75-79 38.91760000000001 41.0 39.4 41.0 35.0 41.0 80-84 39.172000000000004 41.0 41.0 41.0 37.0 41.0 85-89 39.18145 41.0 41.0 41.0 36.0 41.0 90-94 39.3249 41.0 41.0 41.0 37.0 41.0 95-99 39.23550642142777 41.0 41.0 41.0 37.0 41.0 100-104 39.129164582291146 41.0 41.0 41.0 35.0 41.0 105-109 38.936818409204605 41.0 41.0 41.0 34.0 41.0 110-114 38.77033516758379 41.0 41.0 41.0 32.0 41.0 115-119 38.507824100220525 41.0 38.6 41.0 32.0 41.0 120-124 38.508559384759245 41.0 38.6 41.0 33.0 41.0 125-129 38.12433650475713 41.0 37.0 41.0 32.0 41.0 130-134 37.50594227178483 41.0 37.0 41.0 29.0 41.0 135-139 37.07553404227649 41.0 37.0 41.0 27.0 41.0 140-144 36.91713431146259 41.0 37.0 41.0 27.0 41.0 145-149 37.00321640942687 41.0 37.0 41.0 28.0 41.0 150-151 37.24286102717828 41.0 34.5 41.0 29.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 4.0 23 3.0 24 1.0 25 5.0 26 13.0 27 13.0 28 18.0 29 24.0 30 33.0 31 44.0 32 54.0 33 100.0 34 107.0 35 145.0 36 214.0 37 278.0 38 398.0 39 743.0 40 1801.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.2 12.325 14.6 47.875 2 21.475 17.675 38.6 22.25 3 19.575 24.0 23.925 32.5 4 22.975 30.475 20.925 25.624999999999996 5 22.7 32.975 23.9 20.424999999999997 6 19.2 32.925 27.275 20.599999999999998 7 14.524999999999999 26.55 40.550000000000004 18.375 8 16.475 22.875 34.8 25.85 9 17.7 21.85 33.675 26.775 10-14 19.73 29.044999999999998 26.729999999999997 24.495 15-19 20.025000000000002 28.105000000000004 27.705000000000002 24.165 20-24 20.244999999999997 27.495000000000005 27.405 24.855 25-29 19.735 28.595 28.01 23.66 30-34 19.830000000000002 28.355000000000004 27.425 24.39 35-39 19.925 27.955000000000002 27.495000000000005 24.625 40-44 20.424999999999997 28.044999999999998 27.955000000000002 23.575 45-49 20.285 27.805000000000003 27.944999999999997 23.965 50-54 20.27 27.965 28.015 23.75 55-59 19.36 28.51 27.634999999999998 24.495 60-64 20.775 27.36 27.284999999999997 24.58 65-69 20.535 27.61 27.725 24.13 70-74 20.5 27.794999999999998 27.185 24.52 75-79 20.935000000000002 27.215 27.915 23.935000000000002 80-84 20.995 27.715 27.41 23.880000000000003 85-89 20.560000000000002 27.37 27.655 24.415 90-94 20.674999999999997 27.834999999999997 27.07 24.42 95-99 20.964192838567712 27.090418083616726 28.180636127225444 23.76475295059012 100-104 20.245122561280642 27.903951975987994 27.55377688844422 24.297148574287146 105-109 20.100050025012507 26.903451725862933 28.494247123561784 24.502251125562783 110-114 20.870435217608804 27.138569284642323 27.923961980990498 24.06703351675838 115-119 21.386039529647235 27.420565424068048 27.540655491618715 23.652739554666 120-124 20.912185841594074 27.035145689396217 27.685991789326124 24.36667667968359 125-129 20.325488232348523 27.521281922884327 27.77666499749624 24.376564847270906 130-134 20.309526194530704 27.34148051687869 28.47841330261445 23.87057998597616 135-139 21.438949847186734 26.559446866075454 27.9072097800491 24.09439350668871 140-144 21.14082175287212 27.301459890633623 27.898459840465563 23.659258516028697 145-149 21.281023194437395 27.07709485865097 27.95513373597929 23.686748210932347 150-151 20.684503599076464 27.814749422789625 26.918375662094256 24.58237131603966 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 5.0 1 4.0 2 1.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 1.0 25 2.5 26 2.5 27 4.5 28 6.0 29 11.0 30 18.0 31 24.5 32 31.5 33 30.5 34 42.5 35 58.0 36 70.0 37 96.0 38 124.5 39 145.5 40 179.5 41 210.0 42 231.5 43 243.5 44 250.5 45 267.5 46 270.0 47 251.0 48 232.5 49 218.0 50 195.0 51 163.0 52 134.0 53 110.0 54 81.5 55 57.0 56 47.5 57 40.5 58 32.0 59 26.5 60 15.5 61 11.0 62 9.0 63 9.5 64 7.0 65 4.0 66 4.0 67 4.5 68 4.0 69 1.5 70 2.5 71 2.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 96-97 1.0 98-99 1.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 1.0 116-117 0.0 118-119 2.0 120-121 0.0 122-123 1.0 124-125 0.0 126-127 0.0 128-129 0.0 130-131 1.0 132-133 0.0 134-135 1.0 136-137 0.0 138-139 4.0 140-141 1.0 142-143 2.0 144-145 16.0 146-147 51.0 148-149 112.0 150-151 3806.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.25876851130164 92.625 2 3.5853468433359312 6.9 3 0.12990387113535984 0.375 4 0.02598077422707197 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551214 spots for SRR12560177.sra Written 1551214 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra Read 1551201 spots for SRR12560177.sra Written 1551201 spots for SRR12560177.sra SRR ids: ['SRR12560177.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7x_7t27l SRR12560177.sra spots: 31024033 blocks: [[1, 1551201], [1551202, 3102402], [3102403, 4653603], [4653604, 6204804], [6204805, 7756005], [7756006, 9307206], [9307207, 10858407], [10858408, 12409608], [12409609, 13960809], [13960810, 15512010], [15512011, 17063211], [17063212, 18614412], [18614413, 20165613], [20165614, 21716814], [21716815, 23268015], [23268016, 24819216], [24819217, 26370417], [26370418, 27921618], [27921619, 29472819], [29472820, 31024033]] SRR12560177 file size 10242465 SRR12560177 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12560177 SRR12560177_1.fastq Input file: SRR12560177_1.fastq trimmed: SRR12560177-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:04:53 2025 >> started Mon Feb 10 21:05:21 2025 >> done (28.137s) 31024033 reads processed; of these: 6 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 31024027 (100.00%) reads available; of these: 3237 ( 0.01%) trimmed reads available after processing 31020790 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 1 0.00% 21 4 0.00% 22 7 0.00% 23 2 0.00% 24 7 0.00% 25 5 0.00% 26 10 0.00% 27 8 0.00% 28 12 0.00% 29 10 0.00% 30 14 0.00% 31 12 0.00% 32 13 0.00% 33 20 0.00% 34 10 0.00% 35 11 0.00% 36 17 0.00% 37 16 0.00% 38 19 0.00% 39 17 0.00% 40 63 0.00% 41 83 0.00% 42 61 0.00% 43 75 0.00% 44 89 0.00% 45 72 0.00% 46 90 0.00% 47 87 0.00% 48 77 0.00% 49 83 0.00% 50 81 0.00% 51 88 0.00% 52 101 0.00% 53 99 0.00% 54 110 0.00% 55 128 0.00% 56 126 0.00% 57 304 0.00% 58 135 0.00% 59 121 0.00% 60 127 0.00% 61 133 0.00% 62 132 0.00% 63 156 0.00% 64 144 0.00% 65 135 0.00% 66 155 0.00% 67 126 0.00% 68 139 0.00% 69 153 0.00% 70 149 0.00% 71 149 0.00% 72 191 0.00% 73 174 0.00% 74 209 0.00% 75 168 0.00% 76 237 0.00% 77 212 0.00% 78 227 0.00% 79 239 0.00% 80 213 0.00% 81 243 0.00% 82 265 0.00% 83 251 0.00% 84 241 0.00% 85 258 0.00% 86 336 0.00% 87 291 0.00% 88 292 0.00% 89 302 0.00% 90 328 0.00% 91 413 0.00% 92 361 0.00% 93 321 0.00% 94 392 0.00% 95 391 0.00% 96 424 0.00% 97 453 0.00% 98 463 0.00% 99 527 0.00% 100 504 0.00% 101 615 0.00% 102 592 0.00% 103 609 0.00% 104 712 0.00% 105 738 0.00% 106 712 0.00% 107 799 0.00% 108 828 0.00% 109 844 0.00% 110 935 0.00% 111 938 0.00% 112 965 0.00% 113 1072 0.00% 114 1127 0.00% 115 1173 0.00% 116 1155 0.00% 117 1249 0.00% 118 1312 0.00% 119 1395 0.00% 120 1400 0.00% 121 1461 0.00% 122 1613 0.01% 123 1690 0.01% 124 1809 0.01% 125 1820 0.01% 126 2066 0.01% 127 2108 0.01% 128 2323 0.01% 129 2555 0.01% 130 2693 0.01% 131 2916 0.01% 132 3380 0.01% 133 3824 0.01% 134 4358 0.01% 135 5104 0.02% 136 5810 0.02% 137 6826 0.02% 138 7651 0.02% 139 9630 0.03% 140 10151 0.03% 141 12922 0.04% 142 17136 0.06% 143 25066 0.08% 144 38994 0.13% 145 58398 0.19% 146 80790 0.26% 147 120348 0.39% 148 239075 0.77% 149 476044 1.53% 150 2373502 7.65% 151 27469878 88.54% 31024027 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=7.91 fanout-score-rank=14 prefix-density=0.19 prefix-fanout=4.7 sequence=CCTCTGCTGGTCTGGGGGAATGCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=319.99 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=31.1 sequence=TCTTCTTCTTCCT Started job on | Feb 10 21:05:50 Started mapping on | Feb 10 21:05:50 Finished on | Feb 10 21:07:33 Mapping speed, Million of reads per hour | 1084.33 Number of input reads | 31024027 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 28129215 Uniquely mapped reads % | 90.67% Average mapped length | 150.32 Number of splices: Total | 13582381 Number of splices: Annotated (sjdb) | 13381201 Number of splices: GT/AG | 13344348 Number of splices: GC/AG | 192843 Number of splices: AT/AC | 10943 Number of splices: Non-canonical | 34247 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 781683 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 192995 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.09% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2113129 2113129 2113129 N_multimapping 781683 781683 781683 N_noFeature 816077 27887861 932410 N_ambiguous 214637 1540 88429 UnstrandedReadsAssigned:27098501 PositiveStrandReadsAssigned:239814 NegativeStrandReadsAssigned:27108376 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12560177 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12560177-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,024,027 reads, 27,478,378 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52401 SRR12560177.ke.tsv 34699 SRR12560177.se.tsv 87100 total ==> SRR12560177.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2047 63.2842 Potri.005G024800.1.v4.1 1035 936 183 11.5992 Potri.004G059700.1.v4.1 961 862 91 6.26306 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 936.517 19.5361 Potri.016G087400.1.v4.1 270 171 397.431 137.885 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 307.457 10.8963 Potri.012G127500.1.v4.1 977 878 8856 598.405 ==> SRR12560177.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 82 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 128 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 542 Potri.001G452600.v4.1 458 SRR12560177 completed mapping pipeline successfully