Starting /dee2/code/volunteer_pipeline.sh SRR12560178 current disk space = 3056842186752 free memory = 1442845016 SRR12560178 SRAfilesize b5a1ea9e182d727cbcda1072dd868cd0 SRR12560178.sra SRR12560178.sra file validated SRR12560178 is single end SRR12560178 is conventional basespace SRR12560178 read1 length is 96-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12560178_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 96-151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.88625 32.0 32.0 32.0 32.0 32.0 2 31.24875 32.0 32.0 32.0 32.0 32.0 3 34.59875 37.0 32.0 37.0 32.0 37.0 4 36.02425 37.0 37.0 37.0 32.0 37.0 5 36.059 37.0 37.0 37.0 32.0 37.0 6 39.1955 41.0 37.0 41.0 37.0 41.0 7 39.54425 41.0 41.0 41.0 37.0 41.0 8 39.5345 41.0 41.0 41.0 37.0 41.0 9 39.2015 41.0 41.0 41.0 37.0 41.0 10-14 39.48 41.0 41.0 41.0 37.0 41.0 15-19 39.5713 41.0 41.0 41.0 37.0 41.0 20-24 39.54765 41.0 41.0 41.0 37.0 41.0 25-29 39.1047 41.0 41.0 41.0 37.0 41.0 30-34 38.9937 41.0 41.0 41.0 35.0 41.0 35-39 39.367000000000004 41.0 41.0 41.0 37.0 41.0 40-44 39.28975 41.0 41.0 41.0 37.0 41.0 45-49 39.317400000000006 41.0 41.0 41.0 37.0 41.0 50-54 39.096999999999994 41.0 41.0 41.0 36.0 41.0 55-59 39.09375 41.0 41.0 41.0 37.0 41.0 60-64 38.72425 41.0 41.0 41.0 33.0 41.0 65-69 38.71585 41.0 39.4 41.0 33.0 41.0 70-74 38.86095 41.0 41.0 41.0 33.0 41.0 75-79 38.90355 41.0 39.4 41.0 35.0 41.0 80-84 39.11579999999999 41.0 41.0 41.0 37.0 41.0 85-89 39.120650000000005 41.0 41.0 41.0 36.0 41.0 90-94 39.3267 41.0 41.0 41.0 37.0 41.0 95-99 39.11191336584146 41.0 41.0 41.0 37.0 41.0 100-104 39.01225337600033 41.0 41.0 41.0 35.0 41.0 105-109 38.88699349674838 41.0 41.0 41.0 33.0 41.0 110-114 38.700200100050026 41.0 41.0 41.0 32.0 41.0 115-119 38.39029440963337 41.0 37.8 41.0 32.0 41.0 120-124 38.34182728410512 41.0 37.0 41.0 32.0 41.0 125-129 38.040930678209214 41.0 37.0 41.0 32.0 41.0 130-134 37.45659904833458 41.0 37.0 41.0 28.0 41.0 135-139 36.93844227397947 41.0 37.0 41.0 27.0 41.0 140-144 36.744563816919836 41.0 37.0 41.0 27.0 41.0 145-149 36.78998932263174 41.0 37.0 41.0 28.0 41.0 150-151 37.158632818653544 41.0 34.5 41.0 29.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 5.0 25 8.0 26 5.0 27 10.0 28 17.0 29 19.0 30 43.0 31 50.0 32 70.0 33 88.0 34 120.0 35 159.0 36 228.0 37 294.0 38 394.0 39 748.0 40 1737.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.474999999999998 11.774999999999999 16.35 44.4 2 24.099999999999998 17.549999999999997 36.449999999999996 21.9 3 21.25 23.474999999999998 23.7 31.574999999999996 4 25.0 29.975 20.575 24.45 5 22.900000000000002 33.675 23.125 20.3 6 19.175 34.175 26.0 20.65 7 13.375 26.125 40.550000000000004 19.950000000000003 8 17.0 22.25 34.35 26.400000000000002 9 19.075 21.825 32.975 26.125 10-14 19.72 29.565 27.24 23.474999999999998 15-19 19.86 28.244999999999997 27.915 23.98 20-24 20.380000000000003 28.67 27.355 23.595 25-29 20.39 28.660000000000004 27.075 23.875 30-34 20.03 28.310000000000002 27.955000000000002 23.705000000000002 35-39 20.580000000000002 28.405 27.650000000000002 23.365 40-44 20.3 28.655 27.495000000000005 23.549999999999997 45-49 20.605 28.04 27.805000000000003 23.549999999999997 50-54 20.47 28.49 27.615000000000002 23.425 55-59 19.950000000000003 28.535 27.515 24.0 60-64 20.25 28.335 27.810000000000002 23.605 65-69 20.635 28.005000000000003 27.375 23.985 70-74 20.93 28.52 27.12 23.43 75-79 20.26 27.655 27.96 24.125 80-84 20.549999999999997 27.625 27.884999999999998 23.94 85-89 20.974999999999998 27.715 27.29 24.02 90-94 20.695 28.075 27.525 23.705000000000002 95-99 20.878131719757963 27.614142121318196 27.509126368955343 23.998599789968495 100-104 20.954429493271974 27.537391826321844 28.107648441798812 23.400530238607374 105-109 20.770385192596297 27.808904452226113 27.64382191095548 23.77688844422211 110-114 20.70535267633817 27.923961980990498 27.538769384692348 23.83191595797899 115-119 21.031825460368296 27.527021617293833 27.762209767814248 23.67894315452362 120-124 20.58072590738423 27.63454317897372 27.639549436795996 24.14518147684606 125-129 20.761141712568854 27.74161241862794 27.46119178768152 24.036054081121684 130-134 20.500876533934385 27.613323315802656 27.988980716253444 23.896819434009515 135-139 21.182068620085147 27.39794640621087 27.643375907838717 23.776609065865266 140-144 21.394882087305568 27.52634219769192 27.395885599598596 23.68289011540391 145-149 20.9715940850653 27.46074495655267 27.435337161441133 24.132323796940902 150-151 20.970608339029393 27.436773752563226 27.34107997265892 24.251537935748463 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 6.0 1 3.0 2 0.5 3 1.0 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 1.0 13 1.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 3.0 25 5.0 26 7.0 27 8.0 28 8.0 29 11.0 30 17.5 31 30.0 32 31.5 33 35.5 34 48.5 35 59.0 36 67.0 37 88.5 38 121.0 39 147.0 40 194.0 41 208.0 42 216.5 43 253.0 44 277.0 45 279.5 46 272.5 47 258.5 48 217.5 49 194.5 50 190.5 51 156.5 52 123.5 53 103.0 54 80.5 55 63.5 56 52.0 57 45.5 58 31.0 59 20.5 60 16.0 61 12.5 62 8.5 63 3.5 64 3.5 65 4.5 66 2.5 67 3.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 96-97 1.0 98-99 0.0 100-101 1.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 1.0 116-117 1.0 118-119 1.0 120-121 0.0 122-123 0.0 124-125 0.0 126-127 2.0 128-129 0.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 3.0 140-141 3.0 142-143 6.0 144-145 13.0 146-147 55.0 148-149 110.0 150-151 3803.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.1 #Duplication Level Percentage of deduplicated Percentage of total 1 96.17585848074923 92.425 2 3.6680541103017688 7.049999999999999 3 0.1300728407908429 0.375 4 0.0 0.0 5 0.0 0.0 6 0.026014568158168577 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCATG 10 0.0068519996 144.85 8 TTCATGG 10 0.0068519996 144.85 9 >>END_MODULE Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276826 spots for SRR12560178.sra Written 2276826 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra Read 2276814 spots for SRR12560178.sra Written 2276814 spots for SRR12560178.sra SRR ids: ['SRR12560178.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x9c88rub SRR12560178.sra spots: 45536292 blocks: [[1, 2276814], [2276815, 4553628], [4553629, 6830442], [6830443, 9107256], [9107257, 11384070], [11384071, 13660884], [13660885, 15937698], [15937699, 18214512], [18214513, 20491326], [20491327, 22768140], [22768141, 25044954], [25044955, 27321768], [27321769, 29598582], [29598583, 31875396], [31875397, 34152210], [34152211, 36429024], [36429025, 38705838], [38705839, 40982652], [40982653, 43259466], [43259467, 45536292]] SRR12560178 file size 15017835 SRR12560178 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12560178 SRR12560178_1.fastq Input file: SRR12560178_1.fastq trimmed: SRR12560178-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:15:34 2025 >> started Mon Feb 10 21:16:13 2025 >> done (39.274s) 45536292 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 45536285 (100.00%) reads available; of these: 5247 ( 0.01%) trimmed reads available after processing 45531038 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 14 0.00% 22 8 0.00% 23 10 0.00% 24 14 0.00% 25 21 0.00% 26 9 0.00% 27 18 0.00% 28 20 0.00% 29 39 0.00% 30 41 0.00% 31 21 0.00% 32 40 0.00% 33 28 0.00% 34 38 0.00% 35 33 0.00% 36 32 0.00% 37 22 0.00% 38 43 0.00% 39 44 0.00% 40 138 0.00% 41 131 0.00% 42 141 0.00% 43 151 0.00% 44 241 0.00% 45 142 0.00% 46 162 0.00% 47 167 0.00% 48 143 0.00% 49 191 0.00% 50 160 0.00% 51 170 0.00% 52 160 0.00% 53 205 0.00% 54 216 0.00% 55 220 0.00% 56 222 0.00% 57 398 0.00% 58 240 0.00% 59 244 0.00% 60 256 0.00% 61 254 0.00% 62 267 0.00% 63 261 0.00% 64 230 0.00% 65 290 0.00% 66 310 0.00% 67 287 0.00% 68 304 0.00% 69 303 0.00% 70 334 0.00% 71 293 0.00% 72 308 0.00% 73 350 0.00% 74 356 0.00% 75 362 0.00% 76 425 0.00% 77 416 0.00% 78 454 0.00% 79 535 0.00% 80 599 0.00% 81 615 0.00% 82 667 0.00% 83 783 0.00% 84 764 0.00% 85 817 0.00% 86 997 0.00% 87 945 0.00% 88 1055 0.00% 89 1176 0.00% 90 1208 0.00% 91 1299 0.00% 92 1338 0.00% 93 1240 0.00% 94 1351 0.00% 95 1426 0.00% 96 1499 0.00% 97 1680 0.00% 98 1865 0.00% 99 1874 0.00% 100 2023 0.00% 101 2178 0.00% 102 2136 0.00% 103 2441 0.01% 104 2617 0.01% 105 2755 0.01% 106 2735 0.01% 107 2977 0.01% 108 3017 0.01% 109 3175 0.01% 110 3742 0.01% 111 3943 0.01% 112 4088 0.01% 113 4351 0.01% 114 4604 0.01% 115 4868 0.01% 116 5050 0.01% 117 5466 0.01% 118 5677 0.01% 119 5969 0.01% 120 6260 0.01% 121 7129 0.02% 122 7808 0.02% 123 8263 0.02% 124 8854 0.02% 125 9239 0.02% 126 9877 0.02% 127 10409 0.02% 128 11244 0.02% 129 12206 0.03% 130 13403 0.03% 131 14724 0.03% 132 15842 0.03% 133 17546 0.04% 134 19294 0.04% 135 21155 0.05% 136 23823 0.05% 137 27173 0.06% 138 29933 0.07% 139 35643 0.08% 140 39336 0.09% 141 47701 0.10% 142 58527 0.13% 143 71739 0.16% 144 95794 0.21% 145 128514 0.28% 146 173459 0.38% 147 257480 0.57% 148 455218 1.00% 149 889002 1.95% 150 4475252 9.83% 151 38426487 84.39% 45536285 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=29 prefix-density=0.20 prefix-fanout=2.6 sequence=ACCAAGTGGAGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=317.89 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=30.5 sequence=TCTTCTTCTTCCT Started job on | Feb 10 21:16:36 Started mapping on | Feb 10 21:16:36 Finished on | Feb 10 21:18:27 Mapping speed, Million of reads per hour | 1476.85 Number of input reads | 45536285 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 42479726 Uniquely mapped reads % | 93.29% Average mapped length | 150.11 Number of splices: Total | 20491373 Number of splices: Annotated (sjdb) | 20186090 Number of splices: GT/AG | 20134626 Number of splices: GC/AG | 288414 Number of splices: AT/AC | 16298 Number of splices: Non-canonical | 52035 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1304012 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 324159 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.96% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1752547 1752547 1752547 N_multimapping 1304012 1304012 1304012 N_noFeature 1052646 42155421 1203177 N_ambiguous 305847 2508 130083 UnstrandedReadsAssigned:41121233 PositiveStrandReadsAssigned:321797 NegativeStrandReadsAssigned:41146466 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12560178 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12560178-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 45,536,285 reads, 41,812,783 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,266 rounds 52401 SRR12560178.ke.tsv 34699 SRR12560178.se.tsv 87100 total ==> SRR12560178.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 3404 68.0336 Potri.005G024800.1.v4.1 1035 936 491 20.1194 Potri.004G059700.1.v4.1 961 862 61 2.71413 Potri.007G009000.2.v4.1 1416 1317 1 0.0291221 Potri.003G141000.2.v4.1 2943 2844 1598.27 21.5541 Potri.016G087400.1.v4.1 270 171 605 135.696 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 280 6.41522 Potri.012G127500.1.v4.1 977 878 8069 352.48 ==> SRR12560178.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 55 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 196 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 691 Potri.001G452600.v4.1 335 SRR12560178 completed mapping pipeline successfully