Starting /dee2/code/volunteer_pipeline.sh SRR12561279 current disk space = 3056952143872 free memory = 1460888016 SRR12561279 SRAfilesize 7bf84ed5231f1848535f9c72e0ddae34 SRR12561279.sra SRR12561279.sra file validated SRR12561279 is single end SRR12561279 is conventional basespace SRR12561279 read1 length is 110-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12561279_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 110-151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.805 32.0 32.0 32.0 32.0 32.0 2 31.23125 32.0 32.0 32.0 32.0 32.0 3 34.41 37.0 32.0 37.0 32.0 37.0 4 35.74475 37.0 37.0 37.0 32.0 37.0 5 36.06575 37.0 37.0 37.0 32.0 37.0 6 38.649 41.0 37.0 41.0 32.0 41.0 7 38.40375 41.0 37.0 41.0 32.0 41.0 8 39.0115 41.0 41.0 41.0 37.0 41.0 9 38.84375 41.0 37.0 41.0 32.0 41.0 10-14 38.92525 41.0 40.2 41.0 36.0 41.0 15-19 39.148250000000004 41.0 41.0 41.0 36.0 41.0 20-24 39.43675 41.0 41.0 41.0 37.0 41.0 25-29 38.92205 41.0 41.0 41.0 35.0 41.0 30-34 38.97985 41.0 40.2 41.0 35.0 41.0 35-39 38.66074999999999 41.0 39.4 41.0 34.0 41.0 40-44 38.775999999999996 41.0 40.2 41.0 34.0 41.0 45-49 38.841150000000006 41.0 40.2 41.0 34.0 41.0 50-54 38.60325 41.0 39.4 41.0 33.0 41.0 55-59 38.839299999999994 41.0 41.0 41.0 33.0 41.0 60-64 38.58389999999999 41.0 39.4 41.0 32.0 41.0 65-69 38.51225 41.0 39.4 41.0 32.0 41.0 70-74 38.18765 41.0 38.6 41.0 31.0 41.0 75-79 38.18169999999999 41.0 38.6 41.0 32.0 41.0 80-84 38.8149 41.0 41.0 41.0 34.0 41.0 85-89 38.84865 41.0 41.0 41.0 34.0 41.0 90-94 38.6977 41.0 40.2 41.0 33.0 41.0 95-99 38.634150000000005 41.0 40.2 41.0 32.0 41.0 100-104 38.52935 41.0 39.4 41.0 32.0 41.0 105-109 38.6902 41.0 39.4 41.0 32.0 41.0 110-114 38.49896089022256 41.0 37.0 41.0 32.0 41.0 115-119 38.47114291685709 41.0 37.8 41.0 32.0 41.0 120-124 38.128371987410546 41.0 37.0 41.0 32.0 41.0 125-129 37.34254584334034 41.0 37.0 41.0 28.0 41.0 130-134 37.75305232343517 41.0 37.0 41.0 32.0 41.0 135-139 37.5841385538674 41.0 37.0 41.0 31.0 41.0 140-144 37.49766261720183 41.0 37.0 41.0 28.0 41.0 145-149 37.66749281723078 41.0 37.0 41.0 29.0 41.0 150-151 36.62869180219403 39.0 34.5 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 3.0 25 6.0 26 11.0 27 15.0 28 20.0 29 60.0 30 53.0 31 67.0 32 96.0 33 110.0 34 138.0 35 137.0 36 199.0 37 281.0 38 410.0 39 715.0 40 1677.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.75 12.525 13.825000000000001 36.9 2 27.35 13.575000000000001 28.425 30.65 3 24.099999999999998 19.275000000000002 23.875 32.75 4 27.025 24.5 20.474999999999998 28.000000000000004 5 25.724999999999998 28.349999999999998 23.5 22.425 6 19.725 32.375 25.15 22.75 7 14.6 29.299999999999997 36.375 19.725 8 16.3 27.0 31.624999999999996 25.074999999999996 9 17.625 25.650000000000002 32.425 24.3 10-14 19.53 29.86 27.029999999999998 23.580000000000002 15-19 19.470000000000002 29.310000000000002 26.865 24.355 20-24 19.49 28.37 28.115000000000002 24.025 25-29 19.665 28.835 27.46 24.04 30-34 18.895 28.799999999999997 27.6 24.705 35-39 19.06 29.18 27.084999999999997 24.675 40-44 19.06 28.985 27.900000000000002 24.055 45-49 19.68 28.904999999999998 26.924999999999997 24.490000000000002 50-54 19.895 28.189999999999998 27.67 24.245 55-59 19.595000000000002 28.585 27.12 24.7 60-64 20.185 28.21 27.839999999999996 23.765 65-69 19.685 28.005000000000003 27.505000000000003 24.805 70-74 19.79 28.194999999999997 27.465 24.55 75-79 19.375 28.675 27.395000000000003 24.555 80-84 19.285 27.584999999999997 28.384999999999998 24.745 85-89 19.794999999999998 28.115000000000002 27.99 24.099999999999998 90-94 19.93 27.939999999999998 27.334999999999997 24.795 95-99 20.419999999999998 27.839999999999996 27.185 24.555 100-104 20.185 28.694999999999997 26.939999999999998 24.18 105-109 20.095 28.105000000000004 27.24 24.560000000000002 110-114 20.13402680536107 28.455691138227646 26.980396079215847 24.42988597719544 115-119 19.974981235926943 27.775831873905428 27.32549412059044 24.923692769577183 120-124 20.059070885062074 27.833400080096116 27.523027633159792 24.58450140168202 125-129 19.88778679491033 28.233643923454565 27.48221621080052 24.396353070834586 130-134 20.08830022075055 27.478426650612082 27.764398956451934 24.668874172185433 135-139 19.624616313591307 27.47949479192875 27.635485331857296 25.260403562622653 140-144 20.572495961227787 27.599959612277868 27.37782714054927 24.44971728594507 145-149 20.309388880379846 27.70204727625466 27.742890692806455 24.245673150559043 150-151 21.470099667774086 27.671650055370982 26.868770764119603 23.989479512735326 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 3.0 24 3.5 25 4.0 26 4.5 27 7.0 28 7.5 29 10.0 30 19.5 31 22.5 32 24.5 33 35.0 34 53.5 35 74.0 36 73.0 37 90.5 38 124.0 39 141.0 40 164.5 41 208.5 42 236.0 43 243.5 44 275.0 45 275.5 46 267.0 47 263.0 48 243.0 49 223.5 50 180.0 51 141.5 52 125.0 53 102.0 54 79.0 55 63.0 56 49.0 57 37.5 58 27.5 59 20.5 60 15.5 61 13.5 62 11.0 63 7.0 64 3.0 65 2.5 66 2.5 67 3.0 68 2.5 69 1.5 70 1.5 71 0.0 72 0.5 73 0.5 74 1.0 75 1.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 110 1.0 111 0.0 112 0.0 113 0.0 114 0.0 115 1.0 116 2.0 117 0.0 118 0.0 119 0.0 120 0.0 121 0.0 122 2.0 123 0.0 124 0.0 125 1.0 126 0.0 127 2.0 128 0.0 129 1.0 130 1.0 131 2.0 132 4.0 133 0.0 134 1.0 135 4.0 136 4.0 137 4.0 138 1.0 139 0.0 140 1.0 141 5.0 142 5.0 143 8.0 144 8.0 145 6.0 146 13.0 147 14.0 148 32.0 149 82.0 150 366.0 151 3429.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.13170472650026 88.625 2 5.5762081784386615 10.5 3 0.2389803505045141 0.675 4 0.05310674455655868 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.0 0.0 0.0 0.025 0.0 130-131 0.0 0.0 0.0 0.025 0.0 132-133 0.0 0.0 0.0 0.025 0.0 134-135 0.0 0.0 0.0 0.025 0.0 136-137 0.0 0.0 0.0 0.025 0.0 138-139 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTCAT 10 0.0069214175 144.3625 9 >>END_MODULE Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848137 READS because READLEN < 1 Read 2848137 spots for SRR12561279.sra Written 2848137 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra Rejected 2848119 READS because READLEN < 1 Read 2848119 spots for SRR12561279.sra Written 2848119 spots for SRR12561279.sra SRR ids: ['SRR12561279.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fus0qmer SRR12561279.sra spots: 56962398 blocks: [[1, 2848119], [2848120, 5696238], [5696239, 8544357], [8544358, 11392476], [11392477, 14240595], [14240596, 17088714], [17088715, 19936833], [19936834, 22784952], [22784953, 25633071], [25633072, 28481190], [28481191, 31329309], [31329310, 34177428], [34177429, 37025547], [37025548, 39873666], [39873667, 42721785], [42721786, 45569904], [45569905, 48418023], [48418024, 51266142], [51266143, 54114261], [54114262, 56962398]] SRR12561279 file size 19298544 SRR12561279 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12561279 SRR12561279_1.fastq Input file: SRR12561279_1.fastq trimmed: SRR12561279-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:24:21 2025 >> started Mon Feb 10 21:24:56 2025 >> done (35.168s) 56962398 reads processed; of these: 220 ( 0.00%) short reads filtered out after trimming by size control 360 ( 0.00%) empty reads filtered out after trimming by size control 56961818 (100.00%) reads available; of these: 2768 ( 0.00%) trimmed reads available after processing 56959050 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 52 0.00% 19 49 0.00% 20 31 0.00% 21 40 0.00% 22 42 0.00% 23 26 0.00% 24 29 0.00% 25 39 0.00% 26 45 0.00% 27 30 0.00% 28 46 0.00% 29 47 0.00% 30 62 0.00% 31 51 0.00% 32 60 0.00% 33 101 0.00% 34 124 0.00% 35 117 0.00% 36 247 0.00% 37 1524 0.00% 38 503 0.00% 39 139 0.00% 40 176 0.00% 41 161 0.00% 42 201 0.00% 43 349 0.00% 44 98 0.00% 45 108 0.00% 46 160 0.00% 47 79 0.00% 48 95 0.00% 49 121 0.00% 50 128 0.00% 51 122 0.00% 52 149 0.00% 53 169 0.00% 54 164 0.00% 55 366 0.00% 56 148 0.00% 57 185 0.00% 58 169 0.00% 59 168 0.00% 60 183 0.00% 61 161 0.00% 62 220 0.00% 63 193 0.00% 64 203 0.00% 65 205 0.00% 66 229 0.00% 67 213 0.00% 68 257 0.00% 69 259 0.00% 70 253 0.00% 71 240 0.00% 72 287 0.00% 73 299 0.00% 74 351 0.00% 75 447 0.00% 76 632 0.00% 77 332 0.00% 78 317 0.00% 79 357 0.00% 80 342 0.00% 81 357 0.00% 82 361 0.00% 83 433 0.00% 84 406 0.00% 85 512 0.00% 86 454 0.00% 87 516 0.00% 88 563 0.00% 89 511 0.00% 90 674 0.00% 91 578 0.00% 92 629 0.00% 93 735 0.00% 94 784 0.00% 95 1054 0.00% 96 900 0.00% 97 1059 0.00% 98 1016 0.00% 99 1043 0.00% 100 1074 0.00% 101 1117 0.00% 102 1175 0.00% 103 1238 0.00% 104 1453 0.00% 105 1479 0.00% 106 1588 0.00% 107 1572 0.00% 108 1781 0.00% 109 1838 0.00% 110 1894 0.00% 111 1980 0.00% 112 2149 0.00% 113 2190 0.00% 114 2397 0.00% 115 2567 0.00% 116 2656 0.00% 117 3063 0.01% 118 3108 0.01% 119 3446 0.01% 120 3363 0.01% 121 3671 0.01% 122 3933 0.01% 123 4139 0.01% 124 4444 0.01% 125 4765 0.01% 126 5339 0.01% 127 5935 0.01% 128 6732 0.01% 129 7732 0.01% 130 8896 0.02% 131 10509 0.02% 132 10956 0.02% 133 12893 0.02% 134 15352 0.03% 135 18445 0.03% 136 22128 0.04% 137 26318 0.05% 138 30806 0.05% 139 36273 0.06% 140 39203 0.07% 141 48881 0.09% 142 58266 0.10% 143 72507 0.13% 144 95127 0.17% 145 119744 0.21% 146 154563 0.27% 147 226246 0.40% 148 401582 0.71% 149 758886 1.33% 150 4023828 7.06% 151 50655306 88.93% 56961818 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=24 prefix-density=0.28 prefix-fanout=2.8 sequence=AGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCTACCATTCTTGAGTTCCTTCACCTTCAACTCAGCGAATGCTTCGGGATCGTCAGCCAAGCCCAGTGGGTCGAAGCTTCCACCTGGGTAGATTGGGTCAGTTACCTCACCGAGTGGCCCGCCAGCAATTCTGTAACCCTCAACGGCACCCATCAAGACCACCTGTGTAGCCCAGATGGCCAAGATGCTTTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGTCCACCCTCGCTGAAGATCTGGGCTCCAGCCTTGAACCATACAGCCTCGCCGAACTTGACACCGTTGCGGGACAAGAGCTCGGGGAAGACGCATCCAAGAGCTCCAAGCATGGCCCACCTGGAATGGATGACTTCAAGCTCACGGTTCTTGGCAAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACT criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=59.66 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=16.5 sequence=ACCACCACCATGTCCTG Started job on | Feb 10 21:25:22 Started mapping on | Feb 10 21:25:22 Finished on | Feb 10 21:26:58 Mapping speed, Million of reads per hour | 2136.07 Number of input reads | 56961818 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 53651931 Uniquely mapped reads % | 94.19% Average mapped length | 150.20 Number of splices: Total | 24346509 Number of splices: Annotated (sjdb) | 24061553 Number of splices: GT/AG | 23921615 Number of splices: GC/AG | 337426 Number of splices: AT/AC | 22834 Number of splices: Non-canonical | 64634 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2129613 % of reads mapped to multiple loci | 3.74% Number of reads mapped to too many loci | 355385 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.40% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1180274 1180274 1180274 N_multimapping 2129613 2129613 2129613 N_noFeature 1137348 52886669 1569330 N_ambiguous 524491 2808 188936 UnstrandedReadsAssigned:51990092 PositiveStrandReadsAssigned:762454 NegativeStrandReadsAssigned:51893665 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12561279 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12561279-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 56,961,818 reads, 53,148,526 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,226 rounds 52401 SRR12561279.ke.tsv 34699 SRR12561279.se.tsv 87100 total ==> SRR12561279.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2742 36.2232 Potri.005G024800.1.v4.1 1035 936 594 16.0881 Potri.004G059700.1.v4.1 961 862 243 7.14649 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1819.23 16.2163 Potri.016G087400.1.v4.1 270 171 1430 211.999 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 709 10.737 Potri.012G127500.1.v4.1 977 878 2894 83.5599 ==> SRR12561279.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 668 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 492 Potri.001G212900.v4.1 3127 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 88 Potri.001G452600.v4.1 2 SRR12561279 completed mapping pipeline successfully