Starting /dee2/code/volunteer_pipeline.sh SRR12561280 current disk space = 3057057292288 free memory = 1464685724 SRR12561280 SRAfilesize 9bec6a183c38b166380a3edb1b12fdc1 SRR12561280.sra SRR12561280.sra file validated SRR12561280 is single end SRR12561280 is conventional basespace SRR12561280 read1 length is 38-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12561280_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 38-151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8075 32.0 32.0 32.0 32.0 32.0 2 31.30125 32.0 32.0 32.0 32.0 32.0 3 34.19125 37.0 32.0 37.0 32.0 37.0 4 35.666 37.0 37.0 37.0 32.0 37.0 5 35.98125 37.0 37.0 37.0 32.0 37.0 6 38.5395 41.0 37.0 41.0 32.0 41.0 7 38.04175 41.0 37.0 41.0 32.0 41.0 8 38.71075 41.0 37.0 41.0 32.0 41.0 9 38.52725 41.0 37.0 41.0 32.0 41.0 10-14 38.8116 41.0 39.4 41.0 34.0 41.0 15-19 39.0905 41.0 40.2 41.0 36.0 41.0 20-24 39.2916 41.0 41.0 41.0 37.0 41.0 25-29 38.9166 41.0 41.0 41.0 35.0 41.0 30-34 38.71940000000001 41.0 39.4 41.0 34.0 41.0 35-39 38.53244774943736 41.0 38.6 41.0 33.0 41.0 40-44 38.799849962490626 41.0 40.2 41.0 34.0 41.0 45-49 38.73528382095524 41.0 40.2 41.0 34.0 41.0 50-54 38.56884221055264 41.0 39.4 41.0 32.0 41.0 55-59 38.714228557139286 41.0 40.2 41.0 33.0 41.0 60-64 38.45596399099775 41.0 37.8 41.0 32.0 41.0 65-69 38.39319829957489 41.0 38.6 41.0 32.0 41.0 70-74 38.21790447611903 41.0 38.6 41.0 31.0 41.0 75-79 38.14438609652413 41.0 38.6 41.0 32.0 41.0 80-84 38.796899224806204 41.0 40.2 41.0 33.0 41.0 85-89 38.83445861465366 41.0 40.2 41.0 34.0 41.0 90-94 38.67676919229807 41.0 40.2 41.0 32.0 41.0 95-99 38.5251057887033 41.0 39.4 41.0 32.0 41.0 100-104 38.350862911906134 41.0 38.6 41.0 32.0 41.0 105-109 38.61934430049574 41.0 38.6 41.0 32.0 41.0 110-114 38.60037446658097 41.0 37.8 41.0 33.0 41.0 115-119 38.35996993987976 41.0 37.0 41.0 32.0 41.0 120-124 38.067475937134475 41.0 37.0 41.0 32.0 41.0 125-129 37.125317604120156 41.0 37.0 41.0 28.0 41.0 130-134 37.762752156310235 41.0 37.0 41.0 31.0 41.0 135-139 37.60765495519427 41.0 37.0 41.0 31.0 41.0 140-144 37.311989373588474 41.0 37.0 41.0 27.0 41.0 145-149 37.535656297294814 41.0 37.0 41.0 27.0 41.0 150-151 36.66434765985541 39.0 34.5 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 2.0 23 2.0 24 7.0 25 8.0 26 10.0 27 10.0 28 27.0 29 41.0 30 52.0 31 61.0 32 86.0 33 142.0 34 143.0 35 179.0 36 216.0 37 278.0 38 399.0 39 704.0 40 1631.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.725 13.0 14.499999999999998 36.775000000000006 2 29.099999999999998 13.900000000000002 27.500000000000004 29.5 3 24.375 20.925 23.95 30.75 4 27.625 24.075 21.099999999999998 27.200000000000003 5 25.0 28.050000000000004 23.3 23.65 6 20.925 31.125000000000004 25.0 22.95 7 14.524999999999999 28.199999999999996 38.1 19.175 8 16.5 27.6 30.8 25.1 9 18.475 25.025 31.3 25.2 10-14 19.81 30.185000000000002 27.145000000000003 22.86 15-19 19.725 28.105000000000004 28.294999999999998 23.875 20-24 20.044999999999998 28.175 28.265 23.515 25-29 19.615 28.67 27.36 24.355 30-34 19.455 28.384999999999998 27.805000000000003 24.355 35-39 20.17600880044002 28.706435321766087 27.301365068253414 23.816190809540476 40-44 19.744936234058514 28.49212303075769 27.516879219804952 24.246061515378845 45-49 20.4351087771943 28.417104276069015 27.206801700425103 23.940985246311577 50-54 20.32508127031758 28.377094273568392 27.161790447611907 24.136034008502126 55-59 19.564891222805702 28.3520880220055 27.60190047511878 24.48112028007002 60-64 20.29007251812953 28.49212303075769 26.906726681670417 24.31107776944236 65-69 19.964991247811952 28.157039259814955 27.45686421605401 24.42110527631908 70-74 20.825206301575395 27.806951737934483 27.35183795948987 24.016004001000248 75-79 20.08502125531383 28.20205051262816 27.326831707926978 24.38609652413103 80-84 20.120030007501878 28.397099274818704 27.161790447611907 24.321080270067515 85-89 20.525131282820706 28.35708927231808 26.506626656664167 24.61115278819705 90-94 20.38009502375594 27.881970492623154 27.426856714178545 24.31107776944236 95-99 20.198079231692677 28.19627851140456 27.5110044017607 24.094637855142057 100-104 20.813528793715914 27.547906138990342 27.247711012157904 24.39085405513584 105-109 20.00800921059218 27.711868648946286 27.66681683936527 24.61330530109626 110-114 19.926901316777652 28.077905171982177 27.837580733990887 24.157612777249287 115-119 21.082164328657317 27.635270541082164 27.439879759519037 23.842685370741485 120-124 20.57142857142857 27.79949874686717 27.709273182957396 23.919799498746865 125-129 21.141107988759533 26.801485347250097 27.850260939381776 24.20714572460859 130-134 20.248453452698286 27.68696876728864 27.460644771915703 24.60393300809737 135-139 20.341716647346402 27.90181946474472 27.52885439241974 24.227609495489137 140-144 20.626737427343947 28.147586555471314 27.17210007581501 24.053575941369726 145-149 20.661621842724205 27.543716126393292 27.32897024235607 24.465691788526435 150-151 19.71026605376793 28.13762362446023 26.925755676278033 25.226354645493803 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 2.5 24 2.5 25 0.5 26 5.5 27 8.0 28 9.5 29 15.0 30 12.5 31 13.5 32 29.0 33 40.0 34 50.0 35 62.5 36 76.5 37 95.5 38 109.5 39 141.5 40 175.0 41 205.5 42 235.5 43 257.5 44 267.0 45 245.5 46 246.0 47 266.0 48 241.5 49 197.0 50 177.0 51 155.0 52 131.0 53 125.0 54 104.5 55 66.5 56 47.5 57 48.5 58 38.0 59 22.5 60 16.0 61 10.5 62 6.0 63 6.0 64 6.5 65 4.5 66 3.0 67 2.0 68 2.5 69 2.0 70 0.5 71 0.0 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35-39 1.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 1.0 100-104 2.0 105-109 1.0 110-114 3.0 115-119 0.0 120-124 4.0 125-129 8.0 130-134 9.0 135-139 8.0 140-144 24.0 145-149 157.0 150-152 3782.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.92162090109304 88.075 2 5.598507064782725 10.5 3 0.39989336177019463 1.125 4 0.07997867235403892 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTTTA 10 0.006892826 144.5625 6 >>END_MODULE Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330801 READS because READLEN < 1 Read 2330801 spots for SRR12561280.sra Written 2330801 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra Rejected 2330800 READS because READLEN < 1 Read 2330800 spots for SRR12561280.sra Written 2330800 spots for SRR12561280.sra SRR ids: ['SRR12561280.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8eyqxy1c SRR12561280.sra spots: 46616001 blocks: [[1, 2330800], [2330801, 4661600], [4661601, 6992400], [6992401, 9323200], [9323201, 11654000], [11654001, 13984800], [13984801, 16315600], [16315601, 18646400], [18646401, 20977200], [20977201, 23308000], [23308001, 25638800], [25638801, 27969600], [27969601, 30300400], [30300401, 32631200], [32631201, 34962000], [34962001, 37292800], [37292801, 39623600], [39623601, 41954400], [41954401, 44285200], [44285201, 46616001]] SRR12561280 file size 15790596 SRR12561280 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12561280 SRR12561280_1.fastq Input file: SRR12561280_1.fastq trimmed: SRR12561280-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:50:11 2025 >> started Mon Feb 10 21:50:53 2025 >> done (42.274s) 46616001 reads processed; of these: 209 ( 0.00%) short reads filtered out after trimming by size control 382 ( 0.00%) empty reads filtered out after trimming by size control 46615410 (100.00%) reads available; of these: 2176 ( 0.00%) trimmed reads available after processing 46613234 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 62 0.00% 19 62 0.00% 20 41 0.00% 21 38 0.00% 22 32 0.00% 23 26 0.00% 24 28 0.00% 25 40 0.00% 26 42 0.00% 27 44 0.00% 28 31 0.00% 29 38 0.00% 30 63 0.00% 31 39 0.00% 32 56 0.00% 33 71 0.00% 34 145 0.00% 35 104 0.00% 36 312 0.00% 37 1688 0.00% 38 585 0.00% 39 166 0.00% 40 126 0.00% 41 125 0.00% 42 142 0.00% 43 275 0.00% 44 72 0.00% 45 74 0.00% 46 111 0.00% 47 82 0.00% 48 86 0.00% 49 76 0.00% 50 81 0.00% 51 74 0.00% 52 96 0.00% 53 108 0.00% 54 111 0.00% 55 243 0.00% 56 124 0.00% 57 133 0.00% 58 133 0.00% 59 108 0.00% 60 139 0.00% 61 154 0.00% 62 155 0.00% 63 150 0.00% 64 132 0.00% 65 171 0.00% 66 160 0.00% 67 173 0.00% 68 183 0.00% 69 192 0.00% 70 190 0.00% 71 195 0.00% 72 216 0.00% 73 224 0.00% 74 225 0.00% 75 340 0.00% 76 453 0.00% 77 212 0.00% 78 198 0.00% 79 243 0.00% 80 270 0.00% 81 262 0.00% 82 289 0.00% 83 328 0.00% 84 313 0.00% 85 343 0.00% 86 340 0.00% 87 356 0.00% 88 414 0.00% 89 351 0.00% 90 474 0.00% 91 465 0.00% 92 475 0.00% 93 543 0.00% 94 569 0.00% 95 746 0.00% 96 676 0.00% 97 711 0.00% 98 659 0.00% 99 773 0.00% 100 790 0.00% 101 815 0.00% 102 895 0.00% 103 931 0.00% 104 1030 0.00% 105 1013 0.00% 106 1060 0.00% 107 1184 0.00% 108 1274 0.00% 109 1348 0.00% 110 1462 0.00% 111 1424 0.00% 112 1637 0.00% 113 1785 0.00% 114 1835 0.00% 115 2054 0.00% 116 2182 0.00% 117 2414 0.01% 118 2670 0.01% 119 2850 0.01% 120 2757 0.01% 121 2931 0.01% 122 3235 0.01% 123 3304 0.01% 124 3824 0.01% 125 4072 0.01% 126 4513 0.01% 127 4993 0.01% 128 5561 0.01% 129 6431 0.01% 130 7280 0.02% 131 8396 0.02% 132 8835 0.02% 133 10213 0.02% 134 12044 0.03% 135 13994 0.03% 136 17142 0.04% 137 20360 0.04% 138 23167 0.05% 139 28518 0.06% 140 30157 0.06% 141 37124 0.08% 142 44734 0.10% 143 55765 0.12% 144 72780 0.16% 145 91106 0.20% 146 118452 0.25% 147 173719 0.37% 148 310241 0.67% 149 587929 1.26% 150 3223431 6.91% 151 41628194 89.30% 46615410 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=35 prefix-density=0.22 prefix-fanout=2.1 sequence=TAAGAAAGCTGATA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=80.67 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.6 sequence=CAACAACTCAACCCCAAGGGTTTTATTTTTAAGGAATAGCAGCACTCCCTTCACATAGCACAGCACAAACAAGAAATCAAGACACGAACATTCAGTGGTTCAAAACCAGCATTTATTGCACATTACATTACTTTATTCCCATGAAATAGCCCGGCCGAAGTCGTTACTCCTGAGCATTTAGTAGAGAAAGTAGTCTATCACAAGACGCTGTGACAAAGTAGGCAAAAATCCTTCTGCAAATGCAGCAAGAGCAGCAGAATCGAGGTACTCTTGCAAACCTGACTTGCTCTCAAATGTAGATTCAAAGGCATGAGTGTATCCTCGGTTTAGCTCCGCAGACTCCATGCCCAAATCCGTGCCCCAATTGAAACTCTTCATGGTTGGAATGAGATCGAGCAGATTGGTATAGTCATTAATGTAGTTGTCGATTTGTTCTCGTGTGATCTCA Started job on | Feb 10 21:51:20 Started mapping on | Feb 10 21:51:21 Finished on | Feb 10 21:53:20 Mapping speed, Million of reads per hour | 1410.21 Number of input reads | 46615410 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 43738739 Uniquely mapped reads % | 93.83% Average mapped length | 150.20 Number of splices: Total | 19426395 Number of splices: Annotated (sjdb) | 19192036 Number of splices: GT/AG | 19088977 Number of splices: GC/AG | 264041 Number of splices: AT/AC | 17875 Number of splices: Non-canonical | 55502 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1900825 % of reads mapped to multiple loci | 4.08% Number of reads mapped to too many loci | 269278 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.46% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 975846 975846 975846 N_multimapping 1900825 1900825 1900825 N_noFeature 923376 42868384 1533762 N_ambiguous 428017 3648 164887 UnstrandedReadsAssigned:42387346 PositiveStrandReadsAssigned:866707 NegativeStrandReadsAssigned:42040090 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12561280 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12561280-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 46,615,410 reads, 43,217,175 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,356 rounds 52401 SRR12561280.ke.tsv 34699 SRR12561280.se.tsv 87100 total ==> SRR12561280.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2124 33.6345 Potri.005G024800.1.v4.1 1035 936 579 18.7979 Potri.004G059700.1.v4.1 961 862 137 4.82969 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1183.2 12.6425 Potri.016G087400.1.v4.1 270 171 1225.22 217.733 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 470.783 8.54616 Potri.012G127500.1.v4.1 977 878 3768 130.413 ==> SRR12561280.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 403 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 449 Potri.001G212900.v4.1 5917 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 116 Potri.001G452600.v4.1 4 SRR12561280 completed mapping pipeline successfully