Starting /dee2/code/volunteer_pipeline.sh SRR12561281 current disk space = 3056955006976 free memory = 1346662180 SRR12561281 SRAfilesize 8e8cd9c7eacc4c224d82aff1f62ccd71 SRR12561281.sra SRR12561281.sra file validated SRR12561281 is single end SRR12561281 is conventional basespace SRR12561281 read1 length is 72-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12561281_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 72-151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.83 32.0 32.0 32.0 32.0 32.0 2 31.345 32.0 32.0 32.0 32.0 32.0 3 34.35625 37.0 32.0 37.0 32.0 37.0 4 35.837 37.0 37.0 37.0 32.0 37.0 5 36.20525 37.0 37.0 37.0 37.0 37.0 6 38.7475 41.0 37.0 41.0 32.0 41.0 7 38.60675 41.0 37.0 41.0 32.0 41.0 8 39.10075 41.0 41.0 41.0 37.0 41.0 9 38.9525 41.0 37.0 41.0 37.0 41.0 10-14 39.0236 41.0 40.2 41.0 36.0 41.0 15-19 39.26095 41.0 41.0 41.0 36.0 41.0 20-24 39.526799999999994 41.0 41.0 41.0 37.0 41.0 25-29 39.058299999999996 41.0 41.0 41.0 37.0 41.0 30-34 38.9824 41.0 41.0 41.0 35.0 41.0 35-39 38.8505 41.0 39.4 41.0 35.0 41.0 40-44 38.9253 41.0 41.0 41.0 35.0 41.0 45-49 38.94185 41.0 41.0 41.0 35.0 41.0 50-54 38.68765 41.0 39.4 41.0 33.0 41.0 55-59 38.8643 41.0 41.0 41.0 33.0 41.0 60-64 38.714150000000004 41.0 41.0 41.0 32.0 41.0 65-69 38.5666 41.0 39.4 41.0 33.0 41.0 70-74 38.36518793448362 41.0 38.6 41.0 32.0 41.0 75-79 38.27841960490123 41.0 38.6 41.0 32.0 41.0 80-84 38.94173543385847 41.0 41.0 41.0 34.0 41.0 85-89 38.966391597899474 41.0 41.0 41.0 35.0 41.0 90-94 38.7935983995999 41.0 40.2 41.0 33.0 41.0 95-99 38.811102775693925 41.0 40.2 41.0 33.0 41.0 100-104 38.60538332714018 41.0 39.4 41.0 32.0 41.0 105-109 38.840501508631306 41.0 41.0 41.0 33.0 41.0 110-114 38.69795217231354 41.0 38.6 41.0 33.0 41.0 115-119 38.463071720503066 41.0 37.8 41.0 32.0 41.0 120-124 38.21952198454121 41.0 37.0 41.0 32.0 41.0 125-129 37.394359144869426 41.0 37.0 41.0 29.0 41.0 130-134 37.89304019422925 41.0 37.0 41.0 32.0 41.0 135-139 37.600270632160154 41.0 37.0 41.0 31.0 41.0 140-144 37.52094093807075 41.0 37.0 41.0 27.0 41.0 145-149 37.62600475824388 41.0 37.0 41.0 28.0 41.0 150-151 36.738819682112464 39.0 34.5 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 4.0 24 4.0 25 12.0 26 12.0 27 16.0 28 24.0 29 41.0 30 43.0 31 63.0 32 75.0 33 112.0 34 127.0 35 163.0 36 197.0 37 246.0 38 362.0 39 747.0 40 1750.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.5 11.625 14.85 38.025 2 25.575 14.45 31.55 28.425 3 23.025000000000002 21.275 23.3 32.4 4 25.775 26.325 20.175 27.725 5 25.825 30.775000000000002 22.3 21.099999999999998 6 17.45 34.1 25.624999999999996 22.825 7 13.5 27.55 38.625 20.325 8 16.075 26.450000000000003 32.7 24.775 9 18.099999999999998 23.525 32.1 26.275 10-14 19.7 29.470000000000002 26.979999999999997 23.849999999999998 15-19 19.575 28.395 27.96 24.07 20-24 19.405 28.884999999999998 27.765 23.945 25-29 19.575 28.655 27.88 23.89 30-34 19.765 29.065 27.189999999999998 23.98 35-39 19.235 28.22 28.299999999999997 24.245 40-44 19.955000000000002 28.945 27.634999999999998 23.465 45-49 19.915 27.584999999999997 28.215 24.285 50-54 19.689999999999998 28.044999999999998 27.67 24.595 55-59 19.605 28.58 28.17 23.645 60-64 19.805 28.065 28.125 24.005000000000003 65-69 19.835 27.810000000000002 27.76 24.595 70-74 20.25202520252025 27.982798279827982 28.07780778077808 23.687368736873687 75-79 19.604901225306325 27.85696424106027 28.197049262315577 24.34108527131783 80-84 20.060015003750937 27.781945486371594 28.157039259814955 24.001000250062514 85-89 19.934983745936485 27.796949237309327 27.44186046511628 24.82620655163791 90-94 20.180045011252815 28.612153038259564 27.49187296824206 23.71592898224556 95-99 19.8399599899975 28.482120530132534 27.966991747936987 23.710927731932983 100-104 19.45069788383611 28.855870728900896 28.015408474661065 23.678022912601932 105-109 19.874874874874877 28.243243243243242 27.68768768768769 24.194194194194193 110-114 20.621808350856114 27.375588264744167 28.12656453389406 23.876038850505658 115-119 20.175306786877034 28.284497871274734 27.808665164037066 23.73153017781117 120-124 20.18951168154016 28.727564423944653 27.46916675022561 23.613757144289583 125-129 20.306148055207025 27.9297365119197 27.889585947302386 23.874529485570893 130-134 20.03619181662813 27.96320498642807 27.77721926208907 24.22338393485473 135-139 20.397984886649876 28.73551637279597 27.34508816120907 23.52141057934509 140-144 20.310046101626224 27.61031460560312 28.395562085212017 23.68407720755864 145-149 20.96452157886653 27.558490759227972 27.52265397020427 23.954333691701223 150-151 19.89760619897606 28.379687283796873 27.54946727549467 24.173239241732393 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 3.5 23 3.0 24 0.0 25 0.0 26 4.5 27 10.5 28 14.5 29 17.0 30 20.0 31 28.0 32 34.0 33 36.5 34 52.0 35 73.5 36 78.0 37 103.0 38 127.5 39 133.5 40 172.5 41 226.5 42 244.5 43 241.5 44 264.5 45 281.0 46 275.0 47 257.0 48 224.5 49 207.0 50 187.0 51 152.5 52 119.5 53 86.0 54 64.0 55 46.5 56 38.5 57 39.5 58 34.0 59 26.5 60 18.5 61 13.0 62 8.5 63 5.0 64 6.0 65 7.0 66 4.5 67 2.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 72-73 1.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 1.0 100-101 0.0 102-103 1.0 104-105 1.0 106-107 0.0 108-109 1.0 110-111 0.0 112-113 1.0 114-115 0.0 116-117 2.0 118-119 0.0 120-121 3.0 122-123 2.0 124-125 1.0 126-127 1.0 128-129 3.0 130-131 4.0 132-133 2.0 134-135 3.0 136-137 6.0 138-139 8.0 140-141 10.0 142-143 13.0 144-145 15.0 146-147 24.0 148-149 111.0 150-151 3786.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.57499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.67349167349167 83.95 2 7.534807534807535 13.8 3 0.7098007098007098 1.95 4 0.08190008190008191 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.05 0.0 0.0 0.0 0.0 130-131 0.05 0.0 0.0 0.0 0.0 132-133 0.05 0.0 0.0 0.0 0.0 134-135 0.05 0.0 0.0 0.0 0.0 136-137 0.05 0.0 0.0 0.0 0.0 138-139 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCGTA 10 0.006883923 144.625 1 >>END_MODULE Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903472 READS because READLEN < 1 Read 2903472 spots for SRR12561281.sra Written 2903472 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra Rejected 2903453 READS because READLEN < 1 Read 2903453 spots for SRR12561281.sra Written 2903453 spots for SRR12561281.sra SRR ids: ['SRR12561281.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fldhlr8r SRR12561281.sra spots: 58069079 blocks: [[1, 2903453], [2903454, 5806906], [5806907, 8710359], [8710360, 11613812], [11613813, 14517265], [14517266, 17420718], [17420719, 20324171], [20324172, 23227624], [23227625, 26131077], [26131078, 29034530], [29034531, 31937983], [31937984, 34841436], [34841437, 37744889], [37744890, 40648342], [40648343, 43551795], [43551796, 46455248], [46455249, 49358701], [49358702, 52262154], [52262155, 55165607], [55165608, 58069079]] SRR12561281 file size 19672360 SRR12561281 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12561281 SRR12561281_1.fastq Input file: SRR12561281_1.fastq trimmed: SRR12561281-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:28:04 2025 >> started Mon Feb 10 21:28:57 2025 >> done (52.788s) 58069079 reads processed; of these: 283 ( 0.00%) short reads filtered out after trimming by size control 185 ( 0.00%) empty reads filtered out after trimming by size control 58068611 (100.00%) reads available; of these: 3340 ( 0.01%) trimmed reads available after processing 58065271 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 83 0.00% 19 61 0.00% 20 76 0.00% 21 59 0.00% 22 48 0.00% 23 40 0.00% 24 44 0.00% 25 37 0.00% 26 45 0.00% 27 53 0.00% 28 39 0.00% 29 56 0.00% 30 53 0.00% 31 42 0.00% 32 50 0.00% 33 89 0.00% 34 145 0.00% 35 119 0.00% 36 256 0.00% 37 1085 0.00% 38 407 0.00% 39 96 0.00% 40 190 0.00% 41 136 0.00% 42 203 0.00% 43 307 0.00% 44 89 0.00% 45 96 0.00% 46 149 0.00% 47 95 0.00% 48 94 0.00% 49 94 0.00% 50 110 0.00% 51 107 0.00% 52 111 0.00% 53 132 0.00% 54 118 0.00% 55 371 0.00% 56 152 0.00% 57 193 0.00% 58 144 0.00% 59 149 0.00% 60 167 0.00% 61 163 0.00% 62 192 0.00% 63 212 0.00% 64 187 0.00% 65 207 0.00% 66 219 0.00% 67 211 0.00% 68 252 0.00% 69 250 0.00% 70 232 0.00% 71 291 0.00% 72 257 0.00% 73 291 0.00% 74 297 0.00% 75 474 0.00% 76 585 0.00% 77 349 0.00% 78 302 0.00% 79 340 0.00% 80 369 0.00% 81 376 0.00% 82 384 0.00% 83 467 0.00% 84 465 0.00% 85 575 0.00% 86 493 0.00% 87 518 0.00% 88 718 0.00% 89 646 0.00% 90 772 0.00% 91 702 0.00% 92 695 0.00% 93 894 0.00% 94 898 0.00% 95 1200 0.00% 96 993 0.00% 97 1257 0.00% 98 1146 0.00% 99 1324 0.00% 100 1225 0.00% 101 1367 0.00% 102 1426 0.00% 103 1580 0.00% 104 1782 0.00% 105 1787 0.00% 106 1900 0.00% 107 2235 0.00% 108 2283 0.00% 109 2428 0.00% 110 2716 0.00% 111 2870 0.00% 112 3036 0.01% 113 3278 0.01% 114 3479 0.01% 115 3690 0.01% 116 3936 0.01% 117 4255 0.01% 118 4459 0.01% 119 5014 0.01% 120 5123 0.01% 121 5363 0.01% 122 5753 0.01% 123 6061 0.01% 124 6661 0.01% 125 7098 0.01% 126 7658 0.01% 127 8639 0.01% 128 9540 0.02% 129 10367 0.02% 130 11617 0.02% 131 13295 0.02% 132 14034 0.02% 133 15509 0.03% 134 17673 0.03% 135 20751 0.04% 136 24096 0.04% 137 28297 0.05% 138 33135 0.06% 139 38813 0.07% 140 36710 0.06% 141 45241 0.08% 142 54238 0.09% 143 67501 0.12% 144 89428 0.15% 145 113145 0.19% 146 147200 0.25% 147 215844 0.37% 148 389660 0.67% 149 736415 1.27% 150 4011208 6.91% 151 51791399 89.19% 58068611 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=31 prefix-density=0.25 prefix-fanout=2.0 sequence=TGCGACATGGTTGGCAAGAATCCTTCTGCGAATTTAGCAACAACCGAAGAATCAAGATACTCCTGCAAGCCCTCCAGATCATCAAAGGTAGTTTCAAAAGCATGAGTATATCCGAAATTGAGGTCGTGAATACCCAGATTAGTGCCCCAGTGTAAGCTCTTCAAGGGTTCAACTTGATTGACCAGATGAGTGAAGTCGTTTATGATTTTCTCAATTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=107.89 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.7 sequence=AAACAACAACTCAACCCCAAGGGTTTTATTTTTAAGGAATAGCAGCACTCCCTTCACATAGCACAGCACAAACAAGAAATCAAGACACGAACATTCAGTGGTTCAAAACCAGCATTTATTGCACATTACATTACTTTATTCCCATGAAATAGCCCGGCCGAAGTCGTTACTCCTGAGCATTTAGTAGAGAAAGTAGTCTATCACAAGACGCTGTGACAAAGTAGGCAAAAATCCTTCTGCAAATGCAGCAAGAGCAGCAGAATCGAGGTACTCTTGCAAACCTGACTTGCTCTCAAATGTAGATTCAAAGGCATGAGTGTATCCTCGGTTTAGCTCCGCAGACTCCATGCCCAAATCCGTGCCCCAATTGAAACTCTTCATGGTTGGAATGAGATCGAGCAGATTGGTATAGTCATTAATGTAGTTGTCGATTTGTTCTCGTGTGATCTCATCCTTGA Started job on | Feb 10 21:29:21 Started mapping on | Feb 10 21:29:22 Finished on | Feb 10 21:31:02 Mapping speed, Million of reads per hour | 2090.47 Number of input reads | 58068611 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 54680295 Uniquely mapped reads % | 94.16% Average mapped length | 150.20 Number of splices: Total | 24330015 Number of splices: Annotated (sjdb) | 23982696 Number of splices: GT/AG | 23907095 Number of splices: GC/AG | 331758 Number of splices: AT/AC | 19694 Number of splices: Non-canonical | 71468 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2398933 % of reads mapped to multiple loci | 4.13% Number of reads mapped to too many loci | 226290 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.26% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 989383 989383 989383 N_multimapping 2398933 2398933 2398933 N_noFeature 1439031 53770866 2063253 N_ambiguous 495661 4152 206978 UnstrandedReadsAssigned:52745603 PositiveStrandReadsAssigned:905277 NegativeStrandReadsAssigned:52410064 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12561281 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12561281-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 58,068,611 reads, 53,852,588 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,347 rounds 52401 SRR12561281.ke.tsv 34699 SRR12561281.se.tsv 87100 total ==> SRR12561281.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2417 31.8575 Potri.005G024800.1.v4.1 1035 936 496 13.4034 Potri.004G059700.1.v4.1 961 862 170 4.98829 Potri.007G009000.2.v4.1 1416 1317 3 0.0576164 Potri.003G141000.2.v4.1 2943 2844 1467.07 13.0476 Potri.016G087400.1.v4.1 270 171 1690.61 250.068 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 412.898 6.23876 Potri.012G127500.1.v4.1 977 878 4388 126.41 ==> SRR12561281.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1340 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 435 Potri.001G212900.v4.1 12102 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 73 Potri.001G452600.v4.1 3 SRR12561281 completed mapping pipeline successfully