Starting /dee2/code/volunteer_pipeline.sh SRR12561282 current disk space = 3056988565504 free memory = 1058443664 SRR12561282 SRAfilesize 042c01c63806f1d7e063f120afd5b3a3 SRR12561282.sra SRR12561282.sra file validated SRR12561282 is single end SRR12561282 is conventional basespace SRR12561282 read1 length is 108-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12561282_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 108-151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.80875 32.0 32.0 32.0 32.0 32.0 2 31.325 32.0 32.0 32.0 32.0 32.0 3 34.325 37.0 32.0 37.0 32.0 37.0 4 35.61025 37.0 37.0 37.0 32.0 37.0 5 35.986 37.0 37.0 37.0 32.0 37.0 6 38.353 41.0 37.0 41.0 32.0 41.0 7 38.00975 41.0 37.0 41.0 32.0 41.0 8 38.7085 41.0 37.0 41.0 32.0 41.0 9 38.5175 41.0 37.0 41.0 32.0 41.0 10-14 38.8405 41.0 40.2 41.0 33.0 41.0 15-19 39.03745 41.0 40.2 41.0 36.0 41.0 20-24 39.306349999999995 41.0 41.0 41.0 36.0 41.0 25-29 38.74665 41.0 41.0 41.0 32.0 41.0 30-34 38.7243 41.0 39.4 41.0 34.0 41.0 35-39 38.489999999999995 41.0 37.8 41.0 33.0 41.0 40-44 38.67205 41.0 39.4 41.0 34.0 41.0 45-49 38.6754 41.0 39.4 41.0 33.0 41.0 50-54 38.4311 41.0 38.6 41.0 31.0 41.0 55-59 38.568850000000005 41.0 39.4 41.0 32.0 41.0 60-64 38.350750000000005 41.0 37.0 41.0 32.0 41.0 65-69 38.3064 41.0 38.6 41.0 32.0 41.0 70-74 38.18215 41.0 37.8 41.0 31.0 41.0 75-79 38.148799999999994 41.0 38.6 41.0 32.0 41.0 80-84 38.803200000000004 41.0 41.0 41.0 33.0 41.0 85-89 38.73009999999999 41.0 39.4 41.0 33.0 41.0 90-94 38.5785 41.0 40.2 41.0 32.0 41.0 95-99 38.51655 41.0 39.4 41.0 32.0 41.0 100-104 38.3458 41.0 38.6 41.0 32.0 41.0 105-109 38.65298284571143 41.0 40.2 41.0 32.0 41.0 110-114 38.48728464006947 41.0 37.8 41.0 32.0 41.0 115-119 38.24206486530731 41.0 37.0 41.0 32.0 41.0 120-124 37.91575986258679 41.0 37.0 41.0 30.0 41.0 125-129 37.20542688467599 41.0 37.0 41.0 28.0 41.0 130-134 37.63710876362993 41.0 37.0 41.0 31.0 41.0 135-139 37.37702249040136 41.0 37.0 41.0 28.0 41.0 140-144 37.272074204467366 41.0 37.0 41.0 27.0 41.0 145-149 37.461463593413384 41.0 37.0 41.0 27.0 41.0 150-151 36.66062388889908 39.0 34.5 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 1.0 24 3.0 25 7.0 26 13.0 27 15.0 28 34.0 29 54.0 30 68.0 31 70.0 32 77.0 33 118.0 34 117.0 35 199.0 36 210.0 37 277.0 38 429.0 39 741.0 40 1564.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.375 12.174999999999999 14.124999999999998 36.325 2 29.15 13.575000000000001 27.700000000000003 29.575000000000003 3 24.6 19.475 22.3 33.625 4 25.4 23.674999999999997 21.175 29.75 5 26.424999999999997 28.025 21.675 23.875 6 19.85 31.825 25.474999999999998 22.85 7 14.424999999999999 28.7 38.15 18.725 8 17.2 27.575 31.35 23.875 9 18.075 26.075 32.45 23.400000000000002 10-14 19.939999999999998 29.345 27.43 23.285 15-19 19.24 28.945 27.500000000000004 24.315 20-24 19.54 28.060000000000002 27.675 24.725 25-29 19.57 28.754999999999995 27.62 24.055 30-34 19.435 28.835 27.435 24.295 35-39 19.68 28.715000000000003 27.21 24.395 40-44 19.48 28.694999999999997 27.905 23.919999999999998 45-49 19.139999999999997 28.605000000000004 28.075 24.18 50-54 19.59 28.485 27.755000000000003 24.169999999999998 55-59 19.634999999999998 28.02 28.185 24.16 60-64 19.71 27.88 28.155 24.255 65-69 19.84 27.950000000000003 28.035 24.175 70-74 19.96 28.22 27.24 24.58 75-79 19.885 28.505000000000003 27.63 23.98 80-84 19.585 26.87 28.525 25.019999999999996 85-89 19.455 27.935 28.105000000000004 24.505 90-94 20.080000000000002 28.055000000000003 27.12 24.745 95-99 20.025000000000002 27.815 27.515 24.645 100-104 20.19 27.875 27.450000000000003 24.485 105-109 20.036001800090006 27.591379568978446 27.736386819340968 24.636231811590577 110-114 20.35110533159948 27.448234470341106 27.53826147844353 24.662398719615886 115-119 20.493320658427976 27.953169560214143 27.75303947565918 23.800470305698703 120-124 19.95794111756459 27.848988584017626 27.783897456439018 24.409172841978773 125-129 20.6144747393745 27.054931836407377 27.66138732959102 24.669206094627107 130-134 20.656428786510087 27.17554953327311 27.80788919000301 24.36013249021379 135-139 20.636519286937254 26.911068586967467 27.812468526538424 24.639943599556855 140-144 20.118493011950576 28.01802714198906 27.66356086692323 24.199918979137127 145-149 19.956960598452632 27.75016652149408 27.499103345801096 24.793769534252192 150-151 19.000556792873052 27.978841870824056 26.60077951002227 26.419821826280625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.5 4 1.0 5 0.5 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 1.0 12 1.5 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 2.5 25 5.5 26 4.0 27 3.0 28 8.5 29 12.0 30 17.0 31 24.5 32 34.0 33 36.0 34 41.5 35 51.0 36 63.0 37 87.0 38 113.5 39 149.0 40 174.5 41 201.0 42 230.5 43 245.0 44 272.0 45 291.0 46 290.5 47 277.5 48 250.0 49 213.5 50 175.0 51 158.0 52 132.0 53 95.0 54 75.0 55 56.0 56 45.5 57 37.0 58 24.0 59 21.0 60 18.0 61 11.5 62 5.0 63 5.0 64 5.0 65 4.0 66 5.0 67 3.0 68 2.0 69 3.0 70 2.0 71 0.5 72 0.5 73 0.5 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 108 1.0 109 0.0 110 0.0 111 0.0 112 0.0 113 1.0 114 0.0 115 0.0 116 1.0 117 0.0 118 0.0 119 1.0 120 1.0 121 0.0 122 2.0 123 0.0 124 2.0 125 0.0 126 1.0 127 0.0 128 0.0 129 3.0 130 0.0 131 0.0 132 3.0 133 3.0 134 2.0 135 4.0 136 3.0 137 3.0 138 6.0 139 6.0 140 3.0 141 6.0 142 2.0 143 3.0 144 7.0 145 9.0 146 19.0 147 15.0 148 40.0 149 75.0 150 372.0 151 3406.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.475 #Duplication Level Percentage of deduplicated Percentage of total 1 94.41651230484254 89.2 2 5.345329452236041 10.100000000000001 3 0.21169621593014024 0.6 4 0.02646202699126753 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATACAT 10 0.0068892627 144.5875 2 CCGTTAA 10 0.0068892627 144.5875 3 CCCGTTA 10 0.0068892627 144.5875 2 >>END_MODULE Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra Rejected 2568016 READS because READLEN < 1 Read 2568016 spots for SRR12561282.sra Written 2568016 spots for SRR12561282.sra SRR ids: ['SRR12561282.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l6ri4azc SRR12561282.sra spots: 51360320 blocks: [[1, 2568016], [2568017, 5136032], [5136033, 7704048], [7704049, 10272064], [10272065, 12840080], [12840081, 15408096], [15408097, 17976112], [17976113, 20544128], [20544129, 23112144], [23112145, 25680160], [25680161, 28248176], [28248177, 30816192], [30816193, 33384208], [33384209, 35952224], [35952225, 38520240], [38520241, 41088256], [41088257, 43656272], [43656273, 46224288], [46224289, 48792304], [48792305, 51360320]] SRR12561282 file size 17400906 SRR12561282 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12561282 SRR12561282_1.fastq Input file: SRR12561282_1.fastq trimmed: SRR12561282-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:36:20 2025 >> started Mon Feb 10 21:36:51 2025 >> done (30.730s) 51360320 reads processed; of these: 223 ( 0.00%) short reads filtered out after trimming by size control 388 ( 0.00%) empty reads filtered out after trimming by size control 51359709 (100.00%) reads available; of these: 2285 ( 0.00%) trimmed reads available after processing 51357424 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 49 0.00% 19 65 0.00% 20 41 0.00% 21 46 0.00% 22 40 0.00% 23 35 0.00% 24 36 0.00% 25 36 0.00% 26 24 0.00% 27 27 0.00% 28 41 0.00% 29 31 0.00% 30 84 0.00% 31 32 0.00% 32 56 0.00% 33 82 0.00% 34 107 0.00% 35 113 0.00% 36 279 0.00% 37 1416 0.00% 38 533 0.00% 39 153 0.00% 40 147 0.00% 41 139 0.00% 42 141 0.00% 43 317 0.00% 44 71 0.00% 45 84 0.00% 46 125 0.00% 47 97 0.00% 48 71 0.00% 49 91 0.00% 50 106 0.00% 51 94 0.00% 52 103 0.00% 53 89 0.00% 54 116 0.00% 55 276 0.00% 56 122 0.00% 57 144 0.00% 58 119 0.00% 59 144 0.00% 60 130 0.00% 61 143 0.00% 62 169 0.00% 63 170 0.00% 64 168 0.00% 65 162 0.00% 66 162 0.00% 67 187 0.00% 68 172 0.00% 69 223 0.00% 70 199 0.00% 71 199 0.00% 72 242 0.00% 73 233 0.00% 74 267 0.00% 75 392 0.00% 76 439 0.00% 77 253 0.00% 78 265 0.00% 79 257 0.00% 80 265 0.00% 81 300 0.00% 82 276 0.00% 83 365 0.00% 84 322 0.00% 85 418 0.00% 86 335 0.00% 87 356 0.00% 88 487 0.00% 89 437 0.00% 90 555 0.00% 91 459 0.00% 92 498 0.00% 93 545 0.00% 94 564 0.00% 95 758 0.00% 96 678 0.00% 97 785 0.00% 98 721 0.00% 99 775 0.00% 100 758 0.00% 101 824 0.00% 102 845 0.00% 103 928 0.00% 104 1049 0.00% 105 1054 0.00% 106 1136 0.00% 107 1180 0.00% 108 1356 0.00% 109 1318 0.00% 110 1522 0.00% 111 1636 0.00% 112 1622 0.00% 113 1750 0.00% 114 1815 0.00% 115 1901 0.00% 116 2090 0.00% 117 2434 0.00% 118 2514 0.00% 119 2809 0.01% 120 2813 0.01% 121 2997 0.01% 122 3213 0.01% 123 3325 0.01% 124 3803 0.01% 125 4051 0.01% 126 4519 0.01% 127 4865 0.01% 128 5651 0.01% 129 6422 0.01% 130 7337 0.01% 131 8636 0.02% 132 9191 0.02% 133 10660 0.02% 134 12490 0.02% 135 15153 0.03% 136 18217 0.04% 137 21630 0.04% 138 25071 0.05% 139 30185 0.06% 140 33403 0.07% 141 41207 0.08% 142 49498 0.10% 143 61035 0.12% 144 79177 0.15% 145 99686 0.19% 146 129517 0.25% 147 189371 0.37% 148 339278 0.66% 149 642392 1.25% 150 3526783 6.87% 151 45917339 89.40% 51359709 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=26 prefix-density=0.29 prefix-fanout=2.1 sequence=TAAGAAAGCTGATA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=177.42 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=11.9 sequence=AAACAACAACTCAACCCCAAGGGTTTTATTTTTAAGGAATAGCAGCACTCCCTTCACATAGCACAGCACAAACAAGAAATCAAGACACGAACATTCAGTGGTTCAAAACCAGCATTTATTGCACATTACATTACTTTATTCCCATGAAATAGCCCGGCCGAAGTCGTTACTCCTGAGCATTTAGTAGAGAAAGTAGTCTATCACAAGACGCTGTGACAAAGTAGGCAAAAATCCTTCTGCAAATGCAGCAAGAGCAGCAGAATCGAGGTACTCTTGCAAACCTGACTTGCTCTCAAATGTAGATTCAAAGGCATGAGTGTATCCTCGGTTTAGCTCCGCAGACTCCATGCCCAAATCCGTGCCCCAATTGAAACTCTTCATGGTTGGAATGAGATCGAGCAGATTGGTATAGTCATTAATGTAGTTGTCGATTTGTTCTC Started job on | Feb 10 21:37:13 Started mapping on | Feb 10 21:37:13 Finished on | Feb 10 21:38:55 Mapping speed, Million of reads per hour | 1812.70 Number of input reads | 51359709 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 48172719 Uniquely mapped reads % | 93.79% Average mapped length | 150.21 Number of splices: Total | 21405200 Number of splices: Annotated (sjdb) | 21144275 Number of splices: GT/AG | 21033218 Number of splices: GC/AG | 290677 Number of splices: AT/AC | 19670 Number of splices: Non-canonical | 61635 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2158328 % of reads mapped to multiple loci | 4.20% Number of reads mapped to too many loci | 211434 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.53% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1028662 1028662 1028662 N_multimapping 2158328 2158328 2158328 N_noFeature 1025141 47488209 1426574 N_ambiguous 452714 2656 167390 UnstrandedReadsAssigned:46694864 PositiveStrandReadsAssigned:681854 NegativeStrandReadsAssigned:46578755 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12561282 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12561282-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 51,359,709 reads, 47,933,508 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,313 rounds 52401 SRR12561282.ke.tsv 34699 SRR12561282.se.tsv 87100 total ==> SRR12561282.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2051 29.7769 Potri.005G024800.1.v4.1 1035 936 448 13.3349 Potri.004G059700.1.v4.1 961 862 181 5.85005 Potri.007G009000.2.v4.1 1416 1317 7 0.148082 Potri.003G141000.2.v4.1 2943 2844 1446.19 14.1672 Potri.016G087400.1.v4.1 270 171 1385 225.654 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 449.639 7.48337 Potri.012G127500.1.v4.1 977 878 3402 107.951 ==> SRR12561282.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 751 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 376 Potri.001G212900.v4.1 10476 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 66 Potri.001G452600.v4.1 5 SRR12561282 completed mapping pipeline successfully