Starting /dee2/code/volunteer_pipeline.sh SRR12561283 current disk space = 3057020420096 free memory = 1467634156 SRR12561283 SRAfilesize 77f772daf7bf6de2237f2cf7c5324c12 SRR12561283.sra SRR12561283.sra file validated SRR12561283 is single end SRR12561283 is conventional basespace SRR12561283 read1 length is 97-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12561283_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 97-151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.80625 32.0 32.0 32.0 32.0 32.0 2 31.2925 32.0 32.0 32.0 32.0 32.0 3 34.23875 37.0 32.0 37.0 32.0 37.0 4 35.6915 37.0 37.0 37.0 32.0 37.0 5 35.99725 37.0 37.0 37.0 32.0 37.0 6 38.382 41.0 37.0 41.0 32.0 41.0 7 38.148 41.0 37.0 41.0 32.0 41.0 8 38.8525 41.0 37.0 41.0 32.0 41.0 9 38.64175 41.0 37.0 41.0 32.0 41.0 10-14 38.82424999999999 41.0 40.2 41.0 34.0 41.0 15-19 39.090650000000004 41.0 40.2 41.0 36.0 41.0 20-24 39.376400000000004 41.0 41.0 41.0 37.0 41.0 25-29 38.922 41.0 41.0 41.0 36.0 41.0 30-34 38.7734 41.0 39.4 41.0 34.0 41.0 35-39 38.594750000000005 41.0 39.4 41.0 33.0 41.0 40-44 38.75255 41.0 40.2 41.0 34.0 41.0 45-49 38.75295 41.0 41.0 41.0 34.0 41.0 50-54 38.55499999999999 41.0 38.6 41.0 33.0 41.0 55-59 38.70795 41.0 40.2 41.0 33.0 41.0 60-64 38.568799999999996 41.0 39.4 41.0 32.0 41.0 65-69 38.40599999999999 41.0 38.6 41.0 32.0 41.0 70-74 38.2082 41.0 38.6 41.0 31.0 41.0 75-79 38.17425000000001 41.0 38.6 41.0 31.0 41.0 80-84 38.820299999999996 41.0 41.0 41.0 33.0 41.0 85-89 38.78945 41.0 41.0 41.0 34.0 41.0 90-94 38.69525 41.0 40.2 41.0 32.0 41.0 95-99 38.65601869217305 41.0 40.2 41.0 32.0 41.0 100-104 38.45846461615404 41.0 38.6 41.0 32.0 41.0 105-109 38.683470867716935 41.0 39.4 41.0 32.0 41.0 110-114 38.46518259129565 41.0 37.8 41.0 32.0 41.0 115-119 38.311583687765825 41.0 37.0 41.0 32.0 41.0 120-124 38.03531877309099 41.0 37.0 41.0 32.0 41.0 125-129 37.19189945117927 41.0 37.0 41.0 28.0 41.0 130-134 37.70036798645188 41.0 37.0 41.0 31.0 41.0 135-139 37.471591226504856 41.0 37.0 41.0 30.0 41.0 140-144 37.4456151649334 41.0 37.0 41.0 28.0 41.0 145-149 37.48100777224917 41.0 37.0 41.0 27.0 41.0 150-151 36.600645382743046 39.0 34.5 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 3.0 25 9.0 26 12.0 27 18.0 28 22.0 29 36.0 30 57.0 31 103.0 32 95.0 33 114.0 34 127.0 35 157.0 36 206.0 37 268.0 38 397.0 39 698.0 40 1674.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.175000000000004 12.15 14.399999999999999 36.275 2 29.45 13.5 28.299999999999997 28.749999999999996 3 23.825 19.375 22.85 33.95 4 26.075 24.7 20.875 28.349999999999998 5 24.95 29.525000000000002 23.200000000000003 22.325 6 20.1 32.0 24.525 23.375 7 13.175 27.150000000000002 39.0 20.674999999999997 8 17.724999999999998 25.974999999999998 31.55 24.75 9 17.974999999999998 23.875 32.1 26.05 10-14 19.939999999999998 29.409999999999997 27.675 22.975 15-19 20.095 27.425 28.285 24.195 20-24 19.495 28.225 27.98 24.3 25-29 20.16 27.905 27.6 24.335 30-34 19.88 27.889999999999997 28.075 24.154999999999998 35-39 20.335 28.74 27.400000000000002 23.525 40-44 20.095 28.63 26.93 24.345 45-49 19.99 27.815 27.884999999999998 24.310000000000002 50-54 20.125 28.23 27.334999999999997 24.310000000000002 55-59 19.68 28.705000000000002 27.134999999999998 24.48 60-64 19.97 28.24 27.189999999999998 24.6 65-69 19.509999999999998 28.21 27.57 24.709999999999997 70-74 20.265 27.994999999999997 27.029999999999998 24.709999999999997 75-79 19.535 27.87 27.58 25.014999999999997 80-84 20.61 27.139999999999997 27.755000000000003 24.495 85-89 19.475 27.77 28.15 24.605 90-94 20.025000000000002 27.705000000000002 27.750000000000004 24.52 95-99 20.72207220722072 27.647764776477647 27.377737773777376 24.252425242524254 100-104 20.38009502375594 27.53188297074269 27.591897974493623 24.496124031007753 105-109 20.470117529382346 27.021755438859714 27.811952988247064 24.696174043510876 110-114 20.300150075037518 28.104052026013004 26.96848424212106 24.627313656828413 115-119 20.16012009006755 27.500625469101823 28.03102326745059 24.308231173380037 120-124 19.952945887770937 27.131200881013168 27.947139210091603 24.968714021124295 125-129 21.109553374724616 27.748848387742843 26.852593631083515 24.289004606449026 130-134 20.069169465189717 27.95849832088617 27.216680868126915 24.755651345797204 135-139 19.98794393931783 27.43758476917667 27.623449038026827 24.951022253478676 140-144 20.833122948750315 27.159808129260288 27.023478919464782 24.983590002524615 145-149 20.584329349269588 27.36745326386761 27.071202370007153 24.977015016855656 150-151 20.549465797141668 27.83405022894408 26.210628555570974 25.405855418343275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.5 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 2.5 23 4.0 24 4.5 25 3.5 26 3.0 27 6.5 28 9.0 29 13.0 30 16.0 31 19.0 32 30.5 33 38.0 34 44.0 35 54.0 36 77.5 37 103.0 38 115.0 39 137.5 40 152.0 41 172.0 42 202.5 43 235.5 44 267.5 45 273.0 46 258.0 47 255.5 48 253.5 49 225.5 50 206.5 51 172.5 52 126.0 53 107.0 54 87.0 55 61.5 56 55.0 57 53.0 58 48.5 59 37.0 60 20.5 61 13.0 62 7.5 63 4.0 64 4.0 65 2.5 66 1.0 67 0.5 68 1.0 69 2.0 70 1.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 96-97 1.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 1.0 110-111 0.0 112-113 0.0 114-115 1.0 116-117 0.0 118-119 1.0 120-121 1.0 122-123 0.0 124-125 0.0 126-127 1.0 128-129 2.0 130-131 2.0 132-133 2.0 134-135 3.0 136-137 6.0 138-139 10.0 140-141 5.0 142-143 15.0 144-145 16.0 146-147 31.0 148-149 110.0 150-151 3792.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.32059447983015 88.85 2 5.334394904458599 10.05 3 0.21231422505307856 0.6 4 0.1326963906581741 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859925 READS because READLEN < 1 Read 2859925 spots for SRR12561283.sra Written 2859925 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra Rejected 2859910 READS because READLEN < 1 Read 2859910 spots for SRR12561283.sra Written 2859910 spots for SRR12561283.sra SRR ids: ['SRR12561283.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lhhawp9z SRR12561283.sra spots: 57198215 blocks: [[1, 2859910], [2859911, 5719820], [5719821, 8579730], [8579731, 11439640], [11439641, 14299550], [14299551, 17159460], [17159461, 20019370], [20019371, 22879280], [22879281, 25739190], [25739191, 28599100], [28599101, 31459010], [31459011, 34318920], [34318921, 37178830], [37178831, 40038740], [40038741, 42898650], [42898651, 45758560], [45758561, 48618470], [48618471, 51478380], [51478381, 54338290], [54338291, 57198215]] SRR12561283 file size 19381291 SRR12561283 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12561283 SRR12561283_1.fastq Input file: SRR12561283_1.fastq trimmed: SRR12561283-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:48:44 2025 >> started Mon Feb 10 21:49:16 2025 >> done (32.233s) 57198215 reads processed; of these: 197 ( 0.00%) short reads filtered out after trimming by size control 232 ( 0.00%) empty reads filtered out after trimming by size control 57197786 (100.00%) reads available; of these: 2067 ( 0.00%) trimmed reads available after processing 57195719 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 52 0.00% 19 41 0.00% 20 39 0.00% 21 51 0.00% 22 37 0.00% 23 20 0.00% 24 34 0.00% 25 35 0.00% 26 25 0.00% 27 30 0.00% 28 24 0.00% 29 39 0.00% 30 58 0.00% 31 56 0.00% 32 71 0.00% 33 172 0.00% 34 944 0.00% 35 318 0.00% 36 155 0.00% 37 60 0.00% 38 47 0.00% 39 58 0.00% 40 150 0.00% 41 121 0.00% 42 191 0.00% 43 327 0.00% 44 65 0.00% 45 72 0.00% 46 122 0.00% 47 63 0.00% 48 80 0.00% 49 78 0.00% 50 81 0.00% 51 85 0.00% 52 91 0.00% 53 121 0.00% 54 107 0.00% 55 316 0.00% 56 119 0.00% 57 201 0.00% 58 126 0.00% 59 137 0.00% 60 159 0.00% 61 155 0.00% 62 148 0.00% 63 169 0.00% 64 162 0.00% 65 184 0.00% 66 208 0.00% 67 206 0.00% 68 219 0.00% 69 228 0.00% 70 195 0.00% 71 204 0.00% 72 265 0.00% 73 212 0.00% 74 320 0.00% 75 384 0.00% 76 481 0.00% 77 268 0.00% 78 237 0.00% 79 266 0.00% 80 303 0.00% 81 308 0.00% 82 287 0.00% 83 360 0.00% 84 346 0.00% 85 403 0.00% 86 372 0.00% 87 373 0.00% 88 504 0.00% 89 443 0.00% 90 520 0.00% 91 465 0.00% 92 464 0.00% 93 559 0.00% 94 578 0.00% 95 850 0.00% 96 669 0.00% 97 780 0.00% 98 681 0.00% 99 829 0.00% 100 788 0.00% 101 783 0.00% 102 843 0.00% 103 927 0.00% 104 1095 0.00% 105 1003 0.00% 106 1087 0.00% 107 1128 0.00% 108 1255 0.00% 109 1392 0.00% 110 1456 0.00% 111 1512 0.00% 112 1763 0.00% 113 1741 0.00% 114 1879 0.00% 115 1987 0.00% 116 2190 0.00% 117 2440 0.00% 118 2573 0.00% 119 2854 0.00% 120 2910 0.01% 121 3080 0.01% 122 3392 0.01% 123 3428 0.01% 124 3929 0.01% 125 4308 0.01% 126 4600 0.01% 127 5443 0.01% 128 6082 0.01% 129 6947 0.01% 130 8082 0.01% 131 9530 0.02% 132 10325 0.02% 133 11649 0.02% 134 14133 0.02% 135 17018 0.03% 136 20859 0.04% 137 24519 0.04% 138 28855 0.05% 139 34442 0.06% 140 37991 0.07% 141 46398 0.08% 142 55674 0.10% 143 70450 0.12% 144 92144 0.16% 145 115634 0.20% 146 150877 0.26% 147 221485 0.39% 148 393784 0.69% 149 739414 1.29% 150 4042288 7.07% 151 50957637 89.09% 57197786 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=40 prefix-density=0.43 prefix-fanout=1.1 sequence=GCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=16.57 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.2 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG Started job on | Feb 10 21:49:45 Started mapping on | Feb 10 21:49:47 Finished on | Feb 10 21:51:20 Mapping speed, Million of reads per hour | 2214.11 Number of input reads | 57197786 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 54282228 Uniquely mapped reads % | 94.90% Average mapped length | 150.25 Number of splices: Total | 24941229 Number of splices: Annotated (sjdb) | 24672477 Number of splices: GT/AG | 24509259 Number of splices: GC/AG | 357174 Number of splices: AT/AC | 21716 Number of splices: Non-canonical | 53080 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2010814 % of reads mapped to multiple loci | 3.52% Number of reads mapped to too many loci | 251792 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.08% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 904744 904744 904744 N_multimapping 2010814 2010814 2010814 N_noFeature 1081769 53372709 1590119 N_ambiguous 651336 2934 247876 UnstrandedReadsAssigned:52549123 PositiveStrandReadsAssigned:906585 NegativeStrandReadsAssigned:52444233 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12561283 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12561283-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 57,197,786 reads, 53,618,763 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,382 rounds 52401 SRR12561283.ke.tsv 34699 SRR12561283.se.tsv 87100 total ==> SRR12561283.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2102 25.9472 Potri.005G024800.1.v4.1 1035 936 769 19.4618 Potri.004G059700.1.v4.1 961 862 251 6.89761 Potri.007G009000.2.v4.1 1416 1317 1 0.0179865 Potri.003G141000.2.v4.1 2943 2844 1513.22 12.6039 Potri.016G087400.1.v4.1 270 171 1479.54 204.957 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 166 2.34901 Potri.012G127500.1.v4.1 977 878 5017 135.357 ==> SRR12561283.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 545 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 583 Potri.001G212900.v4.1 133 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 300 Potri.001G452600.v4.1 10 SRR12561283 completed mapping pipeline successfully