Starting /dee2/code/volunteer_pipeline.sh SRR12561284 current disk space = 3056991068160 free memory = 1073558072 SRR12561284 SRAfilesize 5ee4fe795bf11e78f1836a610c6c8974 SRR12561284.sra SRR12561284.sra file validated SRR12561284 is single end SRR12561284 is conventional basespace SRR12561284 read1 length is 70-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12561284_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.815 32.0 32.0 32.0 32.0 32.0 2 31.20625 32.0 32.0 32.0 32.0 32.0 3 34.35625 37.0 32.0 37.0 32.0 37.0 4 35.70325 37.0 37.0 37.0 32.0 37.0 5 36.135 37.0 37.0 37.0 37.0 37.0 6 38.58175 41.0 37.0 41.0 32.0 41.0 7 38.2985 41.0 37.0 41.0 32.0 41.0 8 38.921 41.0 37.0 41.0 32.0 41.0 9 38.8705 41.0 37.0 41.0 32.0 41.0 10-14 38.9529 41.0 40.2 41.0 35.0 41.0 15-19 39.12429999999999 41.0 40.2 41.0 36.0 41.0 20-24 39.506750000000004 41.0 41.0 41.0 37.0 41.0 25-29 38.97625 41.0 41.0 41.0 35.0 41.0 30-34 38.8242 41.0 40.2 41.0 34.0 41.0 35-39 38.57495 41.0 37.8 41.0 33.0 41.0 40-44 38.77165 41.0 40.2 41.0 34.0 41.0 45-49 38.81419999999999 41.0 41.0 41.0 34.0 41.0 50-54 38.46345 41.0 38.6 41.0 33.0 41.0 55-59 38.71810000000001 41.0 39.4 41.0 33.0 41.0 60-64 38.519600000000004 41.0 40.2 41.0 32.0 41.0 65-69 38.416900000000005 41.0 38.6 41.0 32.0 41.0 70-74 38.293268329582396 41.0 38.6 41.0 32.0 41.0 75-79 38.16009002250563 41.0 37.8 41.0 32.0 41.0 80-84 38.83745936484121 41.0 41.0 41.0 33.0 41.0 85-89 38.793648412103025 41.0 41.0 41.0 33.0 41.0 90-94 38.7487871967992 41.0 40.2 41.0 33.0 41.0 95-99 38.70777694423606 41.0 40.2 41.0 32.0 41.0 100-104 38.486107257179484 41.0 38.6 41.0 32.0 41.0 105-109 38.8208604302151 41.0 40.2 41.0 32.0 41.0 110-114 38.62231728977603 41.0 37.8 41.0 32.0 41.0 115-119 38.397853748723854 41.0 37.0 41.0 32.0 41.0 120-124 38.05892234087633 41.0 37.0 41.0 32.0 41.0 125-129 37.26040748926711 41.0 37.0 41.0 28.0 41.0 130-134 37.708846142863436 41.0 37.0 41.0 31.0 41.0 135-139 37.5083898693081 41.0 37.0 41.0 27.0 41.0 140-144 37.45350350951692 41.0 37.0 41.0 28.0 41.0 145-149 37.63439288564625 41.0 37.0 41.0 29.0 41.0 150-151 36.6318571679528 39.0 34.5 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 5.0 24 8.0 25 9.0 26 12.0 27 12.0 28 21.0 29 37.0 30 48.0 31 82.0 32 102.0 33 117.0 34 128.0 35 158.0 36 210.0 37 273.0 38 372.0 39 723.0 40 1681.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.975 11.85 14.549999999999999 36.625 2 27.025 13.525 29.599999999999998 29.849999999999998 3 24.525 21.025 22.725 31.724999999999998 4 27.3 25.15 19.525000000000002 28.025 5 24.4 29.225 23.0 23.375 6 18.4 31.2 26.85 23.549999999999997 7 13.525 28.249999999999996 38.7 19.525000000000002 8 16.900000000000002 25.275 34.050000000000004 23.775 9 18.85 22.825 33.375 24.95 10-14 20.06 29.175 27.075 23.69 15-19 20.47 28.310000000000002 27.35 23.87 20-24 20.21 27.58 27.865000000000002 24.345 25-29 19.925 27.500000000000004 27.685 24.89 30-34 20.115 29.205 26.895000000000003 23.785 35-39 19.615 28.799999999999997 26.700000000000003 24.884999999999998 40-44 20.19 27.860000000000003 28.43 23.52 45-49 20.244999999999997 28.000000000000004 27.73 24.025 50-54 20.244999999999997 27.42 28.110000000000003 24.224999999999998 55-59 20.52 27.944999999999997 27.169999999999998 24.365000000000002 60-64 20.09 28.110000000000003 27.04 24.759999999999998 65-69 20.455000000000002 28.09 27.11 24.345 70-74 20.41408281656331 28.395679135827166 27.025405081016203 24.16483296659332 75-79 20.730182545636406 27.461865466366593 27.326831707926978 24.48112028007002 80-84 19.884971242810703 27.68192048012003 27.521880470117527 24.91122780695174 85-89 20.830207551887973 27.636909227306827 26.831707926981746 24.701175293823454 90-94 20.710177544386095 27.211802950737685 27.6419104776194 24.436109027256812 95-99 20.605151287821954 27.70692673168292 27.141785446361588 24.546136534133534 100-104 20.13103931179354 27.78333500050015 27.35820746223867 24.72741822546764 105-109 20.680340170085042 27.12856428214107 27.863931965982992 24.327163581790895 110-114 20.572343406043625 26.91114668801281 27.826696017610566 24.689813888333 115-119 20.734881858229876 27.332799359231075 26.86223468161794 25.070084100921104 120-124 20.533880903490758 27.435268192517654 27.95612761055742 24.074723293434168 125-129 20.645581675104005 27.637712395368652 27.266803668989027 24.44990226053832 130-134 20.639067524115756 27.074959807073956 27.798432475884244 24.487540192926044 135-139 20.665658093797276 27.644982349974782 27.00453857791225 24.684820978315685 140-144 21.388748099341104 26.77141409021794 26.93360364926508 24.906234161175874 145-149 20.295885344429035 26.72728206708789 27.94986387219397 25.026968716289105 150-151 21.83682067125404 27.791040584187616 26.17609886251931 24.196039882039038 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.0 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 1.5 18 1.0 19 0.0 20 0.5 21 1.5 22 1.0 23 0.5 24 1.5 25 1.5 26 2.0 27 4.0 28 5.5 29 12.0 30 17.0 31 19.0 32 29.5 33 43.0 34 48.0 35 53.0 36 68.5 37 76.5 38 108.5 39 143.0 40 157.5 41 189.5 42 223.5 43 241.5 44 253.0 45 264.5 46 269.5 47 260.5 48 234.0 49 204.5 50 194.5 51 167.0 52 140.0 53 128.5 54 86.0 55 61.0 56 58.5 57 51.5 58 38.0 59 27.0 60 26.0 61 21.0 62 15.5 63 14.0 64 8.5 65 4.5 66 3.0 67 1.5 68 1.5 69 1.5 70 1.5 71 0.5 72 0.0 73 1.0 74 1.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70-71 1.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 1.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 2.0 114-115 0.0 116-117 1.0 118-119 1.0 120-121 0.0 122-123 2.0 124-125 1.0 126-127 1.0 128-129 4.0 130-131 4.0 132-133 8.0 134-135 4.0 136-137 7.0 138-139 9.0 140-141 9.0 142-143 7.0 144-145 21.0 146-147 38.0 148-149 119.0 150-151 3760.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.625 #Duplication Level Percentage of deduplicated Percentage of total 1 92.71255060728745 85.875 2 6.666666666666667 12.35 3 0.5937921727395412 1.6500000000000001 4 0.0 0.0 5 0.026990553306342778 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACGGTTCTTGGCAAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0125 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138-139 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802627 READS because READLEN < 1 Read 2802627 spots for SRR12561284.sra Written 2802627 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra Rejected 2802623 READS because READLEN < 1 Read 2802623 spots for SRR12561284.sra Written 2802623 spots for SRR12561284.sra SRR ids: ['SRR12561284.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gflfhbr3 SRR12561284.sra spots: 56052464 blocks: [[1, 2802623], [2802624, 5605246], [5605247, 8407869], [8407870, 11210492], [11210493, 14013115], [14013116, 16815738], [16815739, 19618361], [19618362, 22420984], [22420985, 25223607], [25223608, 28026230], [28026231, 30828853], [30828854, 33631476], [33631477, 36434099], [36434100, 39236722], [39236723, 42039345], [42039346, 44841968], [44841969, 47644591], [47644592, 50447214], [50447215, 53249837], [53249838, 56052464]] SRR12561284 file size 18988167 SRR12561284 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12561284 SRR12561284_1.fastq Input file: SRR12561284_1.fastq trimmed: SRR12561284-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:43:38 2025 >> started Mon Feb 10 21:44:12 2025 >> done (34.114s) 56052464 reads processed; of these: 283 ( 0.00%) short reads filtered out after trimming by size control 293 ( 0.00%) empty reads filtered out after trimming by size control 56051888 (100.00%) reads available; of these: 3027 ( 0.01%) trimmed reads available after processing 56048861 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 70 0.00% 19 62 0.00% 20 56 0.00% 21 61 0.00% 22 48 0.00% 23 43 0.00% 24 39 0.00% 25 43 0.00% 26 44 0.00% 27 37 0.00% 28 40 0.00% 29 55 0.00% 30 80 0.00% 31 48 0.00% 32 71 0.00% 33 79 0.00% 34 96 0.00% 35 78 0.00% 36 134 0.00% 37 97 0.00% 38 120 0.00% 39 206 0.00% 40 1365 0.00% 41 523 0.00% 42 298 0.00% 43 367 0.00% 44 104 0.00% 45 95 0.00% 46 173 0.00% 47 104 0.00% 48 108 0.00% 49 125 0.00% 50 130 0.00% 51 112 0.00% 52 127 0.00% 53 143 0.00% 54 179 0.00% 55 369 0.00% 56 150 0.00% 57 195 0.00% 58 164 0.00% 59 168 0.00% 60 206 0.00% 61 223 0.00% 62 229 0.00% 63 219 0.00% 64 224 0.00% 65 231 0.00% 66 236 0.00% 67 269 0.00% 68 253 0.00% 69 284 0.00% 70 297 0.00% 71 273 0.00% 72 314 0.00% 73 295 0.00% 74 354 0.00% 75 492 0.00% 76 660 0.00% 77 342 0.00% 78 323 0.00% 79 324 0.00% 80 369 0.00% 81 449 0.00% 82 413 0.00% 83 487 0.00% 84 436 0.00% 85 534 0.00% 86 508 0.00% 87 534 0.00% 88 661 0.00% 89 621 0.00% 90 722 0.00% 91 636 0.00% 92 729 0.00% 93 793 0.00% 94 901 0.00% 95 1200 0.00% 96 893 0.00% 97 1145 0.00% 98 1096 0.00% 99 1259 0.00% 100 1248 0.00% 101 1362 0.00% 102 1488 0.00% 103 1554 0.00% 104 1812 0.00% 105 1805 0.00% 106 1950 0.00% 107 2075 0.00% 108 2050 0.00% 109 2325 0.00% 110 2495 0.00% 111 2573 0.00% 112 2910 0.01% 113 2982 0.01% 114 3253 0.01% 115 3316 0.01% 116 3613 0.01% 117 4049 0.01% 118 4143 0.01% 119 4709 0.01% 120 4681 0.01% 121 4856 0.01% 122 5250 0.01% 123 5584 0.01% 124 5932 0.01% 125 6463 0.01% 126 6954 0.01% 127 7559 0.01% 128 8452 0.02% 129 9677 0.02% 130 10868 0.02% 131 12564 0.02% 132 13087 0.02% 133 14835 0.03% 134 17290 0.03% 135 20248 0.04% 136 23584 0.04% 137 27698 0.05% 138 31549 0.06% 139 37767 0.07% 140 36515 0.07% 141 44299 0.08% 142 53464 0.10% 143 66723 0.12% 144 88027 0.16% 145 109864 0.20% 146 143574 0.26% 147 211751 0.38% 148 378027 0.67% 149 711695 1.27% 150 3912229 6.98% 151 49942070 89.10% 56051888 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.24 prefix-fanout=2.0 sequence=ATACGGATAAAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=27.60 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.5 sequence=TTTTTTCAAGGGACCAAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTT Started job on | Feb 10 21:44:36 Started mapping on | Feb 10 21:44:36 Finished on | Feb 10 21:46:03 Mapping speed, Million of reads per hour | 2319.39 Number of input reads | 56051888 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 53185474 Uniquely mapped reads % | 94.89% Average mapped length | 150.20 Number of splices: Total | 24681784 Number of splices: Annotated (sjdb) | 24412434 Number of splices: GT/AG | 24243785 Number of splices: GC/AG | 359904 Number of splices: AT/AC | 22855 Number of splices: Non-canonical | 55240 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1936234 % of reads mapped to multiple loci | 3.45% Number of reads mapped to too many loci | 258073 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.15% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 930180 930180 930180 N_multimapping 1936234 1936234 1936234 N_noFeature 1076851 52279952 1597767 N_ambiguous 607438 3335 220164 UnstrandedReadsAssigned:51501185 PositiveStrandReadsAssigned:902187 NegativeStrandReadsAssigned:51367543 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12561284 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12561284-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 56,051,888 reads, 52,468,087 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,319 rounds 52401 SRR12561284.ke.tsv 34699 SRR12561284.se.tsv 87100 total ==> SRR12561284.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2260 29.0161 Potri.005G024800.1.v4.1 1035 936 719 18.926 Potri.004G059700.1.v4.1 961 862 143 4.08728 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1832 15.8709 Potri.016G087400.1.v4.1 270 171 1694 244.075 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 334 4.91583 Potri.012G127500.1.v4.1 977 878 2588 72.6233 ==> SRR12561284.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 742 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 619 Potri.001G212900.v4.1 75 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 167 Potri.001G452600.v4.1 28 SRR12561284 completed mapping pipeline successfully