Starting /dee2/code/volunteer_pipeline.sh SRR12561285 current disk space = 3057534259200 free memory = 1579909348 SRR12561285 SRAfilesize ab445fafa9ff6ae06974310aa559c5aa SRR12561285.sra SRR12561285.sra file validated SRR12561285 is single end SRR12561285 is conventional basespace SRR12561285 read1 length is 79-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12561285_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 79-151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.82625 32.0 32.0 32.0 32.0 32.0 2 31.32 32.0 32.0 32.0 32.0 32.0 3 34.42 37.0 32.0 37.0 32.0 37.0 4 35.69925 37.0 37.0 37.0 32.0 37.0 5 36.08975 37.0 37.0 37.0 32.0 37.0 6 38.526 41.0 37.0 41.0 32.0 41.0 7 38.2615 41.0 37.0 41.0 32.0 41.0 8 38.943 41.0 37.0 41.0 37.0 41.0 9 38.714 41.0 37.0 41.0 32.0 41.0 10-14 38.9088 41.0 40.2 41.0 35.0 41.0 15-19 39.147450000000006 41.0 41.0 41.0 36.0 41.0 20-24 39.420950000000005 41.0 41.0 41.0 37.0 41.0 25-29 38.951 41.0 41.0 41.0 34.0 41.0 30-34 38.7875 41.0 39.4 41.0 34.0 41.0 35-39 38.54675 41.0 37.8 41.0 33.0 41.0 40-44 38.6764 41.0 40.2 41.0 33.0 41.0 45-49 38.77855 41.0 41.0 41.0 34.0 41.0 50-54 38.5082 41.0 39.4 41.0 33.0 41.0 55-59 38.660199999999996 41.0 40.2 41.0 32.0 41.0 60-64 38.45665 41.0 37.8 41.0 32.0 41.0 65-69 38.2929 41.0 38.6 41.0 32.0 41.0 70-74 38.15245 41.0 37.8 41.0 31.0 41.0 75-79 38.0651 41.0 37.0 41.0 31.0 41.0 80-84 38.78524631157789 41.0 41.0 41.0 33.0 41.0 85-89 38.797449362340586 41.0 40.2 41.0 33.0 41.0 90-94 38.666716679169795 41.0 40.2 41.0 32.0 41.0 95-99 38.577194298574646 41.0 39.4 41.0 32.0 41.0 100-104 38.28356990495389 41.0 38.6 41.0 32.0 41.0 105-109 38.63353353353354 41.0 39.4 41.0 32.0 41.0 110-114 38.36917889103121 41.0 37.0 41.0 32.0 41.0 115-119 38.28746813523821 41.0 37.0 41.0 32.0 41.0 120-124 37.94332518423775 41.0 37.0 41.0 31.0 41.0 125-129 37.10821377538279 41.0 37.0 41.0 27.0 41.0 130-134 37.56371614561411 41.0 37.0 41.0 30.0 41.0 135-139 37.39524691371872 41.0 37.0 41.0 28.0 41.0 140-144 37.337548441542936 41.0 37.0 41.0 27.0 41.0 145-149 37.38663450079234 41.0 37.0 41.0 27.0 41.0 150-151 36.64541399926016 39.0 34.5 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 2.0 24 6.0 25 9.0 26 13.0 27 20.0 28 37.0 29 29.0 30 53.0 31 65.0 32 110.0 33 128.0 34 137.0 35 190.0 36 219.0 37 237.0 38 371.0 39 690.0 40 1681.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.949999999999996 11.774999999999999 15.225 37.05 2 28.375 14.475 27.474999999999998 29.675 3 24.825 19.55 23.9 31.724999999999998 4 26.400000000000002 24.5 20.95 28.15 5 25.724999999999998 28.475 22.825 22.975 6 20.075000000000003 31.125000000000004 25.0 23.799999999999997 7 14.45 29.25 36.6 19.7 8 16.775000000000002 25.55 32.85 24.825 9 18.55 23.549999999999997 33.5 24.4 10-14 20.31 29.265 26.955000000000002 23.47 15-19 20.04 28.065 27.905 23.990000000000002 20-24 19.845 28.299999999999997 27.994999999999997 23.86 25-29 20.11 28.53 27.91 23.45 30-34 20.055 27.98 27.810000000000002 24.154999999999998 35-39 20.285 28.57 27.11 24.035 40-44 19.950000000000003 28.015 27.389999999999997 24.645 45-49 19.939999999999998 28.015 27.735 24.310000000000002 50-54 20.599999999999998 27.900000000000002 27.21 24.29 55-59 20.07 27.944999999999997 27.215 24.77 60-64 20.145 27.62 28.115000000000002 24.12 65-69 20.07 27.839999999999996 27.055 25.035 70-74 20.215 28.444999999999997 27.450000000000003 23.89 75-79 20.405 27.58 28.345 23.669999999999998 80-84 20.060015003750937 27.976994248562143 27.156789197299325 24.8062015503876 85-89 20.475118779694924 28.097024256064017 27.38684671167792 24.04101025256314 90-94 20.470117529382346 27.691922980745186 27.41685421355339 24.42110527631908 95-99 20.29007251812953 27.261815453863463 28.387096774193548 24.06101525381345 100-104 20.61443010107075 27.14400080056039 27.724407084959473 24.517162013409386 105-109 21.03103103103103 26.58158158158158 28.48848848848849 23.8988988988989 110-114 20.793912999949942 27.4115232517395 26.966010912549432 24.828552835761126 115-119 20.365823101979455 27.732397895264345 27.857679779503886 24.044099223252317 120-124 20.319405383688228 27.46082764162314 28.103656086781843 24.11611088790679 125-129 20.918649695628115 27.031242139155808 27.388438899230266 24.661669265985815 130-134 20.588235294117645 27.70154373927959 27.540106951871657 24.170114014731105 135-139 20.82699137493658 27.067478437341453 27.412480974124808 24.69304921359716 140-144 20.992813821925488 27.2157382396412 27.50114673054381 24.290301207889506 145-149 21.142325965709563 26.735178682090478 27.778351580252014 24.344143771947945 150-151 21.49545970488082 26.67423382519864 26.574914869466514 25.25539160045403 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.5 5 1.5 6 1.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.5 17 1.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 1.5 25 3.0 26 3.5 27 5.0 28 10.5 29 15.5 30 19.5 31 22.0 32 23.5 33 38.0 34 56.0 35 65.5 36 87.0 37 99.5 38 125.0 39 142.5 40 148.5 41 170.0 42 195.5 43 224.5 44 235.5 45 264.5 46 264.0 47 251.5 48 256.5 49 238.5 50 206.5 51 165.5 52 140.5 53 111.0 54 81.0 55 71.0 56 52.5 57 40.0 58 38.0 59 31.5 60 24.0 61 14.5 62 8.0 63 6.0 64 4.5 65 3.0 66 6.0 67 5.5 68 2.5 69 2.0 70 0.5 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 78-79 1.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 1.0 100-101 1.0 102-103 1.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 1.0 112-113 0.0 114-115 1.0 116-117 4.0 118-119 5.0 120-121 2.0 122-123 5.0 124-125 1.0 126-127 3.0 128-129 2.0 130-131 5.0 132-133 14.0 134-135 3.0 136-137 13.0 138-139 6.0 140-141 6.0 142-143 11.0 144-145 21.0 146-147 32.0 148-149 143.0 150-151 3718.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.55 #Duplication Level Percentage of deduplicated Percentage of total 1 93.34580438268306 87.325 2 6.467129877071084 12.1 3 0.13361838588989847 0.375 4 0.053447354355959376 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.07500000000000001 0.0 0.0 0.0 0.0 132-133 0.1 0.0 0.0 0.0 0.0 134-135 0.1 0.0 0.0 0.0 0.0 136-137 0.1 0.0 0.0 0.0 0.0 138-139 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCGAAA 10 0.0069124657 144.425 1 CCGAAAA 10 0.0069124657 144.425 2 >>END_MODULE Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804811 READS because READLEN < 1 Read 2804811 spots for SRR12561285.sra Written 2804811 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra Rejected 2804809 READS because READLEN < 1 Read 2804809 spots for SRR12561285.sra Written 2804809 spots for SRR12561285.sra SRR ids: ['SRR12561285.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bujxzuz1 SRR12561285.sra spots: 56096182 blocks: [[1, 2804809], [2804810, 5609618], [5609619, 8414427], [8414428, 11219236], [11219237, 14024045], [14024046, 16828854], [16828855, 19633663], [19633664, 22438472], [22438473, 25243281], [25243282, 28048090], [28048091, 30852899], [30852900, 33657708], [33657709, 36462517], [36462518, 39267326], [39267327, 42072135], [42072136, 44876944], [44876945, 47681753], [47681754, 50486562], [50486563, 53291371], [53291372, 56096182]] SRR12561285 file size 18983940 SRR12561285 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12561285 SRR12561285_1.fastq Input file: SRR12561285_1.fastq trimmed: SRR12561285-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 22:42:08 2025 >> started Mon Feb 10 22:42:43 2025 >> done (35.800s) 56096182 reads processed; of these: 428 ( 0.00%) short reads filtered out after trimming by size control 397 ( 0.00%) empty reads filtered out after trimming by size control 56095357 (100.00%) reads available; of these: 5398 ( 0.01%) trimmed reads available after processing 56089959 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 115 0.00% 19 102 0.00% 20 86 0.00% 21 97 0.00% 22 73 0.00% 23 73 0.00% 24 68 0.00% 25 69 0.00% 26 60 0.00% 27 61 0.00% 28 68 0.00% 29 73 0.00% 30 134 0.00% 31 74 0.00% 32 107 0.00% 33 136 0.00% 34 252 0.00% 35 285 0.00% 36 1928 0.00% 37 637 0.00% 38 310 0.00% 39 127 0.00% 40 213 0.00% 41 285 0.00% 42 250 0.00% 43 392 0.00% 44 155 0.00% 45 146 0.00% 46 240 0.00% 47 134 0.00% 48 151 0.00% 49 180 0.00% 50 181 0.00% 51 190 0.00% 52 189 0.00% 53 201 0.00% 54 215 0.00% 55 413 0.00% 56 218 0.00% 57 271 0.00% 58 268 0.00% 59 290 0.00% 60 284 0.00% 61 334 0.00% 62 309 0.00% 63 350 0.00% 64 342 0.00% 65 311 0.00% 66 381 0.00% 67 373 0.00% 68 390 0.00% 69 451 0.00% 70 445 0.00% 71 444 0.00% 72 438 0.00% 73 465 0.00% 74 575 0.00% 75 700 0.00% 76 825 0.00% 77 578 0.00% 78 621 0.00% 79 602 0.00% 80 653 0.00% 81 714 0.00% 82 792 0.00% 83 876 0.00% 84 893 0.00% 85 1117 0.00% 86 1039 0.00% 87 1178 0.00% 88 1307 0.00% 89 1341 0.00% 90 1535 0.00% 91 1448 0.00% 92 1602 0.00% 93 1822 0.00% 94 2042 0.00% 95 2519 0.00% 96 2331 0.00% 97 2751 0.00% 98 2696 0.00% 99 2951 0.01% 100 3119 0.01% 101 3542 0.01% 102 3684 0.01% 103 4180 0.01% 104 4509 0.01% 105 4712 0.01% 106 5236 0.01% 107 5670 0.01% 108 6066 0.01% 109 6505 0.01% 110 6949 0.01% 111 7260 0.01% 112 7710 0.01% 113 8301 0.01% 114 9078 0.02% 115 9723 0.02% 116 10168 0.02% 117 10761 0.02% 118 11785 0.02% 119 12424 0.02% 120 12532 0.02% 121 13127 0.02% 122 13930 0.02% 123 14710 0.03% 124 15518 0.03% 125 16202 0.03% 126 17607 0.03% 127 18534 0.03% 128 20190 0.04% 129 21574 0.04% 130 23033 0.04% 131 25259 0.05% 132 26285 0.05% 133 29024 0.05% 134 31041 0.06% 135 34136 0.06% 136 38353 0.07% 137 42853 0.08% 138 47009 0.08% 139 53380 0.10% 140 35327 0.06% 141 43271 0.08% 142 52590 0.09% 143 65962 0.12% 144 86599 0.15% 145 108561 0.19% 146 141842 0.25% 147 209445 0.37% 148 371754 0.66% 149 699941 1.25% 150 3875923 6.91% 151 49698121 88.60% 56095357 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=22 prefix-density=0.37 prefix-fanout=2.7 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=49.29 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.9 sequence=ACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTG Started job on | Feb 10 22:43:05 Started mapping on | Feb 10 22:43:06 Finished on | Feb 10 22:44:41 Mapping speed, Million of reads per hour | 2125.72 Number of input reads | 56095357 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 53206939 Uniquely mapped reads % | 94.85% Average mapped length | 150.00 Number of splices: Total | 24745761 Number of splices: Annotated (sjdb) | 24471681 Number of splices: GT/AG | 24311869 Number of splices: GC/AG | 355521 Number of splices: AT/AC | 23318 Number of splices: Non-canonical | 55053 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1942118 % of reads mapped to multiple loci | 3.46% Number of reads mapped to too many loci | 240077 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.18% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 946300 946300 946300 N_multimapping 1942118 1942118 1942118 N_noFeature 1026998 52153819 1668946 N_ambiguous 640250 3518 226252 UnstrandedReadsAssigned:51539691 PositiveStrandReadsAssigned:1049602 NegativeStrandReadsAssigned:51311741 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12561285 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12561285-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 56,095,357 reads, 52,418,542 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52401 SRR12561285.ke.tsv 34699 SRR12561285.se.tsv 87100 total ==> SRR12561285.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2314 28.2355 Potri.005G024800.1.v4.1 1035 936 872 21.8146 Potri.004G059700.1.v4.1 961 862 162 4.40063 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1749.25 14.4022 Potri.016G087400.1.v4.1 270 171 1848 253.054 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 301 4.21035 Potri.012G127500.1.v4.1 977 878 1977 52.7254 ==> SRR12561285.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 616 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 641 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 268 Potri.001G452600.v4.1 14 SRR12561285 completed mapping pipeline successfully