Starting /dee2/code/volunteer_pipeline.sh SRR12561286 current disk space = 3057340461056 free memory = 1473062276 SRR12561286 SRAfilesize 67db371b7054d2bf5266e4681429cae9 SRR12561286.sra SRR12561286.sra file validated SRR12561286 is single end SRR12561286 is conventional basespace SRR12561286 read1 length is 50-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12561286_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.83625 32.0 32.0 32.0 32.0 32.0 2 31.2925 32.0 32.0 32.0 32.0 32.0 3 34.476 37.0 32.0 37.0 32.0 37.0 4 35.86625 37.0 37.0 37.0 32.0 37.0 5 36.14975 37.0 37.0 37.0 37.0 37.0 6 38.70975 41.0 37.0 41.0 32.0 41.0 7 38.42925 41.0 37.0 41.0 32.0 41.0 8 39.09275 41.0 41.0 41.0 37.0 41.0 9 38.76525 41.0 37.0 41.0 32.0 41.0 10-14 38.984449999999995 41.0 40.2 41.0 35.0 41.0 15-19 39.1726 41.0 41.0 41.0 36.0 41.0 20-24 39.51455000000001 41.0 41.0 41.0 37.0 41.0 25-29 38.997 41.0 41.0 41.0 36.0 41.0 30-34 38.97 41.0 41.0 41.0 35.0 41.0 35-39 38.7347 41.0 39.4 41.0 34.0 41.0 40-44 38.8632 41.0 41.0 41.0 34.0 41.0 45-49 38.950900000000004 41.0 41.0 41.0 34.0 41.0 50-54 38.65195350087522 41.0 39.4 41.0 33.0 41.0 55-59 38.80385096274069 41.0 40.2 41.0 34.0 41.0 60-64 38.61700425106277 41.0 40.2 41.0 32.0 41.0 65-69 38.49707426856714 41.0 38.6 41.0 32.0 41.0 70-74 38.30932733183296 41.0 38.6 41.0 32.0 41.0 75-79 38.27166791697925 41.0 38.6 41.0 32.0 41.0 80-84 38.93439529216972 41.0 41.0 41.0 33.0 41.0 85-89 38.86406662175221 41.0 41.0 41.0 34.0 41.0 90-94 38.82606955216413 41.0 41.0 41.0 33.0 41.0 95-99 38.797548161120844 41.0 41.0 41.0 33.0 41.0 100-104 38.66074335531429 41.0 40.2 41.0 32.0 41.0 105-109 38.723464714388946 41.0 39.4 41.0 32.0 41.0 110-114 38.635127373232734 41.0 37.8 41.0 33.0 41.0 115-119 38.4673893841145 41.0 37.8 41.0 32.0 41.0 120-124 38.21995449317322 41.0 37.0 41.0 32.0 41.0 125-129 37.47553992174925 41.0 37.0 41.0 29.0 41.0 130-134 37.83312417146671 41.0 37.0 41.0 31.0 41.0 135-139 37.56816147286129 41.0 37.0 41.0 30.0 41.0 140-144 37.529394852416104 41.0 37.0 41.0 27.0 41.0 145-149 37.67703203842007 41.0 37.0 41.0 28.0 41.0 150-151 36.74169909708698 39.0 34.5 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 3.0 24 6.0 25 9.0 26 8.0 27 14.0 28 31.0 29 35.0 30 47.0 31 65.0 32 93.0 33 120.0 34 135.0 35 156.0 36 192.0 37 248.0 38 367.0 39 650.0 40 1818.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.375 11.700000000000001 14.475 36.449999999999996 2 28.225 12.875 29.549999999999997 29.349999999999998 3 25.324999999999996 19.2 23.400000000000002 32.074999999999996 4 26.924999999999997 24.775 19.675 28.625 5 26.75 27.675 22.7 22.875 6 20.1 31.324999999999996 25.650000000000002 22.925 7 14.399999999999999 29.299999999999997 37.925 18.375 8 16.75 26.75 32.15 24.349999999999998 9 19.075 22.7 32.0 26.224999999999998 10-14 20.71 29.470000000000002 26.795 23.025000000000002 15-19 20.035 28.09 27.875 24.0 20-24 20.055 28.12 27.58 24.245 25-29 19.77 28.345 27.560000000000002 24.325 30-34 20.32 28.34 27.339999999999996 24.0 35-39 20.345 27.605 27.48 24.57 40-44 20.560000000000002 28.025 27.200000000000003 24.215 45-49 20.845 28.050000000000004 27.195000000000004 23.91 50-54 20.249049809961992 27.950590118023605 27.645529105821165 24.154830966193238 55-59 20.370092523130783 27.45686421605401 27.81695423855964 24.356089022255563 60-64 20.1600400100025 28.072018004501125 27.54688672168042 24.221055263815956 65-69 20.46011502875719 28.02200550137534 27.731932983245812 23.785946486621658 70-74 20.54013503375844 27.846961740435113 27.536884221055264 24.07601900475119 75-79 21.030257564391096 27.056764191047762 27.41185296324081 24.50112528132033 80-84 20.457160006002102 27.74971239933977 27.664682638923622 24.12844495573451 85-89 20.344240968678072 27.784449114380067 27.43920744521165 24.43210247173021 90-94 20.745559169377035 27.66574931198399 27.190392794595947 24.398298724043034 95-99 20.88566424818614 27.175381536152116 27.280460345258945 24.658493870402804 100-104 20.6986287658893 27.870083074767287 27.08938044239816 24.34190771694525 105-109 21.104546364910874 27.904065691968754 27.19807730823152 23.793310634888844 110-114 20.551516670844823 27.590874905991473 26.9791927801454 24.8784156430183 115-119 21.39163612631156 27.42607560620513 27.039510015563028 24.142778251920276 120-124 20.775497887748944 27.16254274793804 27.464292898813113 24.5976664654999 125-129 21.73124401672797 27.051947397591576 27.369375724290823 23.84743286138963 130-134 20.802384922439494 27.18912637057248 27.532716891516344 24.475771815471678 135-139 20.77204017449528 26.990970883635995 27.807649386222987 24.429339555645736 140-144 20.895370181521518 27.223128696716298 27.778910870895366 24.102590250866815 145-149 20.909795812871543 27.262858619798397 27.593693460842594 24.23365210648746 150-151 21.445647588243567 27.309801715651805 26.22697229644213 25.017578399662494 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 3.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.0 25 0.5 26 1.5 27 3.0 28 7.5 29 10.5 30 12.5 31 17.5 32 24.0 33 33.5 34 42.0 35 60.5 36 81.5 37 96.5 38 120.0 39 146.0 40 162.0 41 194.0 42 225.5 43 238.5 44 226.5 45 222.5 46 241.0 47 265.0 48 258.0 49 228.0 50 188.0 51 159.0 52 141.0 53 111.5 54 99.5 55 68.0 56 54.0 57 63.0 58 50.0 59 40.5 60 37.0 61 21.5 62 9.0 63 4.0 64 5.5 65 4.5 66 2.5 67 3.0 68 2.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-54 1.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 1.0 85-89 1.0 90-94 0.0 95-99 0.0 100-104 1.0 105-109 5.0 110-114 4.0 115-119 9.0 120-124 2.0 125-129 13.0 130-134 13.0 135-139 19.0 140-144 28.0 145-149 170.0 150-152 3733.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.675 #Duplication Level Percentage of deduplicated Percentage of total 1 92.71648233072565 85.925 2 6.824925816023739 12.65 3 0.37766387914755867 1.05 4 0.05395198273536552 0.2 5 0.0 0.0 6 0.0 0.0 7 0.02697599136768276 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0125 0.0 0.0 0.025 0.0 124-125 0.025 0.0 0.0 0.025 0.0 126-127 0.025 0.0 0.0 0.025 0.0 128-129 0.025 0.0 0.0 0.025 0.0 130-131 0.025 0.0 0.0 0.025 0.0 132-133 0.025 0.0 0.0 0.025 0.0 134-135 0.025 0.0 0.0 0.025 0.0 136-137 0.025 0.0 0.0 0.025 0.0 138-139 0.037500000000000006 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGAGTC 10 0.006864391 144.7625 7 >>END_MODULE Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841500 READS because READLEN < 1 Read 2841500 spots for SRR12561286.sra Written 2841500 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra Rejected 2841491 READS because READLEN < 1 Read 2841491 spots for SRR12561286.sra Written 2841491 spots for SRR12561286.sra SRR ids: ['SRR12561286.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hswt_eeg SRR12561286.sra spots: 56829829 blocks: [[1, 2841491], [2841492, 5682982], [5682983, 8524473], [8524474, 11365964], [11365965, 14207455], [14207456, 17048946], [17048947, 19890437], [19890438, 22731928], [22731929, 25573419], [25573420, 28414910], [28414911, 31256401], [31256402, 34097892], [34097893, 36939383], [36939384, 39780874], [39780875, 42622365], [42622366, 45463856], [45463857, 48305347], [48305348, 51146838], [51146839, 53988329], [53988330, 56829829]] SRR12561286 file size 19234655 SRR12561286 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12561286 SRR12561286_1.fastq Input file: SRR12561286_1.fastq trimmed: SRR12561286-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 22:27:58 2025 >> started Mon Feb 10 22:28:32 2025 >> done (34.079s) 56829829 reads processed; of these: 353 ( 0.00%) short reads filtered out after trimming by size control 533 ( 0.00%) empty reads filtered out after trimming by size control 56828943 (100.00%) reads available; of these: 5867 ( 0.01%) trimmed reads available after processing 56823076 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 96 0.00% 19 91 0.00% 20 82 0.00% 21 100 0.00% 22 86 0.00% 23 63 0.00% 24 56 0.00% 25 64 0.00% 26 61 0.00% 27 55 0.00% 28 71 0.00% 29 72 0.00% 30 117 0.00% 31 66 0.00% 32 111 0.00% 33 161 0.00% 34 321 0.00% 35 1853 0.00% 36 868 0.00% 37 413 0.00% 38 111 0.00% 39 102 0.00% 40 217 0.00% 41 234 0.00% 42 206 0.00% 43 386 0.00% 44 104 0.00% 45 134 0.00% 46 183 0.00% 47 139 0.00% 48 128 0.00% 49 134 0.00% 50 143 0.00% 51 167 0.00% 52 157 0.00% 53 168 0.00% 54 209 0.00% 55 429 0.00% 56 225 0.00% 57 276 0.00% 58 262 0.00% 59 221 0.00% 60 248 0.00% 61 269 0.00% 62 281 0.00% 63 314 0.00% 64 287 0.00% 65 305 0.00% 66 323 0.00% 67 347 0.00% 68 372 0.00% 69 393 0.00% 70 423 0.00% 71 407 0.00% 72 436 0.00% 73 483 0.00% 74 530 0.00% 75 663 0.00% 76 818 0.00% 77 465 0.00% 78 648 0.00% 79 587 0.00% 80 612 0.00% 81 762 0.00% 82 740 0.00% 83 890 0.00% 84 834 0.00% 85 1050 0.00% 86 1030 0.00% 87 1051 0.00% 88 1244 0.00% 89 1278 0.00% 90 1512 0.00% 91 1512 0.00% 92 1606 0.00% 93 1755 0.00% 94 1958 0.00% 95 2357 0.00% 96 2333 0.00% 97 2519 0.00% 98 2744 0.00% 99 2875 0.01% 100 3081 0.01% 101 3334 0.01% 102 3537 0.01% 103 3847 0.01% 104 4209 0.01% 105 4463 0.01% 106 4968 0.01% 107 5253 0.01% 108 5644 0.01% 109 6236 0.01% 110 6378 0.01% 111 6826 0.01% 112 7382 0.01% 113 7802 0.01% 114 8379 0.01% 115 9001 0.02% 116 9810 0.02% 117 10651 0.02% 118 10952 0.02% 119 11869 0.02% 120 11897 0.02% 121 12457 0.02% 122 13204 0.02% 123 13961 0.02% 124 14885 0.03% 125 15469 0.03% 126 16795 0.03% 127 17855 0.03% 128 19440 0.03% 129 20723 0.04% 130 22281 0.04% 131 24691 0.04% 132 25263 0.04% 133 27514 0.05% 134 29633 0.05% 135 33141 0.06% 136 36577 0.06% 137 41597 0.07% 138 46003 0.08% 139 51844 0.09% 140 35301 0.06% 141 43905 0.08% 142 52414 0.09% 143 66541 0.12% 144 87989 0.15% 145 109860 0.19% 146 143684 0.25% 147 212875 0.37% 148 379891 0.67% 149 711625 1.25% 150 3927121 6.91% 151 50380482 88.65% 56828943 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=26 prefix-density=0.40 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=23.25 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.3 sequence=TTTTTTCAAGGGACCAAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTT Started job on | Feb 10 22:29:10 Started mapping on | Feb 10 22:29:10 Finished on | Feb 10 22:30:35 Mapping speed, Million of reads per hour | 2406.87 Number of input reads | 56828943 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 53771747 Uniquely mapped reads % | 94.62% Average mapped length | 150.04 Number of splices: Total | 24881132 Number of splices: Annotated (sjdb) | 24604652 Number of splices: GT/AG | 24451835 Number of splices: GC/AG | 350426 Number of splices: AT/AC | 22168 Number of splices: Non-canonical | 56703 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2043165 % of reads mapped to multiple loci | 3.60% Number of reads mapped to too many loci | 313816 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.15% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1014031 1014031 1014031 N_multimapping 2043165 2043165 2043165 N_noFeature 1039851 52803567 1578983 N_ambiguous 664608 3003 233121 UnstrandedReadsAssigned:52067288 PositiveStrandReadsAssigned:965177 NegativeStrandReadsAssigned:51959643 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12561286 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12561286-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 56,828,943 reads, 53,189,265 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,245 rounds 52401 SRR12561286.ke.tsv 34699 SRR12561286.se.tsv 87100 total ==> SRR12561286.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2335 27.9439 Potri.005G024800.1.v4.1 1035 936 913 22.4011 Potri.004G059700.1.v4.1 961 862 114 3.03719 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1806 14.5835 Potri.016G087400.1.v4.1 270 171 1904 255.709 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 427 5.85797 Potri.012G127500.1.v4.1 977 878 2417 63.2203 ==> SRR12561286.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 826 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 750 Potri.001G212900.v4.1 41 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 261 Potri.001G452600.v4.1 14 SRR12561286 completed mapping pipeline successfully