Starting /dee2/code/volunteer_pipeline.sh SRR12670098 current disk space = 3057391628288 free memory = 1471145212 SRR12670098 SRAfilesize fc39f501057b8879091dd1bd2efeea96 SRR12670098.sra SRR12670098.sra file validated SRR12670098 is paired end SRR12670098 is conventional basespace SRR12670098 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670098_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.609 37.0 37.0 37.0 37.0 37.0 2 36.57175 37.0 37.0 37.0 37.0 37.0 3 36.691 37.0 37.0 37.0 37.0 37.0 4 36.6925 37.0 37.0 37.0 37.0 37.0 5 36.717 37.0 37.0 37.0 37.0 37.0 6 36.659 37.0 37.0 37.0 37.0 37.0 7 36.6335 37.0 37.0 37.0 37.0 37.0 8 36.7655 37.0 37.0 37.0 37.0 37.0 9 36.64 37.0 37.0 37.0 37.0 37.0 10-14 36.6505 37.0 37.0 37.0 37.0 37.0 15-19 36.6202 37.0 37.0 37.0 37.0 37.0 20-24 36.57040000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.517700000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.51649999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4952 37.0 37.0 37.0 37.0 37.0 40-44 36.4713 37.0 37.0 37.0 37.0 37.0 45-49 36.4619 37.0 37.0 37.0 37.0 37.0 50-54 36.464099999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.427800000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3957 37.0 37.0 37.0 37.0 37.0 65-69 36.3932 37.0 37.0 37.0 37.0 37.0 70-74 36.344800000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.299699999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.3197 37.0 37.0 37.0 37.0 37.0 85-89 36.3267 37.0 37.0 37.0 37.0 37.0 90-94 36.237199999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.293600000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.2557 37.0 37.0 37.0 37.0 37.0 105-109 36.247699999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.2123 37.0 37.0 37.0 37.0 37.0 115-119 36.1955 37.0 37.0 37.0 37.0 37.0 120-124 36.0619 37.0 37.0 37.0 37.0 37.0 125-129 35.9418 37.0 37.0 37.0 37.0 37.0 130-134 35.8812 37.0 37.0 37.0 37.0 37.0 135-139 35.8084 37.0 37.0 37.0 37.0 37.0 140-144 35.557100000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.487 37.0 37.0 37.0 37.0 37.0 150-151 35.31275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 3.0 26 3.0 27 7.0 28 8.0 29 16.0 30 28.0 31 30.0 32 36.0 33 68.0 34 142.0 35 319.0 36 2946.0 37 391.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.875 11.450000000000001 5.65 41.025 2 20.290217663247436 12.509382036527395 36.70252689517138 30.497873405053788 3 17.025000000000002 16.150000000000002 27.750000000000004 39.074999999999996 4 22.45 23.325000000000003 25.5 28.725 5 24.575 29.549999999999997 23.875 22.0 6 21.15 34.675 24.45 19.725 7 14.85 27.175 40.175 17.8 8 17.849999999999998 24.525 32.7 24.925 9 18.95 22.45 35.425000000000004 23.175 10-14 19.765 28.59 28.205000000000002 23.44 15-19 19.37 28.444999999999997 27.925 24.26 20-24 20.14 28.005000000000003 27.560000000000002 24.295 25-29 19.905 28.249999999999996 27.169999999999998 24.675 30-34 19.725 28.4 27.85 24.025 35-39 20.895 28.244999999999997 26.790000000000003 24.07 40-44 20.385 28.735 27.375 23.505000000000003 45-49 20.54 28.22 27.825 23.415 50-54 20.89 27.785 28.025 23.3 55-59 20.36 27.85 27.894999999999996 23.895 60-64 21.48 27.275 27.52 23.724999999999998 65-69 21.27 27.750000000000004 27.55 23.43 70-74 20.794999999999998 28.765 26.915 23.525 75-79 21.175 27.6 27.389999999999997 23.835 80-84 20.73 28.720000000000002 27.27 23.28 85-89 21.67 28.215 26.71 23.405 90-94 20.78 28.625 26.91 23.685000000000002 95-99 21.02 28.275 27.560000000000002 23.145 100-104 21.37 27.915 27.29 23.425 105-109 21.4 29.310000000000002 26.165 23.125 110-114 20.919999999999998 28.744999999999997 26.400000000000002 23.935000000000002 115-119 21.41 28.425 25.795 24.37 120-124 21.36 27.52 26.205000000000002 24.915000000000003 125-129 21.62 27.894999999999996 26.55 23.935000000000002 130-134 20.815 28.03 26.32 24.834999999999997 135-139 20.794999999999998 27.625 26.700000000000003 24.88 140-144 21.14 26.775 26.479999999999997 25.605 145-149 21.415 27.525 26.16 24.9 150-151 21.775 26.5875 25.674999999999997 25.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 1.5 27 3.0 28 4.5 29 4.5 30 11.5 31 21.5 32 23.5 33 34.0 34 45.0 35 54.5 36 77.5 37 102.0 38 117.5 39 146.0 40 186.0 41 229.5 42 237.0 43 238.5 44 263.5 45 262.5 46 271.0 47 267.5 48 230.5 49 207.5 50 184.5 51 163.0 52 138.5 53 103.5 54 86.5 55 69.5 56 57.0 57 49.5 58 35.5 59 23.0 60 12.5 61 8.5 62 7.0 63 3.0 64 3.0 65 4.5 66 2.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.75 #Duplication Level Percentage of deduplicated Percentage of total 1 81.80428134556576 66.875 2 14.770642201834864 24.15 3 2.8134556574923546 6.9 4 0.5198776758409785 1.7000000000000002 5 0.09174311926605505 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTTGGATTGGATGTCAAGCGTGGATGTCACGTGAGGGATTTTGAGCTT 5 0.125 No Hit GTCCTTGATTGGTGTCCTCTAAATGGGCAGGTGATTCAATCATGTCGCCC 5 0.125 No Hit ACAAGTCCTTCTCTGACGGTGCAATCGGTTTCCTCAACAAATCTGAACTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.2625 0.0 0.0 0.0 0.0 70-71 0.4625 0.0 0.0 0.0 0.0 72-73 0.6 0.0 0.0 0.0 0.0 74-75 0.7375 0.0 0.0 0.0 0.0 76-77 0.9624999999999999 0.0 0.0 0.0 0.0 78-79 1.1375000000000002 0.0 0.0 0.0 0.0 80-81 1.35 0.0 0.0 0.0 0.0 82-83 1.6 0.0 0.0 0.0 0.0 84-85 2.0375 0.0 0.0 0.0 0.0 86-87 2.7375 0.0 0.0 0.0 0.0 88-89 3.175 0.0 0.0 0.0 0.0 90-91 3.7875 0.0 0.0 0.0 0.0 92-93 4.4125 0.0 0.0 0.0 0.0 94-95 4.875 0.0 0.0 0.0 0.0 96-97 5.525 0.0 0.0 0.0 0.0 98-99 6.1625 0.0 0.0 0.0 0.0 100-101 6.7125 0.0 0.0 0.0 0.0 102-103 7.3125 0.0 0.0 0.0 0.0 104-105 8.175 0.0 0.0 0.0 0.0 106-107 9.037500000000001 0.0 0.0 0.0 0.0 108-109 9.787500000000001 0.0 0.0 0.0 0.0 110-111 10.625 0.0 0.0 0.0 0.0 112-113 11.3875 0.0 0.0 0.0 0.0 114-115 12.4125 0.0 0.0 0.0 0.0 116-117 13.399999999999999 0.0 0.0 0.0 0.0 118-119 14.3625 0.0 0.0 0.0 0.0 120-121 15.0375 0.0 0.0 0.0 0.0 122-123 15.825 0.0 0.0 0.0 0.0 124-125 16.6625 0.0 0.0 0.0 0.0 126-127 17.825 0.0 0.0 0.0 0.0 128-129 18.875 0.0 0.0 0.0 0.0 130-131 19.625 0.0 0.0 0.0 0.0 132-133 20.5625 0.0 0.0 0.0 0.0 134-135 21.475 0.0 0.0 0.0 0.0 136-137 22.3625 0.0 0.0 0.0 0.0 138-139 23.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCGTT 10 0.006830828 145.0 9 CAATGGA 10 0.006830828 145.0 145 CAGTTAT 10 0.006830828 145.0 6 CCAGTTA 10 0.006830828 145.0 5 GAGGAGC 10 0.006830828 145.0 6 AGAGGAG 10 0.006830828 145.0 5 GTCCCCA 10 0.006830828 145.0 1 GAGAGGA 10 0.006830828 145.0 4 CGAGAGG 10 0.006830828 145.0 3 CCCCAGT 10 0.006830828 145.0 3 GTTATTA 10 0.006830828 145.0 8 TCGAGAG 10 0.006830828 145.0 2 GGAGCGT 10 0.006830828 145.0 8 AGTTATT 10 0.006830828 145.0 7 AGGAGCG 10 0.006830828 145.0 7 CTCGAGA 10 0.006830828 145.0 1 >>END_MODULE SRR12670098 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670098_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.292 37.0 37.0 37.0 37.0 37.0 2 36.2415 37.0 37.0 37.0 37.0 37.0 3 36.3285 37.0 37.0 37.0 37.0 37.0 4 36.3895 37.0 37.0 37.0 37.0 37.0 5 36.3965 37.0 37.0 37.0 37.0 37.0 6 36.3145 37.0 37.0 37.0 37.0 37.0 7 36.4255 37.0 37.0 37.0 37.0 37.0 8 36.4725 37.0 37.0 37.0 37.0 37.0 9 36.4385 37.0 37.0 37.0 37.0 37.0 10-14 36.463899999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.432 37.0 37.0 37.0 37.0 37.0 20-24 36.3522 37.0 37.0 37.0 37.0 37.0 25-29 36.306200000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.2875 37.0 37.0 37.0 37.0 37.0 35-39 36.2253 37.0 37.0 37.0 37.0 37.0 40-44 36.2534 37.0 37.0 37.0 37.0 37.0 45-49 36.2702 37.0 37.0 37.0 37.0 37.0 50-54 36.2323 37.0 37.0 37.0 37.0 37.0 55-59 36.1717 37.0 37.0 37.0 37.0 37.0 60-64 36.147499999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.1475 37.0 37.0 37.0 37.0 37.0 70-74 36.111000000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.1443 37.0 37.0 37.0 37.0 37.0 80-84 36.0746 37.0 37.0 37.0 37.0 37.0 85-89 36.0483 37.0 37.0 37.0 37.0 37.0 90-94 36.081100000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.0573 37.0 37.0 37.0 37.0 37.0 100-104 35.9308 37.0 37.0 37.0 37.0 37.0 105-109 35.854099999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.88100000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.8432 37.0 37.0 37.0 37.0 37.0 120-124 35.7293 37.0 37.0 37.0 37.0 37.0 125-129 35.6731 37.0 37.0 37.0 37.0 37.0 130-134 35.5526 37.0 37.0 37.0 37.0 37.0 135-139 35.4401 37.0 37.0 37.0 37.0 37.0 140-144 35.182 37.0 37.0 37.0 32.2 37.0 145-149 34.974000000000004 37.0 37.0 37.0 27.4 37.0 150-151 34.6715 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 2.0 15 4.0 16 1.0 17 2.0 18 2.0 19 0.0 20 2.0 21 1.0 22 3.0 23 5.0 24 4.0 25 8.0 26 6.0 27 7.0 28 7.0 29 17.0 30 21.0 31 33.0 32 47.0 33 102.0 34 175.0 35 477.0 36 2716.0 37 354.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.225 24.9 9.35 26.525 2 28.025 26.700000000000003 30.55 14.725 3 20.775 28.525 31.874999999999996 18.825 4 24.3 33.525 23.35 18.825 5 24.325 36.65 22.1 16.925 6 20.200000000000003 38.324999999999996 23.325000000000003 18.15 7 21.3 21.025 37.75 19.925 8 20.525 26.75 27.900000000000002 24.825 9 21.575 25.1 29.625 23.7 10-14 23.565 29.995 25.795 20.645 15-19 23.48 27.935 27.189999999999998 21.395 20-24 22.3 29.65 26.8 21.25 25-29 22.875 28.815 27.450000000000003 20.86 30-34 22.759999999999998 28.235 28.035 20.97 35-39 23.05 27.435 28.384999999999998 21.13 40-44 23.075000000000003 28.060000000000002 27.515 21.349999999999998 45-49 23.54 28.360000000000003 27.77 20.330000000000002 50-54 22.74 28.675 27.3 21.285 55-59 22.49 27.99 27.894999999999996 21.625 60-64 23.11 28.485 27.615000000000002 20.79 65-69 23.599999999999998 27.750000000000004 27.525 21.125 70-74 23.275000000000002 28.499999999999996 26.97 21.255 75-79 23.724999999999998 28.139999999999997 27.375 20.76 80-84 23.59 28.34 26.955000000000002 21.115000000000002 85-89 24.709999999999997 28.49 26.02 20.78 90-94 24.86 28.04 26.284999999999997 20.815 95-99 25.130000000000003 28.410000000000004 26.229999999999997 20.23 100-104 24.785 28.050000000000004 26.57 20.595 105-109 24.515 28.110000000000003 26.765 20.61 110-114 25.064999999999998 28.825 26.21 19.900000000000002 115-119 25.869999999999997 28.63 25.935000000000002 19.564999999999998 120-124 26.369999999999997 27.950000000000003 26.205000000000002 19.475 125-129 26.22 27.794999999999998 25.6 20.385 130-134 26.155 27.725 26.495 19.625 135-139 26.645000000000003 27.61 26.135 19.61 140-144 26.825 27.415 26.1 19.66 145-149 27.639999999999997 27.215 25.929999999999996 19.215 150-151 27.650000000000002 27.900000000000002 25.4375 19.0125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 3.5 24 4.5 25 4.0 26 2.5 27 2.0 28 5.0 29 6.5 30 8.0 31 17.5 32 28.0 33 36.5 34 43.0 35 50.0 36 90.5 37 114.5 38 130.5 39 154.0 40 174.0 41 226.5 42 272.5 43 283.0 44 263.0 45 276.0 46 286.0 47 249.5 48 207.5 49 190.0 50 172.5 51 141.0 52 117.0 53 94.5 54 82.5 55 60.5 56 48.5 57 43.5 58 27.0 59 19.5 60 14.0 61 8.5 62 6.0 63 6.0 64 3.0 65 0.0 66 1.5 67 2.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 1.0 75 1.0 76 1.0 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 1.0 94 1.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.075 #Duplication Level Percentage of deduplicated Percentage of total 1 82.51599147121536 67.72500000000001 2 13.9201949436491 22.85 3 2.863234846177277 7.049999999999999 4 0.6091989034419738 2.0 5 0.09137983551629607 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAATGATAACTTGACCGTTACAATGCTCCAATTTCTGCTTTCCTAACAGC 5 0.125 No Hit CAGGCCTACACAGCCGAGGAGTTCGAGTTTTACCTCTCCGACTCAGGATC 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.2875 0.0 0.0 0.0 0.0 70-71 0.48750000000000004 0.0 0.0 0.0 0.0 72-73 0.625 0.0 0.0 0.0 0.0 74-75 0.7625 0.0 0.0 0.0 0.0 76-77 0.9875 0.0 0.0 0.0 0.0 78-79 1.1625 0.0 0.0 0.0 0.0 80-81 1.375 0.0 0.0 0.0 0.0 82-83 1.625 0.0 0.0 0.0 0.0 84-85 2.0625 0.0 0.0 0.0 0.0 86-87 2.7625 0.0 0.0 0.0 0.0 88-89 3.2 0.0 0.0 0.0 0.0 90-91 3.8125 0.0 0.0 0.0 0.0 92-93 4.4625 0.0 0.0 0.0 0.0 94-95 4.925000000000001 0.0 0.0 0.0 0.0 96-97 5.575 0.0 0.0 0.0 0.0 98-99 6.2375 0.0 0.0 0.0 0.0 100-101 6.8125 0.0 0.0 0.0 0.0 102-103 7.4125 0.0 0.0 0.0 0.0 104-105 8.274999999999999 0.0 0.0 0.0 0.0 106-107 9.1875 0.0 0.0 0.0 0.0 108-109 9.925 0.0 0.0 0.0 0.0 110-111 10.725 0.0 0.0 0.0 0.0 112-113 11.4875 0.0 0.0 0.0 0.0 114-115 12.5375 0.0 0.0 0.0 0.0 116-117 13.4875 0.0 0.0 0.0 0.0 118-119 14.4125 0.0 0.0 0.0 0.0 120-121 15.100000000000001 0.0 0.0 0.0 0.0 122-123 15.899999999999999 0.0 0.0 0.0 0.0 124-125 16.7375 0.0 0.0 0.0 0.0 126-127 17.875 0.0 0.0 0.0 0.0 128-129 18.925 0.0 0.0 0.0 0.0 130-131 19.675 0.0 0.0 0.0 0.0 132-133 20.5625 0.0 0.0 0.0 0.0 134-135 21.475 0.0 0.0 0.0 0.0 136-137 22.3625 0.0 0.0 0.0 0.0 138-139 23.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCCAG 10 0.006830828 145.0 5 AGCCCCA 10 0.006830828 145.0 4 GTTGAGA 10 0.006830828 145.0 1 CCCAGTT 10 0.006830828 145.0 7 TGATCTC 10 0.006830828 145.0 4 GATAACA 10 0.006830828 145.0 2 ATAACAG 10 0.006830828 145.0 3 TAACAGA 10 0.006830828 145.0 4 CCCCAGT 10 0.006830828 145.0 6 AGATAAC 10 0.006830828 145.0 1 >>END_MODULE Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412387 spots for SRR12670098.sra Written 412387 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra Read 412369 spots for SRR12670098.sra Written 412369 spots for SRR12670098.sra SRR ids: ['SRR12670098.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sbyvn3kl SRR12670098.sra spots: 8247398 blocks: [[1, 412369], [412370, 824738], [824739, 1237107], [1237108, 1649476], [1649477, 2061845], [2061846, 2474214], [2474215, 2886583], [2886584, 3298952], [3298953, 3711321], [3711322, 4123690], [4123691, 4536059], [4536060, 4948428], [4948429, 5360797], [5360798, 5773166], [5773167, 6185535], [6185536, 6597904], [6597905, 7010273], [7010274, 7422642], [7422643, 7835011], [7835012, 8247398]] SRR12670098 file size 2784549 SRR12670098 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670098 SRR12670098_1.fastq SRR12670098_2.fastq Input file: SRR12670098_1.fastq Paired file: SRR12670098_2.fastq trimmed: SRR12670098-trimmed-pair1.fastq, SRR12670098-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:27:51 2025 >> started Mon Feb 10 22:28:06 2025 >> done (14.599s) 8247398 read pairs processed; of these: 67 ( 0.00%) short read pairs filtered out after trimming by size control 3967 ( 0.05%) empty read pairs filtered out after trimming by size control 8243364 (99.95%) read pairs available; of these: 2297089 (27.87%) trimmed read pairs available after processing 5946275 (72.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 11 0.00% 20 8 0.00% 21 8 0.00% 22 13 0.00% 23 22 0.00% 24 36 0.00% 25 39 0.00% 26 55 0.00% 27 46 0.00% 28 79 0.00% 29 57 0.00% 30 65 0.00% 31 95 0.00% 32 71 0.00% 33 99 0.00% 34 100 0.00% 35 116 0.00% 36 106 0.00% 37 112 0.00% 38 124 0.00% 39 139 0.00% 40 172 0.00% 41 148 0.00% 42 188 0.00% 43 210 0.00% 44 210 0.00% 45 199 0.00% 46 245 0.00% 47 293 0.00% 48 338 0.00% 49 382 0.00% 50 455 0.01% 51 495 0.01% 52 547 0.01% 53 560 0.01% 54 605 0.01% 55 652 0.01% 56 746 0.01% 57 822 0.01% 58 969 0.01% 59 1086 0.01% 60 1388 0.02% 61 1555 0.02% 62 1707 0.02% 63 1858 0.02% 64 2091 0.03% 65 2191 0.03% 66 2385 0.03% 67 2779 0.03% 68 3008 0.04% 69 3294 0.04% 70 4003 0.05% 71 4446 0.05% 72 4948 0.06% 73 5700 0.07% 74 6030 0.07% 75 6582 0.08% 76 7271 0.09% 77 7767 0.09% 78 8285 0.10% 79 8935 0.11% 80 9901 0.12% 81 10619 0.13% 82 12134 0.15% 83 13098 0.16% 84 14039 0.17% 85 14972 0.18% 86 15877 0.19% 87 16195 0.20% 88 17021 0.21% 89 17541 0.21% 90 18771 0.23% 91 19485 0.24% 92 20509 0.25% 93 21746 0.26% 94 23023 0.28% 95 24607 0.30% 96 24873 0.30% 97 25876 0.31% 98 25697 0.31% 99 26317 0.32% 100 27131 0.33% 101 27123 0.33% 102 28240 0.34% 103 29589 0.36% 104 30002 0.36% 105 30820 0.37% 106 31910 0.39% 107 32024 0.39% 108 32213 0.39% 109 32236 0.39% 110 31939 0.39% 111 32408 0.39% 112 33004 0.40% 113 33517 0.41% 114 34680 0.42% 115 35108 0.43% 116 35626 0.43% 117 36297 0.44% 118 36706 0.45% 119 36355 0.44% 120 36200 0.44% 121 36375 0.44% 122 36770 0.45% 123 37020 0.45% 124 37004 0.45% 125 37615 0.46% 126 38393 0.47% 127 38347 0.47% 128 38374 0.47% 129 38529 0.47% 130 38394 0.47% 131 37725 0.46% 132 38066 0.46% 133 38146 0.46% 134 38162 0.46% 135 38462 0.47% 136 38747 0.47% 137 38552 0.47% 138 38049 0.46% 139 39328 0.48% 140 38371 0.47% 141 38103 0.46% 142 38132 0.46% 143 38317 0.46% 144 38605 0.47% 145 38358 0.47% 146 38539 0.47% 147 38689 0.47% 148 38834 0.47% 149 38042 0.46% 150 38660 0.47% 151 5946275 72.13% 8243364 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=23 prefix-density=0.45 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=167.80 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=14.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=22 prefix-density=0.64 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.12 sequence-density-rank=26 fanout-score=32.54 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=11.3 sequence=AAAGAAAAGAAAA SRR12670098 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:29:19 Started mapping on | Feb 10 22:29:19 Finished on | Feb 10 22:30:59 Mapping speed, Million of reads per hour | 296.76 Number of input reads | 8243364 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 7714225 Uniquely mapped reads % | 93.58% Average mapped length | 282.28 Number of splices: Total | 7439198 Number of splices: Annotated (sjdb) | 7286643 Number of splices: GT/AG | 7289155 Number of splices: GC/AG | 121143 Number of splices: AT/AC | 4196 Number of splices: Non-canonical | 24704 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 180777 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 51396 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.45% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 348362 348362 348362 N_multimapping 180777 180777 180777 N_noFeature 256888 7599241 307257 N_ambiguous 108915 415 44101 UnstrandedReadsAssigned:7348422 PositiveStrandReadsAssigned:114569 NegativeStrandReadsAssigned:7362867 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=133 echo kmer=129 SRR12670098 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670098-trimmed-pair1.fastq SRR12670098-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,243,364 reads, 7,394,662 reads pseudoaligned [quant] estimated average fragment length: 205.651 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR12670098.ke.tsv 34699 SRR12670098.se.tsv 87100 total ==> SRR12670098.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.35 253 18.4247 Potri.005G024800.1.v4.1 1035 830.349 179 28.4678 Potri.004G059700.1.v4.1 961 756.39 4 0.698353 Potri.007G009000.2.v4.1 1416 1211.35 0 0 Potri.003G141000.2.v4.1 2943 2738.35 283.402 13.667 Potri.016G087400.1.v4.1 270 109.829 261.222 314.09 Potri.015G069301.1.v4.1 564 365.955 0 0 Potri.010G195200.1.v4.1 1773 1568.35 65 5.47308 Potri.012G127500.1.v4.1 977 772.375 63 10.7714 ==> SRR12670098.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 71 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 115 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12670098 completed mapping pipeline successfully