Starting /dee2/code/volunteer_pipeline.sh SRR12670100 current disk space = 3057424424960 free memory = 1466666740 SRR12670100 SRAfilesize 115dd96d62c5734a7488be03edefe106 SRR12670100.sra SRR12670100.sra file validated SRR12670100 is paired end SRR12670100 is conventional basespace SRR12670100 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670100_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.602 37.0 37.0 37.0 37.0 37.0 2 36.54225 37.0 37.0 37.0 37.0 37.0 3 36.628 37.0 37.0 37.0 37.0 37.0 4 36.6545 37.0 37.0 37.0 37.0 37.0 5 36.7425 37.0 37.0 37.0 37.0 37.0 6 36.564 37.0 37.0 37.0 37.0 37.0 7 36.6305 37.0 37.0 37.0 37.0 37.0 8 36.6365 37.0 37.0 37.0 37.0 37.0 9 36.6 37.0 37.0 37.0 37.0 37.0 10-14 36.6024 37.0 37.0 37.0 37.0 37.0 15-19 36.589999999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5179 37.0 37.0 37.0 37.0 37.0 25-29 36.4774 37.0 37.0 37.0 37.0 37.0 30-34 36.5259 37.0 37.0 37.0 37.0 37.0 35-39 36.44879999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.4683 37.0 37.0 37.0 37.0 37.0 45-49 36.446799999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.3678 37.0 37.0 37.0 37.0 37.0 55-59 36.3563 37.0 37.0 37.0 37.0 37.0 60-64 36.338300000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3517 37.0 37.0 37.0 37.0 37.0 70-74 36.2601 37.0 37.0 37.0 37.0 37.0 75-79 36.2812 37.0 37.0 37.0 37.0 37.0 80-84 36.317899999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2721 37.0 37.0 37.0 37.0 37.0 90-94 36.2863 37.0 37.0 37.0 37.0 37.0 95-99 36.285000000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.2314 37.0 37.0 37.0 37.0 37.0 105-109 36.2553 37.0 37.0 37.0 37.0 37.0 110-114 36.1991 37.0 37.0 37.0 37.0 37.0 115-119 36.235 37.0 37.0 37.0 37.0 37.0 120-124 36.1109 37.0 37.0 37.0 37.0 37.0 125-129 35.987899999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.853899999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.6463 37.0 37.0 37.0 37.0 37.0 140-144 35.325 37.0 37.0 37.0 37.0 37.0 145-149 34.963499999999996 37.0 37.0 37.0 29.8 37.0 150-151 34.70325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 3.0 26 7.0 27 7.0 28 18.0 29 11.0 30 22.0 31 33.0 32 73.0 33 84.0 34 128.0 35 342.0 36 2841.0 37 428.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.925000000000004 11.799999999999999 5.8999999999999995 45.375 2 18.573216520650814 12.46558197747184 37.72215269086358 31.23904881101377 3 17.7 15.9 27.325 39.074999999999996 4 22.45 23.425 23.75 30.375000000000004 5 22.725 29.175 25.0 23.1 6 22.3 33.1 24.175 20.424999999999997 7 16.6 26.674999999999997 40.425 16.3 8 19.125 25.025 31.1 24.75 9 17.375 25.775 32.925 23.925 10-14 20.225 29.685 26.99 23.1 15-19 20.064999999999998 28.470000000000002 27.46 24.005000000000003 20-24 20.105 28.26 28.095 23.54 25-29 20.515 28.084999999999997 26.905 24.495 30-34 20.28 28.144999999999996 27.169999999999998 24.404999999999998 35-39 20.599999999999998 27.595 27.515 24.29 40-44 20.075000000000003 28.43 27.47 24.025 45-49 20.28 28.015 27.515 24.19 50-54 20.39 27.3 27.61 24.7 55-59 20.285 27.560000000000002 28.249999999999996 23.905 60-64 20.474999999999998 27.595 27.82 24.11 65-69 21.035 27.474999999999998 27.74 23.75 70-74 20.89 28.02 27.24 23.849999999999998 75-79 21.044999999999998 27.46 27.485 24.01 80-84 20.985 27.889999999999997 27.33 23.794999999999998 85-89 20.78 28.095 27.029999999999998 24.095 90-94 21.5 27.560000000000002 27.525 23.415 95-99 21.395 27.034999999999997 27.61 23.96 100-104 21.529999999999998 28.660000000000004 26.395000000000003 23.415 105-109 21.795 28.494999999999997 26.47 23.24 110-114 21.27 27.74 26.169999999999998 24.82 115-119 22.225 27.57 25.805 24.4 120-124 21.87 27.965 25.845000000000002 24.32 125-129 21.645 27.700000000000003 26.284999999999997 24.37 130-134 22.525000000000002 27.775 25.380000000000003 24.32 135-139 22.705000000000002 28.485 24.995 23.815 140-144 23.335 26.52 25.96 24.185000000000002 145-149 24.349999999999998 27.169999999999998 24.72 23.76 150-151 23.7 26.8125 25.162499999999998 24.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.5 23 3.0 24 1.5 25 0.5 26 0.5 27 3.5 28 6.5 29 8.5 30 13.0 31 15.5 32 21.0 33 28.0 34 37.5 35 52.0 36 67.0 37 90.5 38 118.5 39 143.0 40 160.5 41 178.0 42 217.5 43 252.5 44 248.0 45 264.0 46 284.0 47 291.5 48 285.0 49 229.0 50 201.0 51 182.0 52 135.5 53 115.0 54 94.5 55 66.0 56 50.5 57 33.5 58 23.0 59 18.0 60 14.0 61 10.5 62 9.5 63 6.0 64 2.0 65 2.0 66 0.0 67 1.5 68 2.0 69 1.5 70 2.0 71 2.0 72 1.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 82.3131344201784 66.9 2 13.81113503537373 22.45 3 2.829898492771455 6.9 4 0.7074746231928638 2.3 5 0.27683789603199016 1.125 6 0.030759766225776686 0.15 7 0.030759766225776686 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCACCCATTTTGAAACAAATGTTACAAACCATCTTGTGAACGAGAAAA 7 0.17500000000000002 No Hit CTTTCTCAAACTGCTTCAAGTCCCAAGTCCCTGAAATCCACCTGGGGTCC 6 0.15 No Hit CCTGTTTCTTCATTGGTGACTTTTTCCTCATTCTTCTTTTCCATCTTCAT 5 0.125 No Hit CTTGGGGTCAGAAGATGAGGCGGTTTGTAATTCAGCTGTTATCTGCTCCA 5 0.125 No Hit GTCGATTTTTTTCTTTAGCTTGTCTCTGGTCACTTTGCCAGCCTCCCAGC 5 0.125 No Hit GCAGTAAACTGGGTATCAAGAGACTTGGCTGCACCTAACCATGCAAACAC 5 0.125 No Hit GTGATGTTACGCCCATCAAGGTCTTGGCCGTTCATTCCATCAATCGCATC 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAACGTGGAATCTCGGTT 5 0.125 TruSeq Adapter, Index 1 (97% over 36bp) CGTTGTGAAACCAACAGTAACCTTGTTGCCCATTACCACCCTTCTATGCA 5 0.125 No Hit CCCTGCTGGCATTTCACTGCCCAGTTCGCGCTCTGCCTTCTCAATGCAAA 5 0.125 No Hit AAGGACTATATTTTATTTTGTCAGTGGACGTGGAAGCGCCAGAATCGCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.5875 0.0 0.0 0.0 0.0 82-83 0.95 0.0 0.0 0.0 0.0 84-85 1.2374999999999998 0.0 0.0 0.0 0.0 86-87 1.5875 0.0 0.0 0.0 0.0 88-89 1.85 0.0 0.0 0.0 0.0 90-91 2.0125 0.0 0.0 0.0 0.0 92-93 2.3499999999999996 0.0 0.0 0.0 0.0 94-95 3.0 0.0 0.0 0.0 0.0 96-97 3.5 0.0 0.0 0.0 0.0 98-99 4.1625 0.0 0.0 0.0 0.0 100-101 4.9875 0.0 0.0 0.0 0.0 102-103 5.625 0.0 0.0 0.0 0.0 104-105 6.362500000000001 0.0 0.0 0.0 0.0 106-107 7.1375 0.0 0.0 0.0 0.0 108-109 7.775 0.0 0.0 0.0 0.0 110-111 8.4125 0.0 0.0 0.0 0.0 112-113 9.1375 0.0 0.0 0.0 0.0 114-115 10.0625 0.0 0.0 0.0 0.0 116-117 10.9125 0.0 0.0 0.0 0.0 118-119 11.475 0.0 0.0 0.0 0.0 120-121 11.95 0.0 0.0 0.0 0.0 122-123 12.825 0.0 0.0 0.0 0.0 124-125 13.787500000000001 0.0 0.0 0.0 0.0 126-127 14.6375 0.0 0.0 0.0 0.0 128-129 15.35 0.0 0.0 0.0 0.0 130-131 16.1875 0.0 0.0 0.0 0.0 132-133 16.7375 0.0 0.0 0.0 0.0 134-135 17.675 0.0 0.0 0.0 0.0 136-137 18.4875 0.0 0.0 0.0 0.0 138-139 19.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670100 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670100_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.236 37.0 37.0 37.0 37.0 37.0 2 36.061 37.0 37.0 37.0 37.0 37.0 3 36.0075 37.0 37.0 37.0 37.0 37.0 4 36.1305 37.0 37.0 37.0 37.0 37.0 5 36.2945 37.0 37.0 37.0 37.0 37.0 6 36.2245 37.0 37.0 37.0 37.0 37.0 7 36.2495 37.0 37.0 37.0 37.0 37.0 8 36.315 37.0 37.0 37.0 37.0 37.0 9 36.1805 37.0 37.0 37.0 37.0 37.0 10-14 36.256499999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2192 37.0 37.0 37.0 37.0 37.0 20-24 36.214800000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.1201 37.0 37.0 37.0 37.0 37.0 30-34 36.0743 37.0 37.0 37.0 37.0 37.0 35-39 36.074400000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.0205 37.0 37.0 37.0 37.0 37.0 45-49 36.06570000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.03060000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.0144 37.0 37.0 37.0 37.0 37.0 60-64 36.0006 37.0 37.0 37.0 37.0 37.0 65-69 35.8964 37.0 37.0 37.0 37.0 37.0 70-74 35.9096 37.0 37.0 37.0 37.0 37.0 75-79 35.9002 37.0 37.0 37.0 37.0 37.0 80-84 35.9133 37.0 37.0 37.0 37.0 37.0 85-89 35.8857 37.0 37.0 37.0 37.0 37.0 90-94 35.86710000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.9028 37.0 37.0 37.0 37.0 37.0 100-104 35.8149 37.0 37.0 37.0 37.0 37.0 105-109 35.7661 37.0 37.0 37.0 37.0 37.0 110-114 35.7298 37.0 37.0 37.0 37.0 37.0 115-119 35.755100000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.57090000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.3963 37.0 37.0 37.0 37.0 37.0 130-134 35.1793 37.0 37.0 37.0 32.2 37.0 135-139 35.1921 37.0 37.0 37.0 34.6 37.0 140-144 34.8586 37.0 37.0 37.0 25.0 37.0 145-149 34.5338 37.0 37.0 37.0 25.0 37.0 150-151 34.3225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 5.0 15 2.0 16 0.0 17 1.0 18 1.0 19 1.0 20 1.0 21 1.0 22 5.0 23 4.0 24 2.0 25 7.0 26 9.0 27 12.0 28 10.0 29 20.0 30 31.0 31 38.0 32 61.0 33 144.0 34 236.0 35 632.0 36 2555.0 37 216.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.5 23.1 10.8 30.599999999999998 2 27.125 24.65 31.65 16.575 3 20.375 28.199999999999996 31.0 20.424999999999997 4 24.875 33.375 23.3 18.45 5 25.724999999999998 37.1 20.925 16.25 6 21.675 39.65 21.925 16.75 7 21.625 22.825 37.025000000000006 18.525 8 22.525000000000002 24.75 28.599999999999998 24.125 9 23.25 23.525 28.95 24.275 10-14 24.42 29.270000000000003 25.535000000000004 20.775 15-19 24.04 27.825 26.384999999999998 21.75 20-24 24.005000000000003 28.21 26.66 21.125 25-29 24.115000000000002 27.810000000000002 27.275 20.8 30-34 23.615 28.235 26.669999999999998 21.48 35-39 24.3 28.189999999999998 26.125 21.385 40-44 23.68 27.625 27.215 21.48 45-49 23.005 27.955000000000002 27.375 21.665 50-54 24.07 28.59 26.645000000000003 20.695 55-59 23.235 28.065 26.915 21.785 60-64 24.01 27.32 26.75 21.92 65-69 24.395 26.805 27.66 21.14 70-74 24.495 27.98 26.415 21.11 75-79 24.32 27.35 27.229999999999997 21.099999999999998 80-84 24.305 28.185 26.22 21.29 85-89 24.47 27.72 26.435 21.375 90-94 24.154999999999998 28.555000000000003 25.765 21.525 95-99 25.045 28.42 26.13 20.405 100-104 25.165 27.544999999999998 26.474999999999998 20.815 105-109 25.785000000000004 27.744999999999997 26.224999999999998 20.244999999999997 110-114 25.75 28.134999999999998 25.96 20.155 115-119 27.055 27.500000000000004 25.495 19.950000000000003 120-124 26.400000000000002 28.050000000000004 25.385 20.165 125-129 27.445000000000004 28.105000000000004 25.085 19.365 130-134 28.18 27.584999999999997 25.465 18.77 135-139 28.725 27.169999999999998 25.564999999999998 18.54 140-144 29.349999999999998 26.540000000000003 25.540000000000003 18.57 145-149 31.095 26.340000000000003 24.154999999999998 18.41 150-151 30.9875 26.650000000000002 24.962500000000002 17.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.0 23 1.0 24 0.0 25 0.0 26 1.5 27 2.5 28 5.0 29 6.5 30 10.0 31 11.0 32 12.5 33 17.5 34 24.0 35 43.0 36 65.5 37 83.0 38 98.0 39 129.5 40 178.5 41 203.5 42 233.5 43 274.5 44 284.5 45 291.5 46 312.0 47 291.0 48 243.5 49 205.5 50 179.5 51 172.5 52 147.5 53 107.5 54 78.0 55 63.0 56 54.5 57 42.0 58 30.0 59 21.5 60 12.5 61 9.0 62 8.0 63 5.5 64 3.0 65 3.0 66 1.5 67 0.5 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 1.5 78 1.0 79 0.5 80 0.5 81 1.0 82 1.0 83 0.0 84 1.0 85 1.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.5 91 1.5 92 1.5 93 1.0 94 0.5 95 0.0 96 0.0 97 1.5 98 3.0 99 2.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.825 #Duplication Level Percentage of deduplicated Percentage of total 1 82.85976168652613 67.80000000000001 2 13.32111212954476 21.8 3 3.0553009471432935 7.5 4 0.458295142071494 1.5 5 0.21387106630003055 0.8750000000000001 6 0.030553009471432937 0.15 7 0.030553009471432937 0.17500000000000002 8 0.030553009471432937 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 8 0.2 No Hit AGCTAGCAAGAAAGCTACCAACTGGTGATGTTAGTGCTTTGAAGACCGAT 7 0.17500000000000002 No Hit ACCAAAAAAAGAAGACAATCTCCATATCAATGTCTTTGTTCCCTCCGCCA 6 0.15 No Hit ATGTACGTGTTTAGAGCTATTGACAGGAAATCTTGAGAAGACGTGCATTC 5 0.125 No Hit CTTCCTCATGAGGTGGGCAAGTATTCAAAAGAATTTACTGTCCATCAATG 5 0.125 No Hit AATGATCAGAAAACCCCTGGGATATTGAGATAAAGTTATGGCTGTAAAAT 5 0.125 No Hit ATAAACGATCGTGAAACTGGAAGATCTCGCGGCTTTGGATTTGTTACCTT 5 0.125 No Hit TCAACCAAATCATCTTTCATTTCCCTCCTTGGAGTTGCCCCTCAAGATGA 5 0.125 No Hit TGTCTACAATCCTTTGGGGAAGTCTGGAGGAGCTCTCATTCAACAGTTTA 5 0.125 No Hit TCTCTATCCACCTCGGAGAGGCGAAGAAATGGGAAAGGACTACAACGAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.5875 0.0 0.0 0.0 0.0 82-83 0.95 0.0 0.0 0.0 0.0 84-85 1.2374999999999998 0.0 0.0 0.0 0.0 86-87 1.6124999999999998 0.0 0.0 0.0 0.0 88-89 1.875 0.0 0.0 0.0 0.0 90-91 2.0375 0.0 0.0 0.0 0.0 92-93 2.375 0.0 0.0 0.0 0.0 94-95 3.025 0.0 0.0 0.0 0.0 96-97 3.5250000000000004 0.0 0.0 0.0 0.0 98-99 4.199999999999999 0.0 0.0 0.0 0.0 100-101 5.0375 0.0 0.0 0.0 0.0 102-103 5.675 0.0 0.0 0.0 0.0 104-105 6.4125 0.0 0.0 0.0 0.0 106-107 7.1875 0.0 0.0 0.0 0.0 108-109 7.85 0.0 0.0 0.0 0.0 110-111 8.5 0.0 0.0 0.0 0.0 112-113 9.2375 0.0 0.0 0.0 0.0 114-115 10.2 0.0 0.0 0.0 0.0 116-117 11.075 0.0 0.0 0.0 0.0 118-119 11.662500000000001 0.0 0.0 0.0 0.0 120-121 12.162500000000001 0.0 0.0 0.0 0.0 122-123 13.075 0.0 0.0 0.0 0.0 124-125 14.037500000000001 0.0 0.0 0.0 0.0 126-127 14.9375 0.0 0.0 0.0 0.0 128-129 15.625 0.0 0.0 0.0 0.0 130-131 16.4625 0.0 0.0 0.0 0.0 132-133 17.0375 0.0 0.0 0.0 0.0 134-135 18.0 0.0 0.0 0.0 0.0 136-137 18.825 0.0 0.0 0.0 0.0 138-139 19.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGTGG 10 0.006830828 145.0 7 GGGGGGG 45 2.4877938E-5 32.22222 145 >>END_MODULE Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578197 spots for SRR12670100.sra Written 578197 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra Read 578195 spots for SRR12670100.sra Written 578195 spots for SRR12670100.sra SRR ids: ['SRR12670100.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oghp7a7g SRR12670100.sra spots: 11563902 blocks: [[1, 578195], [578196, 1156390], [1156391, 1734585], [1734586, 2312780], [2312781, 2890975], [2890976, 3469170], [3469171, 4047365], [4047366, 4625560], [4625561, 5203755], [5203756, 5781950], [5781951, 6360145], [6360146, 6938340], [6938341, 7516535], [7516536, 8094730], [8094731, 8672925], [8672926, 9251120], [9251121, 9829315], [9829316, 10407510], [10407511, 10985705], [10985706, 11563902]] SRR12670100 file size 3908219 SRR12670100 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670100 SRR12670100_1.fastq SRR12670100_2.fastq Input file: SRR12670100_1.fastq Paired file: SRR12670100_2.fastq trimmed: SRR12670100-trimmed-pair1.fastq, SRR12670100-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:31:25 2025 >> started Mon Feb 10 22:31:38 2025 >> done (13.425s) 11563902 read pairs processed; of these: 67 ( 0.00%) short read pairs filtered out after trimming by size control 16104 ( 0.14%) empty read pairs filtered out after trimming by size control 11547731 (99.86%) read pairs available; of these: 2859687 (24.76%) trimmed read pairs available after processing 8688044 (75.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 10 0.00% 21 16 0.00% 22 13 0.00% 23 16 0.00% 24 35 0.00% 25 37 0.00% 26 53 0.00% 27 61 0.00% 28 44 0.00% 29 51 0.00% 30 56 0.00% 31 92 0.00% 32 55 0.00% 33 93 0.00% 34 68 0.00% 35 91 0.00% 36 112 0.00% 37 113 0.00% 38 109 0.00% 39 122 0.00% 40 145 0.00% 41 163 0.00% 42 160 0.00% 43 167 0.00% 44 184 0.00% 45 181 0.00% 46 226 0.00% 47 266 0.00% 48 276 0.00% 49 352 0.00% 50 395 0.00% 51 479 0.00% 52 473 0.00% 53 540 0.00% 54 538 0.00% 55 572 0.00% 56 641 0.01% 57 685 0.01% 58 850 0.01% 59 956 0.01% 60 1134 0.01% 61 1232 0.01% 62 1422 0.01% 63 1613 0.01% 64 1770 0.02% 65 1919 0.02% 66 1981 0.02% 67 2150 0.02% 68 2470 0.02% 69 2781 0.02% 70 3161 0.03% 71 3779 0.03% 72 4325 0.04% 73 4675 0.04% 74 5261 0.05% 75 5614 0.05% 76 6289 0.05% 77 6777 0.06% 78 7129 0.06% 79 8015 0.07% 80 8591 0.07% 81 9788 0.08% 82 10812 0.09% 83 12184 0.11% 84 13357 0.12% 85 14296 0.12% 86 14931 0.13% 87 15725 0.14% 88 16421 0.14% 89 17128 0.15% 90 18678 0.16% 91 20087 0.17% 92 21555 0.19% 93 23137 0.20% 94 24611 0.21% 95 26250 0.23% 96 27409 0.24% 97 27809 0.24% 98 28506 0.25% 99 29958 0.26% 100 30537 0.26% 101 31335 0.27% 102 32875 0.28% 103 33953 0.29% 104 35408 0.31% 105 37027 0.32% 106 37990 0.33% 107 38595 0.33% 108 38546 0.33% 109 39656 0.34% 110 39510 0.34% 111 40173 0.35% 112 41458 0.36% 113 41649 0.36% 114 43362 0.38% 115 44417 0.38% 116 45685 0.40% 117 46470 0.40% 118 46501 0.40% 119 46869 0.41% 120 46840 0.41% 121 47010 0.41% 122 47276 0.41% 123 47800 0.41% 124 48512 0.42% 125 49061 0.42% 126 50694 0.44% 127 51205 0.44% 128 50475 0.44% 129 51254 0.44% 130 50986 0.44% 131 50709 0.44% 132 50560 0.44% 133 51391 0.45% 134 51745 0.45% 135 51776 0.45% 136 52430 0.45% 137 52781 0.46% 138 53414 0.46% 139 53945 0.47% 140 53507 0.46% 141 53462 0.46% 142 53660 0.46% 143 52902 0.46% 144 53698 0.47% 145 53690 0.46% 146 54214 0.47% 147 54037 0.47% 148 55214 0.48% 149 54392 0.47% 150 54796 0.47% 151 8688044 75.24% 11547731 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=23 prefix-density=0.59 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=75.78 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.1 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.63 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=43.79 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=1.8 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12670100 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:32:19 Started mapping on | Feb 10 22:32:20 Finished on | Feb 10 22:33:42 Mapping speed, Million of reads per hour | 506.97 Number of input reads | 11547731 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 10935649 Uniquely mapped reads % | 94.70% Average mapped length | 285.88 Number of splices: Total | 10753496 Number of splices: Annotated (sjdb) | 10556737 Number of splices: GT/AG | 10544859 Number of splices: GC/AG | 174740 Number of splices: AT/AC | 6597 Number of splices: Non-canonical | 27300 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 243867 % of reads mapped to multiple loci | 2.11% Number of reads mapped to too many loci | 12565 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 368215 368215 368215 N_multimapping 243867 243867 243867 N_noFeature 227136 10777882 280032 N_ambiguous 170887 483 65770 UnstrandedReadsAssigned:10537626 PositiveStrandReadsAssigned:157284 NegativeStrandReadsAssigned:10589847 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=140 echo kmer=135 SRR12670100 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670100-trimmed-pair1.fastq SRR12670100-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,547,731 reads, 10,611,782 reads pseudoaligned [quant] estimated average fragment length: 209.57 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR12670100.ke.tsv 34699 SRR12670100.se.tsv 87100 total ==> SRR12670100.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.43 391 19.1844 Potri.005G024800.1.v4.1 1035 826.43 153 16.4361 Potri.004G059700.1.v4.1 961 752.448 15 1.76982 Potri.007G009000.2.v4.1 1416 1207.43 0 0 Potri.003G141000.2.v4.1 2943 2734.43 393 12.7597 Potri.016G087400.1.v4.1 270 105.579 670 563.394 Potri.015G069301.1.v4.1 564 361.657 0 0 Potri.010G195200.1.v4.1 1773 1564.43 30 1.70247 Potri.012G127500.1.v4.1 977 768.443 90 10.3979 ==> SRR12670100.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 428 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 165 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12670100 completed mapping pipeline successfully