Starting /dee2/code/volunteer_pipeline.sh SRR12670104 current disk space = 3057665196032 free memory = 1473969512 SRR12670104 SRAfilesize fb49aabb2adc1c7b43ada2c0d9c3512b SRR12670104.sra SRR12670104.sra file validated SRR12670104 is paired end SRR12670104 is conventional basespace SRR12670104 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670104_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5055 37.0 37.0 37.0 37.0 37.0 2 36.31925 37.0 37.0 37.0 37.0 37.0 3 36.5075 37.0 37.0 37.0 37.0 37.0 4 36.55 37.0 37.0 37.0 37.0 37.0 5 36.606 37.0 37.0 37.0 37.0 37.0 6 36.614 37.0 37.0 37.0 37.0 37.0 7 36.4925 37.0 37.0 37.0 37.0 37.0 8 36.5595 37.0 37.0 37.0 37.0 37.0 9 36.5875 37.0 37.0 37.0 37.0 37.0 10-14 36.5911 37.0 37.0 37.0 37.0 37.0 15-19 36.533699999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5278 37.0 37.0 37.0 37.0 37.0 25-29 36.482099999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5127 37.0 37.0 37.0 37.0 37.0 35-39 36.468199999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.381 37.0 37.0 37.0 37.0 37.0 45-49 36.343500000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.3211 37.0 37.0 37.0 37.0 37.0 55-59 36.316500000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.33239999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.240300000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.25469999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.256299999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.2718 37.0 37.0 37.0 37.0 37.0 85-89 36.251799999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2282 37.0 37.0 37.0 37.0 37.0 95-99 36.1523 37.0 37.0 37.0 37.0 37.0 100-104 36.209500000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.150400000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.1023 37.0 37.0 37.0 37.0 37.0 115-119 36.0793 37.0 37.0 37.0 37.0 37.0 120-124 36.0122 37.0 37.0 37.0 37.0 37.0 125-129 35.818599999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.780499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.5507 37.0 37.0 37.0 37.0 37.0 140-144 35.242900000000006 37.0 37.0 37.0 32.2 37.0 145-149 35.1217 37.0 37.0 37.0 29.8 37.0 150-151 34.8725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 3.0 23 1.0 24 1.0 25 1.0 26 3.0 27 8.0 28 10.0 29 15.0 30 26.0 31 37.0 32 62.0 33 98.0 34 166.0 35 375.0 36 2831.0 37 361.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.875 11.225 8.3 42.6 2 20.460806411219636 13.573754069621838 35.386927122464314 30.57851239669421 3 18.675 15.875 27.075 38.375 4 23.025000000000002 24.425 23.75 28.799999999999997 5 24.4 30.925000000000004 24.25 20.424999999999997 6 20.549999999999997 35.275 22.8 21.375 7 15.925 26.075 41.525 16.475 8 17.424999999999997 26.950000000000003 31.474999999999998 24.15 9 18.075 23.525 35.55 22.85 10-14 19.89 29.37 27.575 23.165 15-19 19.755 28.144999999999996 28.1 24.0 20-24 21.154999999999998 27.279999999999998 27.575 23.990000000000002 25-29 19.935 28.365000000000002 27.62 24.08 30-34 20.615 28.189999999999998 27.215 23.98 35-39 20.16 27.900000000000002 28.475 23.465 40-44 20.674999999999997 28.754999999999995 26.705000000000002 23.865 45-49 20.41 27.88 27.315 24.395 50-54 20.47 28.849999999999998 27.35 23.330000000000002 55-59 20.445 28.050000000000004 28.000000000000004 23.505000000000003 60-64 21.025 28.095 27.365000000000002 23.515 65-69 20.825 27.73 27.605 23.84 70-74 20.385 28.27 27.975 23.369999999999997 75-79 20.855 28.38 27.345000000000002 23.419999999999998 80-84 21.175 28.04 27.334999999999997 23.45 85-89 21.09 28.08 27.689999999999998 23.14 90-94 21.075 27.639999999999997 27.62 23.665 95-99 20.36 28.499999999999996 27.47 23.669999999999998 100-104 21.555 27.99 26.765 23.69 105-109 22.06 27.965 26.6 23.375 110-114 22.040000000000003 28.355000000000004 25.895000000000003 23.71 115-119 22.24 28.1 25.814999999999998 23.845 120-124 21.595 27.565 26.69 24.15 125-129 21.45 27.810000000000002 25.935000000000002 24.805 130-134 22.215 27.939999999999998 25.174999999999997 24.67 135-139 21.5 28.249999999999996 26.545 23.705000000000002 140-144 22.335 26.810000000000002 26.035000000000004 24.82 145-149 21.545 26.650000000000002 26.884999999999998 24.92 150-151 22.0 25.974999999999998 26.875 25.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 2.5 24 1.5 25 1.5 26 2.5 27 3.5 28 4.0 29 8.0 30 15.0 31 20.5 32 26.5 33 28.5 34 44.0 35 71.5 36 88.0 37 101.0 38 118.0 39 145.5 40 185.0 41 221.0 42 234.5 43 235.0 44 265.5 45 281.0 46 261.5 47 262.5 48 227.5 49 202.5 50 174.5 51 154.0 52 146.5 53 98.5 54 78.5 55 69.0 56 62.0 57 44.5 58 24.5 59 24.5 60 22.5 61 14.0 62 7.0 63 3.5 64 2.5 65 3.0 66 3.0 67 2.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 83.02808302808303 68.0 2 13.217338217338218 21.65 3 2.625152625152625 6.45 4 0.9157509157509158 3.0 5 0.18315018315018314 0.75 6 0.030525030525030524 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGGCACAAAAAAAGGAAAGTGAGCAAATAAAACCTAATGTTAACTGAACA 6 0.15 No Hit CTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCT 5 0.125 No Hit AGCTATTTTATGTTGGAACTTACTTCTGGCTTTGTTTGGCTCGAATCTTT 5 0.125 No Hit TGCCAATGAAAGTGGATGCCATCTTAAGACCTCTAGGTGGGATGTCACAG 5 0.125 No Hit TGGAGAAAGAATTACATGCCTACTGATTCTCCAGCAGGTCCTGGCCGGGC 5 0.125 No Hit CCGGTATGGAACAACATCACTCAATCTTCATAGTTCACACACTCCTATAA 5 0.125 No Hit GTGGTCTTGACTTTTGTCATCATGTCAATGCTGTTGGTGATGCCTTGTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.30000000000000004 0.0 0.0 0.0 0.0 68-69 0.375 0.0 0.0 0.0 0.0 70-71 0.4375 0.0 0.0 0.0 0.0 72-73 0.6625 0.0 0.0 0.0 0.0 74-75 0.7875000000000001 0.0 0.0 0.0 0.0 76-77 0.8625 0.0 0.0 0.0 0.0 78-79 1.0875 0.0 0.0 0.0 0.0 80-81 1.35 0.0 0.0 0.0 0.0 82-83 1.7625 0.0 0.0 0.0 0.0 84-85 1.9874999999999998 0.0 0.0 0.0 0.0 86-87 2.3375 0.0 0.0 0.0 0.0 88-89 2.875 0.0 0.0 0.0 0.0 90-91 3.2375 0.0 0.0 0.0 0.0 92-93 3.8499999999999996 0.0 0.0 0.0 0.0 94-95 4.4 0.0 0.0 0.0 0.0 96-97 5.3125 0.0 0.0 0.0 0.0 98-99 6.125 0.0 0.0 0.0 0.0 100-101 6.9 0.0 0.0 0.0 0.0 102-103 7.862500000000001 0.0 0.0 0.0 0.0 104-105 8.7875 0.0 0.0 0.0 0.0 106-107 9.6625 0.0 0.0 0.0 0.0 108-109 10.587499999999999 0.0 0.0 0.0 0.0 110-111 11.6375 0.0 0.0 0.0 0.0 112-113 12.375 0.0 0.0 0.0 0.0 114-115 13.2875 0.0 0.0 0.0 0.0 116-117 14.1 0.0 0.0 0.0 0.0 118-119 14.8875 0.0 0.0 0.0 0.0 120-121 15.7875 0.0 0.0 0.0 0.0 122-123 16.475 0.0 0.0 0.0 0.0 124-125 17.4625 0.0 0.0 0.0 0.0 126-127 18.325 0.0 0.0 0.0 0.0 128-129 19.112499999999997 0.0 0.0 0.0 0.0 130-131 19.7 0.0 0.0 0.0 0.0 132-133 20.325000000000003 0.0 0.0 0.0 0.0 134-135 21.1 0.0 0.0 0.0 0.0 136-137 21.7875 0.0 0.0 0.0 0.0 138-139 22.512500000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAAATG 10 0.006830828 145.0 3 TAATTTA 10 0.006830828 145.0 8 GTGATCC 10 0.006830828 145.0 145 GGTAAAA 10 0.006830828 145.0 1 >>END_MODULE SRR12670104 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670104_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.721 37.0 37.0 37.0 37.0 37.0 2 35.2545 37.0 37.0 37.0 25.0 37.0 3 35.271 37.0 37.0 37.0 25.0 37.0 4 35.5465 37.0 37.0 37.0 37.0 37.0 5 35.623 37.0 37.0 37.0 37.0 37.0 6 35.6795 37.0 37.0 37.0 37.0 37.0 7 35.655 37.0 37.0 37.0 37.0 37.0 8 35.8375 37.0 37.0 37.0 37.0 37.0 9 35.78 37.0 37.0 37.0 37.0 37.0 10-14 35.7453 37.0 37.0 37.0 37.0 37.0 15-19 35.7625 37.0 37.0 37.0 37.0 37.0 20-24 35.732000000000006 37.0 37.0 37.0 37.0 37.0 25-29 35.733 37.0 37.0 37.0 37.0 37.0 30-34 35.6371 37.0 37.0 37.0 37.0 37.0 35-39 35.65560000000001 37.0 37.0 37.0 37.0 37.0 40-44 35.593399999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.6408 37.0 37.0 37.0 37.0 37.0 50-54 35.5591 37.0 37.0 37.0 37.0 37.0 55-59 35.534800000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.5585 37.0 37.0 37.0 37.0 37.0 65-69 35.4778 37.0 37.0 37.0 37.0 37.0 70-74 35.395799999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.3836 37.0 37.0 37.0 37.0 37.0 80-84 35.286500000000004 37.0 37.0 37.0 32.2 37.0 85-89 35.367200000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.300700000000006 37.0 37.0 37.0 34.6 37.0 95-99 35.251999999999995 37.0 37.0 37.0 29.8 37.0 100-104 35.2018 37.0 37.0 37.0 27.4 37.0 105-109 35.0577 37.0 37.0 37.0 25.0 37.0 110-114 35.0267 37.0 37.0 37.0 25.0 37.0 115-119 35.001999999999995 37.0 37.0 37.0 25.0 37.0 120-124 34.7697 37.0 37.0 37.0 25.0 37.0 125-129 34.612700000000004 37.0 37.0 37.0 25.0 37.0 130-134 34.3831 37.0 37.0 37.0 25.0 37.0 135-139 34.1494 37.0 37.0 37.0 25.0 37.0 140-144 33.7698 37.0 37.0 37.0 25.0 37.0 145-149 33.416399999999996 37.0 37.0 37.0 19.4 37.0 150-151 33.03425 37.0 37.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 2.0 16 1.0 17 0.0 18 4.0 19 2.0 20 7.0 21 8.0 22 9.0 23 8.0 24 10.0 25 11.0 26 16.0 27 27.0 28 29.0 29 28.0 30 50.0 31 86.0 32 124.0 33 212.0 34 411.0 35 925.0 36 1936.0 37 89.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.875 22.75 11.4 28.975 2 25.75 26.55 30.975 16.725 3 20.200000000000003 29.875 31.0 18.925 4 25.7 32.7 22.675 18.925 5 24.525 37.25 21.675 16.55 6 20.75 39.5 22.025 17.724999999999998 7 20.05 22.375 37.925 19.650000000000002 8 21.45 25.900000000000002 28.249999999999996 24.4 9 21.65 24.85 31.275 22.225 10-14 23.080000000000002 28.93 26.545 21.445 15-19 23.39 27.915 27.46 21.235 20-24 22.705000000000002 27.965 27.85 21.48 25-29 22.89 27.925 27.455000000000002 21.73 30-34 23.150000000000002 27.169999999999998 28.425 21.255 35-39 23.34 28.310000000000002 27.22 21.13 40-44 23.990000000000002 27.689999999999998 27.310000000000002 21.01 45-49 23.080000000000002 28.060000000000002 27.805000000000003 21.055 50-54 22.725 27.72 28.115000000000002 21.44 55-59 23.62 27.42 27.455000000000002 21.505 60-64 23.54 27.51 27.38 21.57 65-69 23.425 27.315 27.76 21.5 70-74 23.615 27.725 27.185 21.475 75-79 23.84 27.575 27.689999999999998 20.895 80-84 24.3 28.24 26.169999999999998 21.29 85-89 25.224999999999998 27.029999999999998 26.985 20.76 90-94 24.805 28.194999999999997 26.6 20.4 95-99 24.915000000000003 28.29 26.22 20.575 100-104 25.785000000000004 27.939999999999998 25.705 20.57 105-109 26.040000000000003 27.195000000000004 26.165 20.599999999999998 110-114 26.685 27.6 25.974999999999998 19.74 115-119 26.900000000000002 27.915 25.55 19.634999999999998 120-124 27.884999999999998 27.815 25.44 18.86 125-129 28.310000000000002 27.52 25.435000000000002 18.735 130-134 28.199999999999996 27.42 25.47 18.91 135-139 28.67 26.13 26.76 18.44 140-144 29.744999999999997 26.255 25.64 18.360000000000003 145-149 30.159999999999997 26.165 25.4 18.275 150-151 33.3125 24.775 24.337500000000002 17.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 0.5 23 2.0 24 2.5 25 1.5 26 2.0 27 2.0 28 5.0 29 8.0 30 11.5 31 18.5 32 23.5 33 28.0 34 42.5 35 65.0 36 86.5 37 97.0 38 134.5 39 169.0 40 181.5 41 212.5 42 239.5 43 264.0 44 268.5 45 264.5 46 258.5 47 244.5 48 231.0 49 204.0 50 166.0 51 138.5 52 128.0 53 110.5 54 92.0 55 78.5 56 59.0 57 41.5 58 26.5 59 15.5 60 12.5 61 10.0 62 6.5 63 5.5 64 5.5 65 3.5 66 2.0 67 1.0 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 1.5 75 1.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 1.0 83 1.5 84 1.0 85 0.5 86 1.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 1.0 97 1.5 98 0.5 99 1.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.45 #Duplication Level Percentage of deduplicated Percentage of total 1 84.35415403274712 69.55 2 11.946634323832626 19.7 3 2.607640994542147 6.45 4 0.7580351728320194 2.5 5 0.21224984839296543 0.8750000000000001 6 0.030321406913280776 0.15 7 0.0 0.0 8 0.030321406913280776 0.2 9 0.030321406913280776 0.22499999999999998 >10 0.030321406913280776 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 14 0.35000000000000003 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 8 0.2 No Hit AAAAATTTGTTTTGGTCCCTTATTATTATTATCTGACGCTGTTTTGTGGT 6 0.15 No Hit TTCTGCTACCATGAGTGGTGTCACATGCTGCCTTCGCTTCCCTGGACAGC 5 0.125 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit GAAGGAATTCACCATTGCAATGCTAGCAATTTCGGACTCCAAGGTTGCGT 5 0.125 No Hit GCCTCGAGACAGAAGTGGCTGTTTTGGAACAAAAGATTCGAGCCAAACAA 5 0.125 No Hit GCCAAACATGAGCATTGTGGTTAAAGCCCTCCAGCCCCTGCTAAATGCCC 5 0.125 No Hit CCTGGTGCTAGAAAGGTTGCTAGTGCCTGTGGTGTTCCCTACCCTAGTTG 5 0.125 No Hit GCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.30000000000000004 0.0 0.0 0.0 0.0 68-69 0.375 0.0 0.0 0.0 0.0 70-71 0.4375 0.0 0.0 0.0 0.0 72-73 0.6625 0.0 0.0 0.0 0.0 74-75 0.7875000000000001 0.0 0.0 0.0 0.0 76-77 0.8625 0.0 0.0 0.0 0.0 78-79 1.0875 0.0 0.0 0.0 0.0 80-81 1.35 0.0 0.0 0.0 0.0 82-83 1.7625 0.0 0.0 0.0 0.0 84-85 1.9874999999999998 0.0 0.0 0.0 0.0 86-87 2.3375 0.0 0.0 0.0 0.0 88-89 2.8875 0.0 0.0 0.0 0.0 90-91 3.2625 0.0 0.0 0.0 0.0 92-93 3.8499999999999996 0.0 0.0 0.0 0.0 94-95 4.4 0.0 0.0 0.0 0.0 96-97 5.300000000000001 0.0 0.0 0.0 0.0 98-99 6.15 0.0 0.0 0.0 0.0 100-101 6.925000000000001 0.0 0.0 0.0 0.0 102-103 7.887499999999999 0.0 0.0 0.0 0.0 104-105 8.8375 0.0 0.0 0.0 0.0 106-107 9.7 0.0 0.0 0.0 0.0 108-109 10.6375 0.0 0.0 0.0 0.0 110-111 11.6625 0.0 0.0 0.0 0.0 112-113 12.4 0.0 0.0 0.0 0.0 114-115 13.325 0.0 0.0 0.0 0.0 116-117 14.125 0.0 0.0 0.0 0.0 118-119 14.875 0.0 0.0 0.0 0.0 120-121 15.774999999999999 0.0 0.0 0.0 0.0 122-123 16.4625 0.0 0.0 0.0 0.0 124-125 17.425 0.0 0.0 0.0 0.0 126-127 18.3 0.0 0.0 0.0 0.0 128-129 19.1 0.0 0.0 0.0 0.0 130-131 19.7 0.0 0.0 0.0 0.0 132-133 20.325000000000003 0.0 0.0 0.0 0.0 134-135 21.075 0.0 0.0 0.0 0.0 136-137 21.762500000000003 0.0 0.0 0.0 0.0 138-139 22.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATCT 10 0.006830828 145.0 1 GGTAGTA 10 0.006830828 145.0 145 CATGTAC 10 0.006830828 145.0 1 AAGCAAC 10 0.006830828 145.0 3 GGGGGGG 120 2.6557245E-10 16.916668 140-144 >>END_MODULE Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra Read 738375 spots for SRR12670104.sra Written 738375 spots for SRR12670104.sra Read 738369 spots for SRR12670104.sra Written 738369 spots for SRR12670104.sra SRR ids: ['SRR12670104.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pa8x5p9o SRR12670104.sra spots: 14767386 blocks: [[1, 738369], [738370, 1476738], [1476739, 2215107], [2215108, 2953476], [2953477, 3691845], [3691846, 4430214], [4430215, 5168583], [5168584, 5906952], [5906953, 6645321], [6645322, 7383690], [7383691, 8122059], [8122060, 8860428], [8860429, 9598797], [9598798, 10337166], [10337167, 11075535], [11075536, 11813904], [11813905, 12552273], [12552274, 13290642], [13290643, 14029011], [14029012, 14767386]] SRR12670104 file size 4996903 SRR12670104 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670104 SRR12670104_1.fastq SRR12670104_2.fastq Input file: SRR12670104_1.fastq Paired file: SRR12670104_2.fastq trimmed: SRR12670104-trimmed-pair1.fastq, SRR12670104-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:26:45 2025 >> started Mon Feb 10 23:27:01 2025 >> done (16.094s) 14767386 read pairs processed; of these: 77 ( 0.00%) short read pairs filtered out after trimming by size control 27974 ( 0.19%) empty read pairs filtered out after trimming by size control 14739335 (99.81%) read pairs available; of these: 3942227 (26.75%) trimmed read pairs available after processing 10797108 (73.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 5 0.00% 21 6 0.00% 22 12 0.00% 23 24 0.00% 24 15 0.00% 25 22 0.00% 26 43 0.00% 27 47 0.00% 28 51 0.00% 29 54 0.00% 30 81 0.00% 31 97 0.00% 32 81 0.00% 33 90 0.00% 34 105 0.00% 35 112 0.00% 36 110 0.00% 37 153 0.00% 38 202 0.00% 39 214 0.00% 40 279 0.00% 41 289 0.00% 42 346 0.00% 43 283 0.00% 44 339 0.00% 45 314 0.00% 46 359 0.00% 47 443 0.00% 48 499 0.00% 49 727 0.00% 50 806 0.01% 51 913 0.01% 52 943 0.01% 53 1063 0.01% 54 1057 0.01% 55 1207 0.01% 56 1325 0.01% 57 1510 0.01% 58 1764 0.01% 59 2124 0.01% 60 2497 0.02% 61 2793 0.02% 62 3151 0.02% 63 3377 0.02% 64 3726 0.03% 65 3801 0.03% 66 4265 0.03% 67 4671 0.03% 68 5232 0.04% 69 6071 0.04% 70 6999 0.05% 71 7676 0.05% 72 8865 0.06% 73 9686 0.07% 74 10525 0.07% 75 11677 0.08% 76 12558 0.09% 77 13158 0.09% 78 14315 0.10% 79 15447 0.10% 80 17071 0.12% 81 19280 0.13% 82 20920 0.14% 83 22748 0.15% 84 24856 0.17% 85 26261 0.18% 86 27636 0.19% 87 28219 0.19% 88 29671 0.20% 89 31362 0.21% 90 33746 0.23% 91 35352 0.24% 92 36508 0.25% 93 39709 0.27% 94 42100 0.29% 95 43523 0.30% 96 44935 0.30% 97 46108 0.31% 98 46221 0.31% 99 46910 0.32% 100 48409 0.33% 101 48322 0.33% 102 50898 0.35% 103 52341 0.36% 104 53491 0.36% 105 55149 0.37% 106 56516 0.38% 107 55807 0.38% 108 56332 0.38% 109 56112 0.38% 110 56193 0.38% 111 57447 0.39% 112 59019 0.40% 113 59225 0.40% 114 60932 0.41% 115 61903 0.42% 116 62356 0.42% 117 62480 0.42% 118 63382 0.43% 119 62124 0.42% 120 62987 0.43% 121 62931 0.43% 122 63276 0.43% 123 64206 0.44% 124 64075 0.43% 125 63750 0.43% 126 65346 0.44% 127 64353 0.44% 128 64201 0.44% 129 63172 0.43% 130 63774 0.43% 131 62601 0.42% 132 63247 0.43% 133 63216 0.43% 134 62467 0.42% 135 64111 0.43% 136 63559 0.43% 137 64071 0.43% 138 63312 0.43% 139 64304 0.44% 140 63145 0.43% 141 63215 0.43% 142 62859 0.43% 143 62772 0.43% 144 63884 0.43% 145 63412 0.43% 146 64438 0.44% 147 64114 0.43% 148 64699 0.44% 149 62561 0.42% 150 63978 0.43% 151 10797108 73.25% 14739335 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.35 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=122.07 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=3.8 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=6.29 fanout-score-rank=5 prefix-density=1.94 prefix-fanout=1.7 sequence=CACCTGCGACACCTGCGACTGCG criterion=fanout-score sequence-density=0.23 sequence-density-rank=10 fanout-score=9.84 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=5.6 sequence=AAGAAAGCTTACCCTAAC SRR12670104 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:27:47 Started mapping on | Feb 10 23:27:47 Finished on | Feb 10 23:29:50 Mapping speed, Million of reads per hour | 431.40 Number of input reads | 14739335 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 13595088 Uniquely mapped reads % | 92.24% Average mapped length | 282.61 Number of splices: Total | 12964428 Number of splices: Annotated (sjdb) | 12662659 Number of splices: GT/AG | 12698564 Number of splices: GC/AG | 203360 Number of splices: AT/AC | 8137 Number of splices: Non-canonical | 54367 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 443968 % of reads mapped to multiple loci | 3.01% Number of reads mapped to too many loci | 62144 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.16% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 700279 700279 700279 N_multimapping 443968 443968 443968 N_noFeature 470163 13348433 560711 N_ambiguous 246360 763 89808 UnstrandedReadsAssigned:12878565 PositiveStrandReadsAssigned:245892 NegativeStrandReadsAssigned:12944569 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=135 echo kmer=131 SRR12670104 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670104-trimmed-pair1.fastq SRR12670104-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,739,335 reads, 13,063,991 reads pseudoaligned [quant] estimated average fragment length: 208.375 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR12670104.ke.tsv 34699 SRR12670104.se.tsv 87100 total ==> SRR12670104.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.62 756 27.8743 Potri.005G024800.1.v4.1 1035 827.625 351 28.3128 Potri.004G059700.1.v4.1 961 753.634 5 0.442914 Potri.007G009000.2.v4.1 1416 1208.62 0 0 Potri.003G141000.2.v4.1 2943 2735.62 600 14.6421 Potri.016G087400.1.v4.1 270 110.059 601 364.551 Potri.015G069301.1.v4.1 564 362.07 0 0 Potri.010G195200.1.v4.1 1773 1565.62 197 8.40018 Potri.012G127500.1.v4.1 977 769.625 148 12.8379 ==> SRR12670104.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 211 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 242 Potri.001G212900.v4.1 316 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12670104 completed mapping pipeline successfully