Starting /dee2/code/volunteer_pipeline.sh SRR12670106 current disk space = 3057645707264 free memory = 1460996152 SRR12670106 SRAfilesize c763f8d6b19a7afeb137d2f83b13b9c0 SRR12670106.sra SRR12670106.sra file validated SRR12670106 is paired end SRR12670106 is conventional basespace SRR12670106 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670106_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.595 37.0 37.0 37.0 37.0 37.0 2 36.495 37.0 37.0 37.0 37.0 37.0 3 36.555 37.0 37.0 37.0 37.0 37.0 4 36.5745 37.0 37.0 37.0 37.0 37.0 5 36.602 37.0 37.0 37.0 37.0 37.0 6 36.6115 37.0 37.0 37.0 37.0 37.0 7 36.5865 37.0 37.0 37.0 37.0 37.0 8 36.602 37.0 37.0 37.0 37.0 37.0 9 36.575 37.0 37.0 37.0 37.0 37.0 10-14 36.592200000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5478 37.0 37.0 37.0 37.0 37.0 20-24 36.4927 37.0 37.0 37.0 37.0 37.0 25-29 36.458099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4475 37.0 37.0 37.0 37.0 37.0 35-39 36.42280000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.3417 37.0 37.0 37.0 37.0 37.0 45-49 36.307599999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.2866 37.0 37.0 37.0 37.0 37.0 55-59 36.2039 37.0 37.0 37.0 37.0 37.0 60-64 36.2165 37.0 37.0 37.0 37.0 37.0 65-69 36.1507 37.0 37.0 37.0 37.0 37.0 70-74 36.1748 37.0 37.0 37.0 37.0 37.0 75-79 36.20970000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.217099999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.175 37.0 37.0 37.0 37.0 37.0 90-94 36.2131 37.0 37.0 37.0 37.0 37.0 95-99 36.138999999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1375 37.0 37.0 37.0 37.0 37.0 105-109 36.0827 37.0 37.0 37.0 37.0 37.0 110-114 35.978699999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.9387 37.0 37.0 37.0 37.0 37.0 120-124 35.7504 37.0 37.0 37.0 37.0 37.0 125-129 35.592200000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.2802 37.0 37.0 37.0 37.0 37.0 135-139 34.965 37.0 37.0 37.0 25.0 37.0 140-144 34.600100000000005 37.0 37.0 37.0 25.0 37.0 145-149 34.225199999999994 37.0 37.0 37.0 25.0 37.0 150-151 33.932249999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 3.0 21 1.0 22 2.0 23 1.0 24 1.0 25 5.0 26 9.0 27 6.0 28 21.0 29 28.0 30 26.0 31 40.0 32 65.0 33 172.0 34 212.0 35 378.0 36 2697.0 37 333.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.025 11.5 10.525 43.95 2 18.593593593593592 14.514514514514515 35.66066066066066 31.23123123123123 3 18.95 18.4 25.75 36.9 4 20.875 25.174999999999997 24.25 29.7 5 22.375 31.35 24.375 21.9 6 21.0 34.0 25.7 19.3 7 14.799999999999999 25.974999999999998 41.275 17.95 8 19.125 25.025 30.825000000000003 25.025 9 17.549999999999997 25.55 34.375 22.525000000000002 10-14 20.1 29.404999999999998 27.05 23.445 15-19 20.565 28.025 27.634999999999998 23.775 20-24 19.994999999999997 27.97 28.075 23.96 25-29 20.34 28.144999999999996 27.575 23.94 30-34 20.435 28.215 27.095000000000002 24.255 35-39 20.625 27.985 28.105000000000004 23.285 40-44 20.055 28.155 27.944999999999997 23.845 45-49 20.695 27.595 27.515 24.195 50-54 19.825 28.249999999999996 27.815 24.11 55-59 20.22 28.54 27.639999999999997 23.599999999999998 60-64 20.69 27.889999999999997 27.51 23.91 65-69 20.095 27.97 28.22 23.715 70-74 20.965 28.565 27.52 22.95 75-79 21.145 27.27 28.055000000000003 23.53 80-84 21.105 28.485 26.640000000000004 23.77 85-89 21.61 28.58 26.950000000000003 22.86 90-94 22.3 28.660000000000004 26.505000000000003 22.535 95-99 21.759999999999998 28.444999999999997 26.105 23.69 100-104 21.9 29.049999999999997 25.505 23.544999999999998 105-109 21.965 29.099999999999998 25.424999999999997 23.51 110-114 21.560000000000002 28.625 25.555 24.26 115-119 21.755 28.465 24.935 24.845 120-124 21.485000000000003 28.244999999999997 25.174999999999997 25.095 125-129 21.705 28.165000000000003 25.055 25.074999999999996 130-134 21.705 27.634999999999998 25.21 25.45 135-139 21.67 27.975 25.105 25.25 140-144 21.965 27.125 25.655 25.255 145-149 22.975 26.0 25.765 25.259999999999998 150-151 23.2875 25.7375 25.025 25.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 2.0 20 1.5 21 2.0 22 3.0 23 1.5 24 1.0 25 3.0 26 3.0 27 3.5 28 8.0 29 7.5 30 10.5 31 17.5 32 28.0 33 34.5 34 43.5 35 66.0 36 88.0 37 114.5 38 123.0 39 148.5 40 181.5 41 199.5 42 225.5 43 244.5 44 257.0 45 258.0 46 252.0 47 259.5 48 244.0 49 207.0 50 196.0 51 176.5 52 137.0 53 97.5 54 72.0 55 61.5 56 49.0 57 40.5 58 31.0 59 19.0 60 19.0 61 16.0 62 10.0 63 5.0 64 3.5 65 4.5 66 4.5 67 5.5 68 2.5 69 1.0 70 2.0 71 1.5 72 1.5 73 1.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.7 #Duplication Level Percentage of deduplicated Percentage of total 1 81.19578686493185 65.525 2 14.838909541511772 23.95 3 3.1598513011152414 7.6499999999999995 4 0.5885997521685253 1.9 5 0.15489467162329618 0.625 6 0.030978934324659233 0.15 7 0.0 0.0 8 0.030978934324659233 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGCTCAATCTCGTAT 8 0.2 TruSeq Adapter, Index 5 (97% over 37bp) CCGTAATATCACCATCATAGGTGACCTTCACCACCTGTCCCCTCTCGAGG 6 0.15 No Hit CTTCCACCAAGTGCAACGGCCATTTGATTCTCCAGGTAGCTTCTACTGTA 5 0.125 No Hit CCACAATGAGAAATCAATTCCTTTGCTTTTCAGTTTCTCAGTTGCGGGTG 5 0.125 No Hit ACCAAGTTAACGATGAGGAGAGTTGTTGGCGGGATAAGTAGAGTTGTCCA 5 0.125 No Hit CTGGTGTAAGATGATCATCATACTTTGCAGTCTGTAAATTACATTGGAGA 5 0.125 No Hit TGGAGCAATCATAATAGGCATTGATATTTTGAAGCCCAAAACAGTGGTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.07500000000000001 0.0 0.0 0.0 0.0 44-45 0.1125 0.0 0.0 0.0 0.0 46-47 0.1375 0.0 0.0 0.0 0.0 48-49 0.16249999999999998 0.0 0.0 0.0 0.0 50-51 0.2 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.2375 0.0 0.0 0.0 0.0 56-57 0.275 0.0 0.0 0.0 0.0 58-59 0.3125 0.0 0.0 0.0 0.0 60-61 0.44999999999999996 0.0 0.0 0.0 0.0 62-63 0.5375 0.0 0.0 0.0 0.0 64-65 0.675 0.0 0.0 0.0 0.0 66-67 0.825 0.0 0.0 0.0 0.0 68-69 1.0 0.0 0.0 0.0 0.0 70-71 1.2 0.0 0.0 0.0 0.0 72-73 1.5875 0.0 0.0 0.0 0.0 74-75 1.9 0.0 0.0 0.0 0.0 76-77 2.2375 0.0 0.0 0.0 0.0 78-79 2.75 0.0 0.0 0.0 0.0 80-81 3.2 0.0 0.0 0.0 0.0 82-83 3.75 0.0 0.0 0.0 0.0 84-85 4.45 0.0 0.0 0.0 0.0 86-87 5.4 0.0 0.0 0.0 0.0 88-89 6.1875 0.0 0.0 0.0 0.0 90-91 7.0 0.0 0.0 0.0 0.0 92-93 7.7875000000000005 0.0 0.0 0.0 0.0 94-95 8.9625 0.0 0.0 0.0 0.0 96-97 9.875 0.0 0.0 0.0 0.0 98-99 10.95 0.0 0.0 0.0 0.0 100-101 12.1125 0.0 0.0 0.0 0.0 102-103 13.575 0.0 0.0 0.0 0.0 104-105 14.9 0.0 0.0 0.0 0.0 106-107 15.9375 0.0 0.0 0.0 0.0 108-109 17.2875 0.0 0.0 0.0 0.0 110-111 18.125 0.0 0.0 0.0 0.0 112-113 19.2875 0.0 0.0 0.0 0.0 114-115 20.475 0.0 0.0 0.0 0.0 116-117 21.4625 0.0 0.0 0.0 0.0 118-119 22.5125 0.0 0.0 0.0 0.0 120-121 23.1625 0.0 0.0 0.0 0.0 122-123 24.1625 0.0 0.0 0.0 0.0 124-125 25.275 0.0 0.0 0.0 0.0 126-127 26.262500000000003 0.0 0.0 0.0 0.0 128-129 27.299999999999997 0.0 0.0 0.0 0.0 130-131 28.2625 0.0 0.0 0.0 0.0 132-133 29.4625 0.0 0.0 0.0 0.0 134-135 30.45 0.0 0.0 0.0 0.0 136-137 31.475 0.0 0.0 0.0 0.0 138-139 32.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCATA 10 0.006830828 145.0 7 GGGGGGG 40 0.0076550315 18.125 140-144 CAATCTC 60 0.004491891 14.500001 140-144 AATCTCG 65 0.0076375785 13.384615 140-144 CAGCTCA 95 0.007278115 10.684211 135-139 >>END_MODULE SRR12670106 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670106_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2945 37.0 37.0 37.0 37.0 37.0 2 36.283 37.0 37.0 37.0 37.0 37.0 3 36.1885 37.0 37.0 37.0 37.0 37.0 4 36.245 37.0 37.0 37.0 37.0 37.0 5 36.341 37.0 37.0 37.0 37.0 37.0 6 36.26 37.0 37.0 37.0 37.0 37.0 7 36.1125 37.0 37.0 37.0 37.0 37.0 8 36.323 37.0 37.0 37.0 37.0 37.0 9 36.241 37.0 37.0 37.0 37.0 37.0 10-14 36.2529 37.0 37.0 37.0 37.0 37.0 15-19 36.2642 37.0 37.0 37.0 37.0 37.0 20-24 36.2315 37.0 37.0 37.0 37.0 37.0 25-29 36.1666 37.0 37.0 37.0 37.0 37.0 30-34 36.1049 37.0 37.0 37.0 37.0 37.0 35-39 36.07039999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.0746 37.0 37.0 37.0 37.0 37.0 45-49 35.971199999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.97619999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.987399999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.9852 37.0 37.0 37.0 37.0 37.0 65-69 35.949799999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.910000000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.9188 37.0 37.0 37.0 37.0 37.0 80-84 35.9154 37.0 37.0 37.0 37.0 37.0 85-89 35.885000000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.870200000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.8351 37.0 37.0 37.0 37.0 37.0 100-104 35.7029 37.0 37.0 37.0 37.0 37.0 105-109 35.6553 37.0 37.0 37.0 37.0 37.0 110-114 35.5988 37.0 37.0 37.0 37.0 37.0 115-119 35.54 37.0 37.0 37.0 37.0 37.0 120-124 35.316700000000004 37.0 37.0 37.0 34.6 37.0 125-129 35.1053 37.0 37.0 37.0 29.8 37.0 130-134 34.782799999999995 37.0 37.0 37.0 25.0 37.0 135-139 34.619299999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.2447 37.0 37.0 37.0 25.0 37.0 145-149 33.7524 37.0 37.0 37.0 22.2 37.0 150-151 33.286500000000004 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 4.0 14 7.0 15 2.0 16 0.0 17 3.0 18 2.0 19 4.0 20 2.0 21 1.0 22 1.0 23 10.0 24 10.0 25 7.0 26 15.0 27 18.0 28 15.0 29 14.0 30 36.0 31 40.0 32 98.0 33 143.0 34 247.0 35 601.0 36 2458.0 37 260.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.025 20.125 15.425 28.425 2 30.275000000000002 26.650000000000002 27.975 15.1 3 22.5 27.250000000000004 30.45 19.8 4 25.05 33.7 23.275000000000002 17.974999999999998 5 24.65 34.4 23.75 17.2 6 22.175 38.475 22.7 16.650000000000002 7 19.575 20.275000000000002 39.375 20.775 8 23.200000000000003 25.174999999999997 26.724999999999998 24.9 9 22.275 25.674999999999997 28.9 23.150000000000002 10-14 23.57 29.445 25.77 21.215 15-19 23.97 28.110000000000003 27.52 20.4 20-24 23.22 28.83 26.924999999999997 21.025 25-29 22.975 28.970000000000002 26.86 21.195 30-34 22.965 28.345 28.050000000000004 20.64 35-39 23.365 28.24 27.785 20.61 40-44 23.735 28.189999999999998 27.834999999999997 20.24 45-49 23.669999999999998 28.29 27.195000000000004 20.845 50-54 23.215 28.48 27.58 20.724999999999998 55-59 23.665 28.075 27.88 20.380000000000003 60-64 24.085 28.075 27.084999999999997 20.755000000000003 65-69 23.355 27.735 28.189999999999998 20.72 70-74 24.495 27.200000000000003 27.334999999999997 20.97 75-79 24.015 27.88 27.165 20.94 80-84 24.415 28.875 25.94 20.77 85-89 25.25 28.395 25.83 20.525 90-94 25.71 28.275 26.13 19.885 95-99 26.005 28.410000000000004 25.814999999999998 19.77 100-104 26.179999999999996 28.910000000000004 25.729999999999997 19.18 105-109 26.415 28.794999999999998 25.365 19.425 110-114 27.334999999999997 28.194999999999997 25.56 18.91 115-119 27.955000000000002 28.02 25.230000000000004 18.795 120-124 28.055000000000003 28.32 25.240000000000002 18.385 125-129 28.610000000000003 28.22 24.39 18.78 130-134 28.999999999999996 27.875 25.330000000000002 17.794999999999998 135-139 29.875 26.650000000000002 24.935 18.54 140-144 29.935000000000002 27.05 24.85 18.165 145-149 31.75 26.240000000000002 24.224999999999998 17.785 150-151 33.050000000000004 24.4375 25.137500000000003 17.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.5 9 1.0 10 0.0 11 0.5 12 1.0 13 1.5 14 1.5 15 1.0 16 1.0 17 0.5 18 2.0 19 3.0 20 2.5 21 2.5 22 1.0 23 1.0 24 2.5 25 2.5 26 2.5 27 4.0 28 5.0 29 7.0 30 10.0 31 20.5 32 28.5 33 34.5 34 46.0 35 52.5 36 79.0 37 103.5 38 122.0 39 156.0 40 185.5 41 221.5 42 247.0 43 268.0 44 274.0 45 269.5 46 269.5 47 251.0 48 232.0 49 208.5 50 170.0 51 135.5 52 115.0 53 92.5 54 73.0 55 63.5 56 55.0 57 38.5 58 29.0 59 25.5 60 16.0 61 10.0 62 7.5 63 5.5 64 3.5 65 2.5 66 1.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.5 84 1.0 85 1.0 86 0.5 87 0.0 88 0.5 89 0.5 90 1.0 91 1.5 92 0.5 93 0.0 94 1.0 95 2.0 96 2.0 97 1.0 98 2.0 99 2.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.125 #Duplication Level Percentage of deduplicated Percentage of total 1 82.06471494607088 66.57499999999999 2 14.11402157164869 22.900000000000002 3 3.050847457627119 7.425 4 0.43143297380585516 1.4000000000000001 5 0.21571648690292758 0.8750000000000001 6 0.030816640986132512 0.15 7 0.0 0.0 8 0.030816640986132512 0.2 9 0.030816640986132512 0.22499999999999998 >10 0.030816640986132512 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 10 0.25 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit CATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 8 0.2 No Hit CAGGTGCTAAGTGAGCAGGCAAAACAAAGGCTCTTGAAGAAGTACAGTAT 6 0.15 No Hit GGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit CACCAACTTCACTGTTACGTCCAAGGCATCAGACGAGGACGGTGGTTTTG 5 0.125 No Hit TGGTGGTCTAACATTTTTTGCTCCAAGTGAGGAAAGGCTCGAGTCTGGAT 5 0.125 No Hit GGGGTGATGAGCGAACAACACTAGCTAGCTGAGTGCAGCATTGTGAGGAT 5 0.125 No Hit AGTCTATTCACTCTGAAAATAAATAGATCAAATGTTCTATATTCATATTA 5 0.125 No Hit GGAAACTCCAAACCAATCGATGTTTCAAAGCCTAACCCTAACGGTATTGA 5 0.125 No Hit TGTGTTTTAAGGTGGAATTCGCTGAACTTTTGACTTGAGAAATGCAAGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.07500000000000001 0.0 0.0 0.0 0.0 44-45 0.1125 0.0 0.0 0.0 0.0 46-47 0.1375 0.0 0.0 0.0 0.0 48-49 0.16249999999999998 0.0 0.0 0.0 0.0 50-51 0.2 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.2375 0.0 0.0 0.0 0.0 56-57 0.275 0.0 0.0 0.0 0.0 58-59 0.3125 0.0 0.0 0.0 0.0 60-61 0.44999999999999996 0.0 0.0 0.0 0.0 62-63 0.5375 0.0 0.0 0.0 0.0 64-65 0.675 0.0 0.0 0.0 0.0 66-67 0.7749999999999999 0.0 0.0 0.0 0.0 68-69 0.975 0.0 0.0 0.0 0.0 70-71 1.175 0.0 0.0 0.0 0.0 72-73 1.5625 0.0 0.0 0.0 0.0 74-75 1.875 0.0 0.0 0.0 0.0 76-77 2.2125000000000004 0.0 0.0 0.0 0.0 78-79 2.725 0.0 0.0 0.0 0.0 80-81 3.175 0.0 0.0 0.0 0.0 82-83 3.75 0.0 0.0 0.0 0.0 84-85 4.5375 0.0 0.0 0.0 0.0 86-87 5.5 0.0 0.0 0.0 0.0 88-89 6.2875 0.0 0.0 0.0 0.0 90-91 7.1 0.0 0.0 0.0 0.0 92-93 7.8875 0.0 0.0 0.0 0.0 94-95 9.0875 0.0 0.0 0.0 0.0 96-97 10.0 0.0 0.0 0.0 0.0 98-99 11.1 0.0 0.0 0.0 0.0 100-101 12.275 0.0 0.0 0.0 0.0 102-103 13.8 0.0 0.0 0.0 0.0 104-105 15.15 0.0 0.0 0.0 0.0 106-107 16.2125 0.0 0.0 0.0 0.0 108-109 17.55 0.0 0.0 0.0 0.0 110-111 18.375 0.0 0.0 0.0 0.0 112-113 19.5375 0.0 0.0 0.0 0.0 114-115 20.75 0.0 0.0 0.0 0.0 116-117 21.737499999999997 0.0 0.0 0.0 0.0 118-119 22.7625 0.0 0.0 0.0 0.0 120-121 23.4125 0.0 0.0 0.0 0.0 122-123 24.4125 0.0 0.0 0.0 0.0 124-125 25.5375 0.0 0.0 0.0 0.0 126-127 26.512500000000003 0.0 0.0 0.0 0.0 128-129 27.55 0.0 0.0 0.0 0.0 130-131 28.575 0.0 0.0 0.0 0.0 132-133 29.799999999999997 0.0 0.0 0.0 0.0 134-135 30.8 0.0 0.0 0.0 0.0 136-137 31.825 0.0 0.0 0.0 0.0 138-139 32.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGTAG 75 0.0012377208 13.533334 140-144 TGTACAG 110 0.0017637183 10.545455 130-134 >>END_MODULE Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640819 spots for SRR12670106.sra Written 640819 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra Read 640800 spots for SRR12670106.sra Written 640800 spots for SRR12670106.sra SRR ids: ['SRR12670106.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mxhea7l5 SRR12670106.sra spots: 12816019 blocks: [[1, 640800], [640801, 1281600], [1281601, 1922400], [1922401, 2563200], [2563201, 3204000], [3204001, 3844800], [3844801, 4485600], [4485601, 5126400], [5126401, 5767200], [5767201, 6408000], [6408001, 7048800], [7048801, 7689600], [7689601, 8330400], [8330401, 8971200], [8971201, 9612000], [9612001, 10252800], [10252801, 10893600], [10893601, 11534400], [11534401, 12175200], [12175201, 12816019]] SRR12670106 file size 4333743 SRR12670106 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670106 SRR12670106_1.fastq SRR12670106_2.fastq Input file: SRR12670106_1.fastq Paired file: SRR12670106_2.fastq trimmed: SRR12670106-trimmed-pair1.fastq, SRR12670106-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:09:44 2025 >> started Mon Feb 10 23:09:59 2025 >> done (14.766s) 12816019 read pairs processed; of these: 267 ( 0.00%) short read pairs filtered out after trimming by size control 48713 ( 0.38%) empty read pairs filtered out after trimming by size control 12767039 (99.62%) read pairs available; of these: 4576574 (35.85%) trimmed read pairs available after processing 8190465 (64.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 13 0.00% 21 8 0.00% 22 12 0.00% 23 25 0.00% 24 29 0.00% 25 23 0.00% 26 39 0.00% 27 32 0.00% 28 50 0.00% 29 72 0.00% 30 99 0.00% 31 114 0.00% 32 148 0.00% 33 202 0.00% 34 175 0.00% 35 204 0.00% 36 278 0.00% 37 299 0.00% 38 369 0.00% 39 448 0.00% 40 565 0.00% 41 600 0.00% 42 691 0.01% 43 628 0.00% 44 673 0.01% 45 735 0.01% 46 914 0.01% 47 1037 0.01% 48 1321 0.01% 49 1585 0.01% 50 1860 0.01% 51 2167 0.02% 52 2463 0.02% 53 2438 0.02% 54 2560 0.02% 55 2754 0.02% 56 3155 0.02% 57 3478 0.03% 58 4171 0.03% 59 4848 0.04% 60 5678 0.04% 61 6655 0.05% 62 7435 0.06% 63 8099 0.06% 64 8585 0.07% 65 8935 0.07% 66 9292 0.07% 67 10233 0.08% 68 11436 0.09% 69 13071 0.10% 70 14880 0.12% 71 16992 0.13% 72 19361 0.15% 73 21177 0.17% 74 22797 0.18% 75 23751 0.19% 76 24789 0.19% 77 25644 0.20% 78 26856 0.21% 79 29956 0.23% 80 32102 0.25% 81 35538 0.28% 82 39018 0.31% 83 42213 0.33% 84 44714 0.35% 85 46660 0.37% 86 47169 0.37% 87 47169 0.37% 88 49072 0.38% 89 50060 0.39% 90 52291 0.41% 91 56151 0.44% 92 58016 0.45% 93 60860 0.48% 94 63664 0.50% 95 65974 0.52% 96 64597 0.51% 97 64853 0.51% 98 64322 0.50% 99 63655 0.50% 100 65334 0.51% 101 66066 0.52% 102 67496 0.53% 103 69824 0.55% 104 71264 0.56% 105 71425 0.56% 106 71389 0.56% 107 70347 0.55% 108 68143 0.53% 109 67881 0.53% 110 66437 0.52% 111 66566 0.52% 112 67589 0.53% 113 68218 0.53% 114 69601 0.55% 115 69676 0.55% 116 70231 0.55% 117 67583 0.53% 118 67233 0.53% 119 65147 0.51% 120 64024 0.50% 121 64202 0.50% 122 63673 0.50% 123 64295 0.50% 124 65364 0.51% 125 64786 0.51% 126 64779 0.51% 127 64076 0.50% 128 62372 0.49% 129 61094 0.48% 130 60297 0.47% 131 58744 0.46% 132 58430 0.46% 133 58835 0.46% 134 58448 0.46% 135 58928 0.46% 136 57952 0.45% 137 58065 0.45% 138 57354 0.45% 139 56628 0.44% 140 55107 0.43% 141 53833 0.42% 142 53759 0.42% 143 53264 0.42% 144 53401 0.42% 145 53258 0.42% 146 52731 0.41% 147 52326 0.41% 148 52626 0.41% 149 50886 0.40% 150 50575 0.40% 151 8190465 64.15% 12767039 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=25 prefix-density=0.44 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=33.94 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.3 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=23 prefix-density=0.71 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATTGTTATGTATTGGCCATGTCTGTGGCCTCTGGTGTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=21.04 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.3 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCT SRR12670106 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:10:38 Started mapping on | Feb 10 23:10:38 Finished on | Feb 10 23:12:09 Mapping speed, Million of reads per hour | 505.07 Number of input reads | 12767039 Average input read length | 273 UNIQUE READS: Uniquely mapped reads number | 11836898 Uniquely mapped reads % | 92.71% Average mapped length | 272.10 Number of splices: Total | 10847466 Number of splices: Annotated (sjdb) | 10599635 Number of splices: GT/AG | 10617060 Number of splices: GC/AG | 182217 Number of splices: AT/AC | 6361 Number of splices: Non-canonical | 41828 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 319279 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 29061 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.35% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 610862 610862 610862 N_multimapping 319279 319279 319279 N_noFeature 423867 11646471 511423 N_ambiguous 181236 712 77933 UnstrandedReadsAssigned:11231795 PositiveStrandReadsAssigned:189715 NegativeStrandReadsAssigned:11247542 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=116 echo kmer=111 SRR12670106 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670106-trimmed-pair1.fastq SRR12670106-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,767,039 reads, 11,310,333 reads pseudoaligned [quant] estimated average fragment length: 193.553 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR12670106.ke.tsv 34699 SRR12670106.se.tsv 87100 total ==> SRR12670106.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1825.45 570 28.1859 Potri.005G024800.1.v4.1 1035 842.447 318 34.073 Potri.004G059700.1.v4.1 961 768.529 8 0.939627 Potri.007G009000.2.v4.1 1416 1223.45 0 0 Potri.003G141000.2.v4.1 2943 2750.45 641.345 21.0482 Potri.016G087400.1.v4.1 270 125.197 773 557.331 Potri.015G069301.1.v4.1 564 380 0 0 Potri.010G195200.1.v4.1 1773 1580.45 92.9133 5.30669 Potri.012G127500.1.v4.1 977 784.496 180 20.7113 ==> SRR12670106.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 137 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 178 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12670106 completed mapping pipeline successfully