Starting /dee2/code/volunteer_pipeline.sh SRR12670111 current disk space = 3057637466112 free memory = 1162729328 SRR12670111 SRAfilesize a38ef309b1b7f4d8e4b39b0a6473a0fd SRR12670111.sra SRR12670111.sra file validated SRR12670111 is paired end SRR12670111 is conventional basespace SRR12670111 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670111_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6015 37.0 37.0 37.0 37.0 37.0 2 36.47925 37.0 37.0 37.0 37.0 37.0 3 36.6255 37.0 37.0 37.0 37.0 37.0 4 36.6605 37.0 37.0 37.0 37.0 37.0 5 36.69 37.0 37.0 37.0 37.0 37.0 6 36.7385 37.0 37.0 37.0 37.0 37.0 7 36.5975 37.0 37.0 37.0 37.0 37.0 8 36.6795 37.0 37.0 37.0 37.0 37.0 9 36.6135 37.0 37.0 37.0 37.0 37.0 10-14 36.650600000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.605 37.0 37.0 37.0 37.0 37.0 20-24 36.5668 37.0 37.0 37.0 37.0 37.0 25-29 36.599599999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.551700000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.5166 37.0 37.0 37.0 37.0 37.0 40-44 36.520599999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.468399999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.4464 37.0 37.0 37.0 37.0 37.0 55-59 36.4161 37.0 37.0 37.0 37.0 37.0 60-64 36.4101 37.0 37.0 37.0 37.0 37.0 65-69 36.3511 37.0 37.0 37.0 37.0 37.0 70-74 36.3714 37.0 37.0 37.0 37.0 37.0 75-79 36.3846 37.0 37.0 37.0 37.0 37.0 80-84 36.373000000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.306200000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.314 37.0 37.0 37.0 37.0 37.0 95-99 36.287099999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.292 37.0 37.0 37.0 37.0 37.0 105-109 36.2805 37.0 37.0 37.0 37.0 37.0 110-114 36.253600000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.2869 37.0 37.0 37.0 37.0 37.0 120-124 36.133199999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.085499999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.0569 37.0 37.0 37.0 37.0 37.0 135-139 35.9606 37.0 37.0 37.0 37.0 37.0 140-144 35.7485 37.0 37.0 37.0 37.0 37.0 145-149 35.6998 37.0 37.0 37.0 37.0 37.0 150-151 35.509249999999994 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 0.0 25 1.0 26 2.0 27 7.0 28 7.0 29 15.0 30 23.0 31 34.0 32 42.0 33 60.0 34 104.0 35 316.0 36 2945.0 37 442.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.225 11.375 8.450000000000001 39.95 2 19.218241042345277 12.12728639438737 36.20646454522676 32.44800801804059 3 18.125 16.950000000000003 29.925 35.0 4 21.925 24.4 25.25 28.425 5 24.099999999999998 30.0 23.375 22.525000000000002 6 22.15 32.9 25.25 19.7 7 15.375 26.174999999999997 42.15 16.3 8 18.025 24.85 32.5 24.625 9 17.8 24.025 34.375 23.799999999999997 10-14 20.62 28.52 27.474999999999998 23.385 15-19 19.715 27.500000000000004 28.395 24.39 20-24 20.395 27.72 27.72 24.165 25-29 20.880000000000003 27.725 27.694999999999997 23.7 30-34 20.685000000000002 27.63 27.63 24.055 35-39 20.59 28.249999999999996 27.52 23.64 40-44 20.575 28.544999999999998 27.400000000000002 23.48 45-49 20.294999999999998 28.055000000000003 27.29 24.36 50-54 20.849999999999998 28.33 26.795 24.025 55-59 20.580000000000002 27.765 27.785 23.87 60-64 20.91 28.449999999999996 27.345000000000002 23.294999999999998 65-69 20.52 27.82 27.52 24.14 70-74 21.310000000000002 27.560000000000002 27.37 23.76 75-79 21.14 28.305000000000003 27.284999999999997 23.27 80-84 20.86 27.985 27.235 23.919999999999998 85-89 21.595 28.375 27.065 22.965 90-94 21.02 27.939999999999998 27.295 23.745 95-99 21.05 28.655 26.505000000000003 23.79 100-104 21.67 28.199999999999996 26.75 23.380000000000003 105-109 21.37 28.425 26.88 23.325000000000003 110-114 21.125 28.57 25.805 24.5 115-119 21.865000000000002 27.805000000000003 26.41 23.919999999999998 120-124 21.285 28.139999999999997 27.11 23.465 125-129 21.44 27.685 25.845000000000002 25.03 130-134 21.365000000000002 28.294999999999998 26.16 24.18 135-139 21.875 27.555000000000003 26.265 24.305 140-144 21.55 26.950000000000003 26.790000000000003 24.709999999999997 145-149 22.52 26.095000000000002 26.884999999999998 24.5 150-151 23.3625 27.05 25.275 24.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 2.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 0.5 23 0.0 24 1.5 25 2.5 26 3.5 27 4.0 28 5.5 29 9.0 30 15.0 31 16.5 32 17.0 33 23.5 34 39.5 35 50.0 36 68.5 37 95.5 38 117.0 39 154.0 40 183.5 41 202.0 42 230.5 43 258.0 44 255.0 45 246.0 46 253.5 47 265.0 48 258.0 49 244.5 50 207.5 51 157.0 52 121.5 53 94.5 54 95.5 55 83.0 56 59.5 57 46.5 58 30.0 59 22.0 60 22.0 61 12.5 62 6.0 63 6.0 64 3.5 65 2.5 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.05 #Duplication Level Percentage of deduplicated Percentage of total 1 80.82448469706434 64.7 2 14.647095565271705 23.45 3 3.529044347282948 8.475000000000001 4 0.8119925046845722 2.6 5 0.1561524047470331 0.625 6 0.03123048094940662 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAGCATTCTTTATAAACTCTCCATAATCCAAAACTTCACCTTCAGTCCCG 6 0.15 No Hit CTCACTGCCACTTGGCACTAAACATAAGAAGACGACAAAACTAGATCTTG 5 0.125 No Hit CCTCAGAGTGTCCAAATCTTCAAGAATGTTGCTCTGTTTATTCGTAACAA 5 0.125 No Hit CCGTCTGATATCCTCTTCACAGCAGCATCAATGTCTTCTGCGAGCTTTTC 5 0.125 No Hit TGATAATTCTGTATAAGGTGATCGCAGGTTGTGCAATCATTGCTCAAAAG 5 0.125 No Hit GCTATTGCTTGGAAACTGGGTCAATGATCACCAGGTACGCTCTTAATGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.2625 0.0 0.0 0.0 0.0 66-67 0.3625 0.0 0.0 0.0 0.0 68-69 0.4125 0.0 0.0 0.0 0.0 70-71 0.475 0.0 0.0 0.0 0.0 72-73 0.55 0.0 0.0 0.0 0.0 74-75 0.6625 0.0 0.0 0.0 0.0 76-77 0.8875 0.0 0.0 0.0 0.0 78-79 1.0125 0.0 0.0 0.0 0.0 80-81 1.1875 0.0 0.0 0.0 0.0 82-83 1.4625 0.0 0.0 0.0 0.0 84-85 2.0875 0.0 0.0 0.0 0.0 86-87 2.5625 0.0 0.0 0.0 0.0 88-89 2.9625 0.0 0.0 0.0 0.0 90-91 3.5625 0.0 0.0 0.0 0.0 92-93 4.025 0.0 0.0 0.0 0.0 94-95 4.762499999999999 0.0 0.0 0.0 0.0 96-97 5.3375 0.0 0.0 0.0 0.0 98-99 6.075 0.0 0.0 0.0 0.0 100-101 6.9125 0.0 0.0 0.0 0.0 102-103 7.987500000000001 0.0 0.0 0.0 0.0 104-105 8.7875 0.0 0.0 0.0 0.0 106-107 9.3625 0.0 0.0 0.0 0.0 108-109 10.1125 0.0 0.0 0.0 0.0 110-111 10.8 0.0 0.0 0.0 0.0 112-113 11.525 0.0 0.0 0.0 0.0 114-115 12.6125 0.0 0.0 0.0 0.0 116-117 13.5625 0.0 0.0 0.0 0.0 118-119 14.45 0.0 0.0 0.0 0.0 120-121 15.4375 0.0 0.0 0.0 0.0 122-123 16.450000000000003 0.0 0.0 0.0 0.0 124-125 17.375 0.0 0.0 0.0 0.0 126-127 18.4 0.0 0.0 0.0 0.0 128-129 19.3125 0.0 0.0 0.0 0.0 130-131 20.0375 0.0 0.0 0.0 0.0 132-133 20.7875 0.0 0.0 0.0 0.0 134-135 21.6375 0.0 0.0 0.0 0.0 136-137 22.6375 0.0 0.0 0.0 0.0 138-139 23.825000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGAGGA 10 0.006830828 145.0 7 GTGAAAA 10 0.006830828 145.0 8 ATCTCGT 30 0.0014437955 24.166668 140-144 CCATCTC 40 2.9585467E-4 21.75 140-144 TCTCGTA 35 0.0035366106 20.714287 140-144 GATGTCC 50 0.0013298223 17.4 135-139 TCACTGA 65 0.0076375785 13.384615 130-134 >>END_MODULE SRR12670111 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670111_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.393 37.0 37.0 37.0 37.0 37.0 2 36.376 37.0 37.0 37.0 37.0 37.0 3 36.359 37.0 37.0 37.0 37.0 37.0 4 36.3365 37.0 37.0 37.0 37.0 37.0 5 36.3635 37.0 37.0 37.0 37.0 37.0 6 36.4735 37.0 37.0 37.0 37.0 37.0 7 36.4045 37.0 37.0 37.0 37.0 37.0 8 36.4315 37.0 37.0 37.0 37.0 37.0 9 36.384 37.0 37.0 37.0 37.0 37.0 10-14 36.3551 37.0 37.0 37.0 37.0 37.0 15-19 36.3611 37.0 37.0 37.0 37.0 37.0 20-24 36.2964 37.0 37.0 37.0 37.0 37.0 25-29 36.2752 37.0 37.0 37.0 37.0 37.0 30-34 36.2786 37.0 37.0 37.0 37.0 37.0 35-39 36.221199999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.1955 37.0 37.0 37.0 37.0 37.0 45-49 36.2143 37.0 37.0 37.0 37.0 37.0 50-54 36.1655 37.0 37.0 37.0 37.0 37.0 55-59 36.1654 37.0 37.0 37.0 37.0 37.0 60-64 36.180699999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.1605 37.0 37.0 37.0 37.0 37.0 70-74 36.0942 37.0 37.0 37.0 37.0 37.0 75-79 36.0731 37.0 37.0 37.0 37.0 37.0 80-84 36.072599999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.1121 37.0 37.0 37.0 37.0 37.0 90-94 36.0739 37.0 37.0 37.0 37.0 37.0 95-99 36.007600000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.901300000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.92529999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.7926 37.0 37.0 37.0 37.0 37.0 115-119 35.9037 37.0 37.0 37.0 37.0 37.0 120-124 35.717499999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.49249999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.3793 37.0 37.0 37.0 34.6 37.0 135-139 35.244099999999996 37.0 37.0 37.0 32.2 37.0 140-144 35.0299 37.0 37.0 37.0 27.4 37.0 145-149 34.7548 37.0 37.0 37.0 25.0 37.0 150-151 34.207499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 1.0 15 4.0 16 1.0 17 2.0 18 1.0 19 5.0 20 1.0 21 1.0 22 3.0 23 5.0 24 6.0 25 8.0 26 3.0 27 13.0 28 12.0 29 10.0 30 14.0 31 31.0 32 69.0 33 106.0 34 192.0 35 515.0 36 2680.0 37 313.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.0 22.925 10.625 25.45 2 26.650000000000002 26.525 31.175000000000004 15.65 3 21.7 27.800000000000004 30.375000000000004 20.125 4 24.4 35.25 21.4 18.95 5 24.925 36.55 21.625 16.900000000000002 6 21.475 37.425000000000004 22.8 18.3 7 21.0 21.5 38.2 19.3 8 21.625 25.6 27.400000000000002 25.374999999999996 9 22.400000000000002 23.474999999999998 30.2 23.925 10-14 23.7 28.660000000000004 26.3 21.34 15-19 23.18 28.384999999999998 27.37 21.065 20-24 22.825 27.939999999999998 27.42 21.815 25-29 23.11 28.29 27.35 21.25 30-34 22.259999999999998 28.310000000000002 27.665 21.765 35-39 22.88 27.715 27.584999999999997 21.82 40-44 22.425 28.560000000000002 28.105000000000004 20.91 45-49 23.325000000000003 27.275 28.37 21.029999999999998 50-54 23.57 27.41 27.975 21.044999999999998 55-59 23.395 26.875 27.955000000000002 21.775 60-64 23.215 28.084999999999997 27.71 20.990000000000002 65-69 22.925 27.295 27.67 22.11 70-74 23.025000000000002 27.405 27.49 22.08 75-79 23.724999999999998 27.839999999999996 26.584999999999997 21.85 80-84 23.43 28.375 27.235 20.96 85-89 23.810000000000002 27.1 27.389999999999997 21.7 90-94 23.535 28.884999999999998 26.534999999999997 21.044999999999998 95-99 24.529999999999998 27.985 26.72 20.765 100-104 25.490000000000002 28.38 26.105 20.025000000000002 105-109 25.045 27.794999999999998 26.645000000000003 20.515 110-114 26.3 27.96 26.26 19.48 115-119 26.115 27.805000000000003 26.305 19.775000000000002 120-124 26.44 27.79 26.93 18.84 125-129 26.91 27.77 26.13 19.189999999999998 130-134 27.565 26.895000000000003 26.75 18.790000000000003 135-139 28.095 27.16 26.115 18.63 140-144 27.589999999999996 26.674999999999997 26.56 19.175 145-149 29.14 27.150000000000002 26.0 17.71 150-151 29.575000000000003 26.3625 25.637500000000003 18.425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 1.5 14 2.0 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 2.5 27 5.5 28 6.5 29 9.0 30 14.0 31 21.5 32 25.5 33 27.5 34 37.0 35 49.0 36 69.5 37 91.5 38 127.5 39 164.0 40 186.5 41 208.0 42 256.0 43 281.0 44 259.0 45 237.5 46 239.5 47 259.5 48 241.5 49 214.5 50 195.5 51 169.5 52 130.5 53 107.5 54 98.5 55 77.0 56 52.5 57 34.5 58 29.5 59 22.5 60 10.5 61 3.0 62 3.5 63 4.5 64 2.5 65 2.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 1.0 72 1.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.35 #Duplication Level Percentage of deduplicated Percentage of total 1 81.3005600497822 65.325 2 14.46795270690728 23.25 3 2.9869321717485997 7.199999999999999 4 0.9956440572495333 3.2 5 0.21779713752333543 0.8750000000000001 6 0.031113876789047916 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGACTTTTATTATTGCTAATAATTGTCACCCTCAAACTATTGATATTTGT 6 0.15 No Hit CACAAGAAGGTCTGGATTGCTGCGGGTGATATAATTCTCGTTGGCCTCCG 5 0.125 No Hit CTGAGAATGTGCGTTATGTTTACCAGCCAATAGAGGCTATGTACTTGCTG 5 0.125 No Hit GTTCATCACTACAATGGAAATAATGTTGACTTGGGCACTGCCTGTGGAAA 5 0.125 No Hit GGCAGCCGGTGATTTGCAGCAGATCACGGGTCTGGCTAAGCAGATGGTAA 5 0.125 No Hit GAATTATGTCAATTAGGGAATTGGGCAAGTTTAGAAGAGAATTAGGTCTT 5 0.125 No Hit GTTGTCCGTATACCAAGACGTCTAAGGGCGGTGTACACCCTTTTGAGCAA 5 0.125 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.2625 0.0 0.0 0.0 0.0 66-67 0.3625 0.0 0.0 0.0 0.0 68-69 0.4125 0.0 0.0 0.0 0.0 70-71 0.475 0.0 0.0 0.0 0.0 72-73 0.55 0.0 0.0 0.0 0.0 74-75 0.6875 0.0 0.0 0.0 0.0 76-77 0.9125000000000001 0.0 0.0 0.0 0.0 78-79 1.0375 0.0 0.0 0.0 0.0 80-81 1.2125 0.0 0.0 0.0 0.0 82-83 1.5 0.0 0.0 0.0 0.0 84-85 2.1375 0.0 0.0 0.0 0.0 86-87 2.6125 0.0 0.0 0.0 0.0 88-89 3.0375 0.0 0.0 0.0 0.0 90-91 3.6624999999999996 0.0 0.0 0.0 0.0 92-93 4.125 0.0 0.0 0.0 0.0 94-95 4.8875 0.0 0.0 0.0 0.0 96-97 5.4625 0.0 0.0 0.0 0.0 98-99 6.1625 0.0 0.0 0.0 0.0 100-101 6.9875 0.0 0.0 0.0 0.0 102-103 8.0625 0.0 0.0 0.0 0.0 104-105 8.8375 0.0 0.0 0.0 0.0 106-107 9.4125 0.0 0.0 0.0 0.0 108-109 10.149999999999999 0.0 0.0 0.0 0.0 110-111 10.875 0.0 0.0 0.0 0.0 112-113 11.6125 0.0 0.0 0.0 0.0 114-115 12.7125 0.0 0.0 0.0 0.0 116-117 13.6625 0.0 0.0 0.0 0.0 118-119 14.55 0.0 0.0 0.0 0.0 120-121 15.55 0.0 0.0 0.0 0.0 122-123 16.549999999999997 0.0 0.0 0.0 0.0 124-125 17.5 0.0 0.0 0.0 0.0 126-127 18.549999999999997 0.0 0.0 0.0 0.0 128-129 19.450000000000003 0.0 0.0 0.0 0.0 130-131 20.1625 0.0 0.0 0.0 0.0 132-133 20.9125 0.0 0.0 0.0 0.0 134-135 21.7625 0.0 0.0 0.0 0.0 136-137 22.775 0.0 0.0 0.0 0.0 138-139 23.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTCCG 50 0.0013298223 17.4 135-139 >>END_MODULE Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521274 spots for SRR12670111.sra Written 521274 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra Read 521256 spots for SRR12670111.sra Written 521256 spots for SRR12670111.sra SRR ids: ['SRR12670111.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_px2fn2yg SRR12670111.sra spots: 10425138 blocks: [[1, 521256], [521257, 1042512], [1042513, 1563768], [1563769, 2085024], [2085025, 2606280], [2606281, 3127536], [3127537, 3648792], [3648793, 4170048], [4170049, 4691304], [4691305, 5212560], [5212561, 5733816], [5733817, 6255072], [6255073, 6776328], [6776329, 7297584], [7297585, 7818840], [7818841, 8340096], [8340097, 8861352], [8861353, 9382608], [9382609, 9903864], [9903865, 10425138]] SRR12670111 file size 3521217 SRR12670111 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670111 SRR12670111_1.fastq SRR12670111_2.fastq Input file: SRR12670111_1.fastq Paired file: SRR12670111_2.fastq trimmed: SRR12670111-trimmed-pair1.fastq, SRR12670111-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:31:26 2025 >> started Mon Feb 10 23:31:38 2025 >> done (11.593s) 10425138 read pairs processed; of these: 64 ( 0.00%) short read pairs filtered out after trimming by size control 9788 ( 0.09%) empty read pairs filtered out after trimming by size control 10415286 (99.91%) read pairs available; of these: 2930131 (28.13%) trimmed read pairs available after processing 7485155 (71.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 3 0.00% 21 19 0.00% 22 30 0.00% 23 18 0.00% 24 22 0.00% 25 37 0.00% 26 27 0.00% 27 29 0.00% 28 35 0.00% 29 44 0.00% 30 54 0.00% 31 70 0.00% 32 70 0.00% 33 80 0.00% 34 95 0.00% 35 107 0.00% 36 111 0.00% 37 111 0.00% 38 137 0.00% 39 164 0.00% 40 185 0.00% 41 190 0.00% 42 199 0.00% 43 208 0.00% 44 214 0.00% 45 240 0.00% 46 246 0.00% 47 291 0.00% 48 354 0.00% 49 459 0.00% 50 462 0.00% 51 559 0.01% 52 658 0.01% 53 660 0.01% 54 649 0.01% 55 787 0.01% 56 804 0.01% 57 907 0.01% 58 1103 0.01% 59 1314 0.01% 60 1628 0.02% 61 1768 0.02% 62 1950 0.02% 63 2205 0.02% 64 2322 0.02% 65 2488 0.02% 66 2668 0.03% 67 2884 0.03% 68 3341 0.03% 69 3791 0.04% 70 4392 0.04% 71 4881 0.05% 72 5705 0.05% 73 6432 0.06% 74 7175 0.07% 75 7635 0.07% 76 8121 0.08% 77 8681 0.08% 78 9299 0.09% 79 10614 0.10% 80 11390 0.11% 81 12926 0.12% 82 14292 0.14% 83 15747 0.15% 84 16768 0.16% 85 18354 0.18% 86 18979 0.18% 87 19865 0.19% 88 20915 0.20% 89 21670 0.21% 90 23359 0.22% 91 25375 0.24% 92 26521 0.25% 93 28988 0.28% 94 30331 0.29% 95 31849 0.31% 96 32863 0.32% 97 33660 0.32% 98 33233 0.32% 99 34328 0.33% 100 35797 0.34% 101 36871 0.35% 102 38065 0.37% 103 39502 0.38% 104 40471 0.39% 105 41828 0.40% 106 42652 0.41% 107 42264 0.41% 108 42665 0.41% 109 43329 0.42% 110 42440 0.41% 111 43668 0.42% 112 44734 0.43% 113 45436 0.44% 114 46198 0.44% 115 47428 0.46% 116 47507 0.46% 117 47635 0.46% 118 47561 0.46% 119 46862 0.45% 120 46944 0.45% 121 47315 0.45% 122 47619 0.46% 123 47890 0.46% 124 48347 0.46% 125 48359 0.46% 126 50098 0.48% 127 49068 0.47% 128 48346 0.46% 129 47973 0.46% 130 47668 0.46% 131 47611 0.46% 132 47215 0.45% 133 47911 0.46% 134 48663 0.47% 135 48646 0.47% 136 48672 0.47% 137 48408 0.46% 138 48353 0.46% 139 48321 0.46% 140 47601 0.46% 141 46847 0.45% 142 47262 0.45% 143 47929 0.46% 144 47613 0.46% 145 47755 0.46% 146 47680 0.46% 147 47755 0.46% 148 47975 0.46% 149 47044 0.45% 150 47181 0.45% 151 7485155 71.87% 10415286 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=0.45 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTGTA criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=115.77 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=12.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=26 prefix-density=0.71 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=33.50 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=1.8 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12670111 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:32:19 Started mapping on | Feb 10 23:32:19 Finished on | Feb 10 23:33:27 Mapping speed, Million of reads per hour | 551.40 Number of input reads | 10415286 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 9815896 Uniquely mapped reads % | 94.25% Average mapped length | 282.25 Number of splices: Total | 9435423 Number of splices: Annotated (sjdb) | 9237744 Number of splices: GT/AG | 9247557 Number of splices: GC/AG | 151783 Number of splices: AT/AC | 5662 Number of splices: Non-canonical | 30421 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 225616 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 21783 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.25% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 373774 373774 373774 N_multimapping 225616 225616 225616 N_noFeature 293674 9670413 349419 N_ambiguous 149006 487 59054 UnstrandedReadsAssigned:9373216 PositiveStrandReadsAssigned:144996 NegativeStrandReadsAssigned:9407423 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=132 echo kmer=127 SRR12670111 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670111-trimmed-pair1.fastq SRR12670111-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,415,286 reads, 9,412,162 reads pseudoaligned [quant] estimated average fragment length: 207.942 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR12670111.ke.tsv 34699 SRR12670111.se.tsv 87100 total ==> SRR12670111.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1811.06 334 19.0404 Potri.005G024800.1.v4.1 1035 828.058 162 20.1983 Potri.004G059700.1.v4.1 961 754.116 0 0 Potri.007G009000.2.v4.1 1416 1209.06 0 0 Potri.003G141000.2.v4.1 2943 2736.06 436.131 16.4571 Potri.016G087400.1.v4.1 270 110.862 420 391.137 Potri.015G069301.1.v4.1 564 365.267 0 0 Potri.010G195200.1.v4.1 1773 1566.06 24 1.58221 Potri.012G127500.1.v4.1 977 770.085 61 8.17811 ==> SRR12670111.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 141 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 148 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12670111 completed mapping pipeline successfully