Starting /dee2/code/volunteer_pipeline.sh SRR12670112 current disk space = 3057637470208 free memory = 1466193864 SRR12670112 SRAfilesize ab0b279282838f863d3224f6f0aebb01 SRR12670112.sra SRR12670112.sra file validated SRR12670112 is paired end SRR12670112 is conventional basespace SRR12670112 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670112_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.665 37.0 37.0 37.0 37.0 37.0 2 36.49875 37.0 37.0 37.0 37.0 37.0 3 36.6025 37.0 37.0 37.0 37.0 37.0 4 36.6575 37.0 37.0 37.0 37.0 37.0 5 36.6715 37.0 37.0 37.0 37.0 37.0 6 36.677 37.0 37.0 37.0 37.0 37.0 7 36.674 37.0 37.0 37.0 37.0 37.0 8 36.6295 37.0 37.0 37.0 37.0 37.0 9 36.636 37.0 37.0 37.0 37.0 37.0 10-14 36.63590000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.5864 37.0 37.0 37.0 37.0 37.0 20-24 36.58990000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.5262 37.0 37.0 37.0 37.0 37.0 30-34 36.5407 37.0 37.0 37.0 37.0 37.0 35-39 36.5421 37.0 37.0 37.0 37.0 37.0 40-44 36.5405 37.0 37.0 37.0 37.0 37.0 45-49 36.499399999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.4832 37.0 37.0 37.0 37.0 37.0 55-59 36.439499999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.444199999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.3974 37.0 37.0 37.0 37.0 37.0 70-74 36.393299999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.4079 37.0 37.0 37.0 37.0 37.0 80-84 36.41420000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.392399999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.366499999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.3438 37.0 37.0 37.0 37.0 37.0 100-104 36.3118 37.0 37.0 37.0 37.0 37.0 105-109 36.3198 37.0 37.0 37.0 37.0 37.0 110-114 36.2274 37.0 37.0 37.0 37.0 37.0 115-119 36.2336 37.0 37.0 37.0 37.0 37.0 120-124 36.1419 37.0 37.0 37.0 37.0 37.0 125-129 36.1043 37.0 37.0 37.0 37.0 37.0 130-134 36.031099999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.9463 37.0 37.0 37.0 37.0 37.0 140-144 35.729499999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.6084 37.0 37.0 37.0 37.0 37.0 150-151 35.5195 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 3.0 26 4.0 27 5.0 28 9.0 29 15.0 30 15.0 31 26.0 32 33.0 33 83.0 34 109.0 35 277.0 36 2985.0 37 432.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.525 11.15 6.075 47.25 2 17.91530944625407 13.029315960912053 40.415935855675265 28.639438737158606 3 16.45 17.45 27.35 38.75 4 21.725 24.3 22.575 31.4 5 22.375 30.775000000000002 23.549999999999997 23.3 6 20.075000000000003 33.125 24.25 22.55 7 15.65 28.549999999999997 38.625 17.175 8 17.0 26.25 32.550000000000004 24.2 9 17.125 23.175 35.449999999999996 24.25 10-14 19.585 29.720000000000002 27.865000000000002 22.830000000000002 15-19 20.080000000000002 27.425 28.244999999999997 24.25 20-24 19.55 28.28 28.199999999999996 23.97 25-29 20.31 28.415000000000003 27.125 24.15 30-34 20.845 28.285 27.46 23.41 35-39 20.235 28.415000000000003 27.68 23.669999999999998 40-44 19.965 28.265 27.555000000000003 24.215 45-49 20.16 28.565 27.29 23.985 50-54 20.165 28.115000000000002 28.1 23.62 55-59 20.775 28.285 27.134999999999998 23.805 60-64 19.765 28.685 27.54 24.01 65-69 20.51 28.4 27.334999999999997 23.755000000000003 70-74 20.349999999999998 28.299999999999997 28.17 23.18 75-79 20.419999999999998 27.905 27.925 23.75 80-84 19.994999999999997 29.304999999999996 26.735 23.965 85-89 20.835 27.99 27.105 24.07 90-94 20.815 28.07 27.05 24.065 95-99 21.07 27.965 27.47 23.494999999999997 100-104 21.04 28.389999999999997 27.155 23.415 105-109 20.875 27.825 27.295 24.005000000000003 110-114 20.65 28.76 26.33 24.26 115-119 21.025 28.575 26.334999999999997 24.065 120-124 21.09 28.560000000000002 26.35 24.0 125-129 21.125 28.515 26.325 24.035 130-134 21.365000000000002 28.335 25.835 24.465 135-139 21.875 28.18 25.88 24.065 140-144 21.65 28.560000000000002 26.31 23.48 145-149 21.66 27.805000000000003 25.615 24.92 150-151 22.275 26.4125 26.3125 25.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.5 24 2.5 25 2.0 26 1.5 27 4.0 28 6.0 29 7.0 30 9.0 31 19.0 32 27.0 33 33.5 34 48.0 35 70.0 36 92.5 37 114.0 38 131.0 39 146.0 40 171.0 41 199.0 42 250.5 43 287.5 44 274.5 45 249.5 46 237.0 47 247.5 48 239.0 49 208.0 50 187.0 51 161.5 52 125.0 53 90.5 54 82.0 55 71.0 56 57.5 57 50.5 58 32.0 59 21.0 60 14.0 61 10.5 62 8.0 63 4.5 64 3.0 65 0.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.075 #Duplication Level Percentage of deduplicated Percentage of total 1 83.27749010051781 68.35 2 12.701797136765153 20.849999999999998 3 3.228754188242461 7.95 4 0.6396588486140725 2.1 5 0.03045994517209869 0.125 6 0.09137983551629607 0.44999999999999996 7 0.03045994517209869 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 7 0.17500000000000002 No Hit GCGCACACAATGTTCTCTACTTGGGGGATCAATTCTGGTAAGATACCCTT 6 0.15 No Hit ACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGC 6 0.15 No Hit CAAGGCATGATGGTAGAGATCCATGGATTACCTCACACTCAGTTGGAGGA 6 0.15 No Hit GCTCAATTTCAGCACATGAAAGCATGGTGACCACCCAAACCCAAGAGGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.375 0.0 0.0 0.0 0.0 74-75 0.44999999999999996 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.5875 0.0 0.0 0.0 0.0 80-81 0.7250000000000001 0.0 0.0 0.0 0.0 82-83 0.875 0.0 0.0 0.0 0.0 84-85 1.0 0.0 0.0 0.0 0.0 86-87 1.225 0.0 0.0 0.0 0.0 88-89 1.4375 0.0 0.0 0.0 0.0 90-91 1.6625 0.0 0.0 0.0 0.0 92-93 1.9625 0.0 0.0 0.0 0.0 94-95 2.375 0.0 0.0 0.0 0.0 96-97 2.775 0.0 0.0 0.0 0.0 98-99 3.1875 0.0 0.0 0.0 0.0 100-101 3.6875 0.0 0.0 0.0 0.0 102-103 4.225 0.0 0.0 0.0 0.0 104-105 4.800000000000001 0.0 0.0 0.0 0.0 106-107 5.262499999999999 0.0 0.0 0.0 0.0 108-109 5.825 0.0 0.0 0.0 0.0 110-111 6.35 0.0 0.0 0.0 0.0 112-113 6.975 0.0 0.0 0.0 0.0 114-115 7.65 0.0 0.0 0.0 0.0 116-117 8.1375 0.0 0.0 0.0 0.0 118-119 8.7375 0.0 0.0 0.0 0.0 120-121 9.525 0.0 0.0 0.0 0.0 122-123 10.2375 0.0 0.0 0.0 0.0 124-125 10.9625 0.0 0.0 0.0 0.0 126-127 11.7875 0.0 0.0 0.0 0.0 128-129 12.4875 0.0 0.0 0.0 0.0 130-131 13.2 0.0 0.0 0.0 0.0 132-133 13.9 0.0 0.0 0.0 0.0 134-135 14.7375 0.0 0.0 0.0 0.0 136-137 15.375 0.0 0.0 0.0 0.0 138-139 16.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670112 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670112_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4535 37.0 37.0 37.0 37.0 37.0 2 36.308 37.0 37.0 37.0 37.0 37.0 3 36.272 37.0 37.0 37.0 37.0 37.0 4 36.3955 37.0 37.0 37.0 37.0 37.0 5 36.453 37.0 37.0 37.0 37.0 37.0 6 36.398 37.0 37.0 37.0 37.0 37.0 7 36.43 37.0 37.0 37.0 37.0 37.0 8 36.467 37.0 37.0 37.0 37.0 37.0 9 36.454 37.0 37.0 37.0 37.0 37.0 10-14 36.4606 37.0 37.0 37.0 37.0 37.0 15-19 36.426199999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.4092 37.0 37.0 37.0 37.0 37.0 25-29 36.346199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.335899999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.330200000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.2712 37.0 37.0 37.0 37.0 37.0 45-49 36.29359999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.23290000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.212 37.0 37.0 37.0 37.0 37.0 60-64 36.2372 37.0 37.0 37.0 37.0 37.0 65-69 36.178999999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.19109999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.1773 37.0 37.0 37.0 37.0 37.0 80-84 36.097500000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.08480000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.1047 37.0 37.0 37.0 37.0 37.0 95-99 35.988899999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.99059999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.9593 37.0 37.0 37.0 37.0 37.0 110-114 35.9351 37.0 37.0 37.0 37.0 37.0 115-119 35.93339999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.8445 37.0 37.0 37.0 37.0 37.0 125-129 35.73049999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.6021 37.0 37.0 37.0 37.0 37.0 135-139 35.5287 37.0 37.0 37.0 37.0 37.0 140-144 35.2806 37.0 37.0 37.0 37.0 37.0 145-149 35.1293 37.0 37.0 37.0 32.2 37.0 150-151 34.8975 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 6.0 15 1.0 16 2.0 17 0.0 18 2.0 19 0.0 20 0.0 21 0.0 22 1.0 23 5.0 24 5.0 25 5.0 26 7.0 27 9.0 28 9.0 29 11.0 30 15.0 31 28.0 32 52.0 33 73.0 34 179.0 35 501.0 36 2771.0 37 316.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.825 24.9 9.775 31.5 2 25.324999999999996 27.725 30.925000000000004 16.025 3 19.75 27.6 32.625 20.025000000000002 4 22.025 34.625 24.425 18.925 5 24.875 38.4 20.674999999999997 16.05 6 21.025 39.574999999999996 22.375 17.025000000000002 7 21.099999999999998 22.775000000000002 36.199999999999996 19.925 8 20.9 26.125 27.800000000000004 25.174999999999997 9 22.35 24.474999999999998 30.575000000000003 22.6 10-14 22.91 28.88 26.405 21.805 15-19 23.369999999999997 28.15 27.41 21.07 20-24 22.905 28.105000000000004 27.865000000000002 21.125 25-29 22.985 28.83 27.48 20.705000000000002 30-34 23.21 28.470000000000002 27.694999999999997 20.625 35-39 23.125 28.78 27.1 20.995 40-44 23.055 27.605 27.955000000000002 21.385 45-49 23.025000000000002 28.005000000000003 27.639999999999997 21.33 50-54 22.73 27.46 28.33 21.48 55-59 23.36 28.060000000000002 27.33 21.25 60-64 23.86 26.91 28.095 21.135 65-69 23.48 27.935 27.235 21.349999999999998 70-74 23.125 28.410000000000004 27.455000000000002 21.01 75-79 23.93 27.865000000000002 26.545 21.66 80-84 23.715 27.750000000000004 26.855 21.68 85-89 24.4 27.355 27.884999999999998 20.36 90-94 23.98 27.384999999999998 27.994999999999997 20.64 95-99 25.014999999999997 28.720000000000002 26.119999999999997 20.145 100-104 24.515 28.74 26.365 20.380000000000003 105-109 24.545 28.315 27.05 20.09 110-114 25.455 28.215 26.615 19.715 115-119 25.46 28.08 26.395000000000003 20.064999999999998 120-124 25.56 28.535 26.195 19.71 125-129 26.52 27.665 26.334999999999997 19.48 130-134 26.224999999999998 27.93 26.540000000000003 19.305 135-139 26.52 28.15 25.635 19.695 140-144 27.265 27.42 26.340000000000003 18.975 145-149 28.199999999999996 27.67 25.605 18.525 150-151 28.3625 27.3875 26.187500000000004 18.0625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 1.0 10 1.0 11 0.0 12 0.5 13 0.5 14 1.0 15 1.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 1.5 25 1.5 26 3.5 27 5.0 28 4.5 29 8.5 30 11.5 31 11.5 32 21.5 33 39.0 34 49.5 35 51.5 36 79.0 37 106.0 38 126.0 39 146.0 40 171.5 41 230.0 42 275.5 43 281.5 44 285.0 45 267.0 46 243.5 47 249.0 48 253.0 49 215.0 50 166.0 51 140.5 52 112.0 53 94.5 54 85.0 55 70.0 56 50.0 57 35.5 58 25.0 59 25.0 60 18.5 61 7.5 62 5.0 63 3.0 64 2.5 65 1.5 66 1.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 1.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 83.85527515962299 68.95 2 12.3137731833384 20.25 3 3.0100334448160537 7.425 4 0.5472788081483734 1.7999999999999998 5 0.12161751292186075 0.5 6 0.0 0.0 7 0.060808756460930376 0.35000000000000003 8 0.030404378230465188 0.2 9 0.0 0.0 >10 0.060808756460930376 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 11 0.27499999999999997 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 10 0.25 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 7 0.17500000000000002 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 7 0.17500000000000002 No Hit TCTTAAACAGCTGTTCTCACTTGCTGAAAAGTTTGGTTATTCTGAGTGGA 5 0.125 No Hit GTTAACGAATTGAAGGCAACAAAATGGATGCCTCATCGTCCTCTTTCCTC 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit GCTATTGCGGACTGTGGTCAACTCTCTTAGAGGGCATTGATTGACATGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.375 0.0 0.0 0.0 0.0 74-75 0.44999999999999996 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.5875 0.0 0.0 0.0 0.0 80-81 0.7250000000000001 0.0 0.0 0.0 0.0 82-83 0.875 0.0 0.0 0.0 0.0 84-85 1.0 0.0 0.0 0.0 0.0 86-87 1.25 0.0 0.0 0.0 0.0 88-89 1.4625 0.0 0.0 0.0 0.0 90-91 1.6875 0.0 0.0 0.0 0.0 92-93 2.0 0.0 0.0 0.0 0.0 94-95 2.425 0.0 0.0 0.0 0.0 96-97 2.825 0.0 0.0 0.0 0.0 98-99 3.25 0.0 0.0 0.0 0.0 100-101 3.7625 0.0 0.0 0.0 0.0 102-103 4.3 0.0 0.0 0.0 0.0 104-105 4.9 0.0 0.0 0.0 0.0 106-107 5.387499999999999 0.0 0.0 0.0 0.0 108-109 5.95 0.0 0.0 0.0 0.0 110-111 6.475 0.0 0.0 0.0 0.0 112-113 7.1 0.0 0.0 0.0 0.0 114-115 7.75 0.0 0.0 0.0 0.0 116-117 8.2375 0.0 0.0 0.0 0.0 118-119 8.8375 0.0 0.0 0.0 0.0 120-121 9.6375 0.0 0.0 0.0 0.0 122-123 10.3375 0.0 0.0 0.0 0.0 124-125 11.0625 0.0 0.0 0.0 0.0 126-127 11.8875 0.0 0.0 0.0 0.0 128-129 12.587499999999999 0.0 0.0 0.0 0.0 130-131 13.3125 0.0 0.0 0.0 0.0 132-133 14.025 0.0 0.0 0.0 0.0 134-135 14.8875 0.0 0.0 0.0 0.0 136-137 15.525 0.0 0.0 0.0 0.0 138-139 16.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565468 spots for SRR12670112.sra Written 565468 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra Read 565461 spots for SRR12670112.sra Written 565461 spots for SRR12670112.sra SRR ids: ['SRR12670112.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_487st5mp SRR12670112.sra spots: 11309227 blocks: [[1, 565461], [565462, 1130922], [1130923, 1696383], [1696384, 2261844], [2261845, 2827305], [2827306, 3392766], [3392767, 3958227], [3958228, 4523688], [4523689, 5089149], [5089150, 5654610], [5654611, 6220071], [6220072, 6785532], [6785533, 7350993], [7350994, 7916454], [7916455, 8481915], [8481916, 9047376], [9047377, 9612837], [9612838, 10178298], [10178299, 10743759], [10743760, 11309227]] SRR12670112 file size 3821669 SRR12670112 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670112 SRR12670112_1.fastq SRR12670112_2.fastq Input file: SRR12670112_1.fastq Paired file: SRR12670112_2.fastq trimmed: SRR12670112-trimmed-pair1.fastq, SRR12670112-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:31:40 2025 >> started Mon Feb 10 23:31:52 2025 >> done (12.339s) 11309227 read pairs processed; of these: 57 ( 0.00%) short read pairs filtered out after trimming by size control 3854 ( 0.03%) empty read pairs filtered out after trimming by size control 11305316 (99.97%) read pairs available; of these: 2323801 (20.55%) trimmed read pairs available after processing 8981515 (79.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 11 0.00% 22 10 0.00% 23 21 0.00% 24 23 0.00% 25 22 0.00% 26 20 0.00% 27 35 0.00% 28 42 0.00% 29 42 0.00% 30 42 0.00% 31 46 0.00% 32 55 0.00% 33 75 0.00% 34 62 0.00% 35 77 0.00% 36 79 0.00% 37 76 0.00% 38 105 0.00% 39 130 0.00% 40 118 0.00% 41 145 0.00% 42 148 0.00% 43 151 0.00% 44 159 0.00% 45 146 0.00% 46 180 0.00% 47 199 0.00% 48 263 0.00% 49 265 0.00% 50 299 0.00% 51 370 0.00% 52 390 0.00% 53 382 0.00% 54 456 0.00% 55 401 0.00% 56 575 0.01% 57 544 0.00% 58 701 0.01% 59 894 0.01% 60 961 0.01% 61 1164 0.01% 62 1185 0.01% 63 1336 0.01% 64 1405 0.01% 65 1556 0.01% 66 1617 0.01% 67 1824 0.02% 68 2057 0.02% 69 2299 0.02% 70 2715 0.02% 71 3096 0.03% 72 3522 0.03% 73 3883 0.03% 74 4276 0.04% 75 4629 0.04% 76 5058 0.04% 77 5284 0.05% 78 5602 0.05% 79 6484 0.06% 80 7115 0.06% 81 7850 0.07% 82 8631 0.08% 83 9444 0.08% 84 10457 0.09% 85 11349 0.10% 86 12042 0.11% 87 12515 0.11% 88 13239 0.12% 89 13412 0.12% 90 14770 0.13% 91 15672 0.14% 92 16784 0.15% 93 17917 0.16% 94 19259 0.17% 95 20317 0.18% 96 21241 0.19% 97 22266 0.20% 98 22338 0.20% 99 22680 0.20% 100 23516 0.21% 101 23887 0.21% 102 24700 0.22% 103 26163 0.23% 104 27344 0.24% 105 28710 0.25% 106 29406 0.26% 107 29767 0.26% 108 29890 0.26% 109 30251 0.27% 110 30529 0.27% 111 31179 0.28% 112 32014 0.28% 113 33144 0.29% 114 33523 0.30% 115 34728 0.31% 116 35545 0.31% 117 36272 0.32% 118 36507 0.32% 119 36632 0.32% 120 37262 0.33% 121 37714 0.33% 122 37907 0.34% 123 38790 0.34% 124 38934 0.34% 125 39613 0.35% 126 41291 0.37% 127 41245 0.36% 128 40951 0.36% 129 41223 0.36% 130 41865 0.37% 131 41393 0.37% 132 41808 0.37% 133 42355 0.37% 134 42955 0.38% 135 43301 0.38% 136 43953 0.39% 137 44379 0.39% 138 43804 0.39% 139 45838 0.41% 140 45103 0.40% 141 46170 0.41% 142 46064 0.41% 143 45404 0.40% 144 46578 0.41% 145 46248 0.41% 146 47509 0.42% 147 47154 0.42% 148 48890 0.43% 149 47937 0.42% 150 49438 0.44% 151 8981515 79.45% 11305316 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=35 prefix-density=0.76 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTGTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=31.43 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.0 sequence=ACCACACCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=22 prefix-density=0.60 prefix-fanout=2.5 sequence=GAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATTGTTATGTATTGGCCATGTCTGTGGCCTCTGGTGTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=34.82 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=1.8 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12670112 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:32:36 Started mapping on | Feb 10 23:32:37 Finished on | Feb 10 23:33:58 Mapping speed, Million of reads per hour | 502.46 Number of input reads | 11305316 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 10687894 Uniquely mapped reads % | 94.54% Average mapped length | 288.61 Number of splices: Total | 10413023 Number of splices: Annotated (sjdb) | 10167259 Number of splices: GT/AG | 10206777 Number of splices: GC/AG | 156029 Number of splices: AT/AC | 6804 Number of splices: Non-canonical | 43413 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 260997 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 24744 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 356425 356425 356425 N_multimapping 260997 260997 260997 N_noFeature 350278 10473170 422398 N_ambiguous 216811 781 73821 UnstrandedReadsAssigned:10120805 PositiveStrandReadsAssigned:213943 NegativeStrandReadsAssigned:10191675 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR12670112 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670112-trimmed-pair1.fastq SRR12670112-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,305,316 reads, 10,138,515 reads pseudoaligned [quant] estimated average fragment length: 224.04 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR12670112.ke.tsv 34699 SRR12670112.se.tsv 87100 total ==> SRR12670112.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.96 529 23.2631 Potri.005G024800.1.v4.1 1035 811.96 199 19.3458 Potri.004G059700.1.v4.1 961 738.023 0 0 Potri.007G009000.2.v4.1 1416 1192.96 0 0 Potri.003G141000.2.v4.1 2943 2719.96 470.434 13.6522 Potri.016G087400.1.v4.1 270 100.896 645.908 505.319 Potri.015G069301.1.v4.1 564 348.669 0 0 Potri.010G195200.1.v4.1 1773 1549.96 123 6.264 Potri.012G127500.1.v4.1 977 753.989 84 8.7939 ==> SRR12670112.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 188 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 163 Potri.001G212900.v4.1 42 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12670112 completed mapping pipeline successfully