Starting /dee2/code/volunteer_pipeline.sh SRR12670114 current disk space = 3057470246912 free memory = 1163365912 SRR12670114 SRAfilesize 002ba9c2f78ef6f410f9dbc65b276bfa SRR12670114.sra SRR12670114.sra file validated SRR12670114 is paired end SRR12670114 is conventional basespace SRR12670114 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670114_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6105 37.0 37.0 37.0 37.0 37.0 2 36.47175 37.0 37.0 37.0 37.0 37.0 3 36.5645 37.0 37.0 37.0 37.0 37.0 4 36.67 37.0 37.0 37.0 37.0 37.0 5 36.643 37.0 37.0 37.0 37.0 37.0 6 36.631 37.0 37.0 37.0 37.0 37.0 7 36.7025 37.0 37.0 37.0 37.0 37.0 8 36.5925 37.0 37.0 37.0 37.0 37.0 9 36.652 37.0 37.0 37.0 37.0 37.0 10-14 36.625600000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.6146 37.0 37.0 37.0 37.0 37.0 20-24 36.5616 37.0 37.0 37.0 37.0 37.0 25-29 36.5372 37.0 37.0 37.0 37.0 37.0 30-34 36.480199999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.507799999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.452999999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4291 37.0 37.0 37.0 37.0 37.0 50-54 36.4177 37.0 37.0 37.0 37.0 37.0 55-59 36.4068 37.0 37.0 37.0 37.0 37.0 60-64 36.3625 37.0 37.0 37.0 37.0 37.0 65-69 36.3472 37.0 37.0 37.0 37.0 37.0 70-74 36.3158 37.0 37.0 37.0 37.0 37.0 75-79 36.263400000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.2517 37.0 37.0 37.0 37.0 37.0 85-89 36.2309 37.0 37.0 37.0 37.0 37.0 90-94 36.2226 37.0 37.0 37.0 37.0 37.0 95-99 36.21410000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.201800000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.1389 37.0 37.0 37.0 37.0 37.0 110-114 36.1041 37.0 37.0 37.0 37.0 37.0 115-119 36.1091 37.0 37.0 37.0 37.0 37.0 120-124 35.9942 37.0 37.0 37.0 37.0 37.0 125-129 35.9473 37.0 37.0 37.0 37.0 37.0 130-134 35.978699999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.832100000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.663199999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.617 37.0 37.0 37.0 37.0 37.0 150-151 35.4505 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 3.0 25 5.0 26 3.0 27 7.0 28 10.0 29 20.0 30 30.0 31 35.0 32 46.0 33 73.0 34 130.0 35 269.0 36 2926.0 37 440.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.525 11.95 5.45 45.074999999999996 2 17.622027534418024 11.914893617021278 38.423028785982474 32.040050062578224 3 16.875 15.825 28.1 39.2 4 21.6 24.025 22.6 31.775 5 25.650000000000002 29.299999999999997 23.525 21.525 6 20.549999999999997 32.7 24.55 22.2 7 14.975 26.224999999999998 40.1 18.7 8 17.224999999999998 26.875 31.924999999999997 23.974999999999998 9 18.224999999999998 22.925 35.099999999999994 23.75 10-14 20.79 28.285 27.389999999999997 23.535 15-19 20.294999999999998 27.500000000000004 27.644999999999996 24.560000000000002 20-24 20.62 27.785 27.62 23.974999999999998 25-29 20.76 26.895000000000003 28.005000000000003 24.34 30-34 20.815 28.470000000000002 26.465 24.25 35-39 20.71 27.495000000000005 27.665 24.13 40-44 21.075 27.74 26.974999999999998 24.21 45-49 21.01 27.785 27.115000000000002 24.09 50-54 20.68 27.025 28.165000000000003 24.13 55-59 20.915 27.615000000000002 27.544999999999998 23.925 60-64 21.07 27.810000000000002 27.555000000000003 23.565 65-69 21.08 27.939999999999998 26.69 24.29 70-74 21.015 28.235 27.05 23.7 75-79 21.39 28.335 26.979999999999997 23.294999999999998 80-84 21.099999999999998 27.675 27.334999999999997 23.89 85-89 21.735 27.125 27.250000000000004 23.89 90-94 21.87 27.894999999999996 26.729999999999997 23.505000000000003 95-99 21.85 27.450000000000003 26.93 23.77 100-104 21.765 28.785 25.88 23.57 105-109 21.29 28.060000000000002 26.86 23.79 110-114 21.790000000000003 28.199999999999996 25.82 24.19 115-119 21.215 29.07 25.75 23.965 120-124 22.035 28.22 25.765 23.98 125-129 22.09 27.925 25.629999999999995 24.355 130-134 21.69 26.919999999999998 26.634999999999998 24.755 135-139 21.93 27.310000000000002 26.505000000000003 24.255 140-144 21.84 26.775 26.47 24.915000000000003 145-149 22.689999999999998 26.88 25.735000000000003 24.695 150-151 22.5875 26.775 26.424999999999997 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 1.0 27 3.0 28 5.0 29 10.0 30 12.5 31 16.5 32 19.0 33 20.5 34 23.0 35 43.0 36 70.0 37 85.5 38 115.0 39 137.0 40 153.5 41 181.0 42 219.0 43 233.5 44 242.0 45 251.5 46 274.5 47 285.5 48 253.5 49 246.0 50 223.0 51 185.0 52 151.5 53 120.5 54 106.5 55 85.0 56 58.5 57 39.5 58 35.0 59 29.5 60 15.5 61 13.5 62 10.0 63 3.5 64 3.5 65 4.0 66 2.5 67 2.0 68 1.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.15 #Duplication Level Percentage of deduplicated Percentage of total 1 82.31669747381393 66.8 2 13.493530499075785 21.9 3 3.234750462107209 7.875 4 0.6777572396796057 2.1999999999999997 5 0.18484288354898337 0.75 6 0.06161429451632779 0.3 7 0.030807147258163897 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCTTCAAGAATGGGTGAGAGGGGAATATACTTCTCGGTAGCCAATTCAG 7 0.17500000000000002 No Hit ACCAGAAGCGGCTCAAGCTTGCTTCTATTGAACCATGTGGCTCGTCGGTA 6 0.15 No Hit GCCAGAGAGAAGGAAAAAGATTGACGCGGGAGCTTAAGGGAGACTCCATG 6 0.15 No Hit GCCCAGCAGTGTCCCAGCCATAATCACCAGGGAACTCACCGGTCAAGTAG 5 0.125 No Hit GCCTTCCCAGCCTTGTTGATTAGAGTATAGGTGTTAACACCAGAGCCTTC 5 0.125 No Hit CCTCAATCTTGTCTTCCTGCATCCCTGAGAAAGATACGTCCTCTATCTTT 5 0.125 No Hit GCTCTGTTTAATTAACACTGCTATATAGAAAGATAAATAATTTGTCTTTT 5 0.125 No Hit GTCCTTTGCTGACTCCTTAGCCCTTACTGCCGCCTCAGCTGGAGGAAGTG 5 0.125 No Hit CTCATCCATCCACTGCTGCAAATCCCCGATCCACAACGACTTGATCTCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1375 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.375 0.0 0.0 0.0 0.0 74-75 0.5375000000000001 0.0 0.0 0.0 0.0 76-77 0.6375 0.0 0.0 0.0 0.0 78-79 0.9125 0.0 0.0 0.0 0.0 80-81 1.15 0.0 0.0 0.0 0.0 82-83 1.2625000000000002 0.0 0.0 0.0 0.0 84-85 1.4625 0.0 0.0 0.0 0.0 86-87 1.9625 0.0 0.0 0.0 0.0 88-89 2.25 0.0 0.0 0.0 0.0 90-91 2.5875 0.0 0.0 0.0 0.0 92-93 3.1624999999999996 0.0 0.0 0.0 0.0 94-95 3.5999999999999996 0.0 0.0 0.0 0.0 96-97 4.225 0.0 0.0 0.0 0.0 98-99 4.8 0.0 0.0 0.0 0.0 100-101 5.6 0.0 0.0 0.0 0.0 102-103 6.4375 0.0 0.0 0.0 0.0 104-105 7.15 0.0 0.0 0.0 0.0 106-107 8.025 0.0 0.0 0.0 0.0 108-109 8.7625 0.0 0.0 0.0 0.0 110-111 9.5125 0.0 0.0 0.0 0.0 112-113 10.3125 0.0 0.0 0.0 0.0 114-115 10.95 0.0 0.0 0.0 0.0 116-117 11.9125 0.0 0.0 0.0 0.0 118-119 12.649999999999999 0.0 0.0 0.0 0.0 120-121 13.65 0.0 0.0 0.0 0.0 122-123 14.6375 0.0 0.0 0.0 0.0 124-125 15.5 0.0 0.0 0.0 0.0 126-127 16.4875 0.0 0.0 0.0 0.0 128-129 17.5125 0.0 0.0 0.0 0.0 130-131 18.4375 0.0 0.0 0.0 0.0 132-133 19.2125 0.0 0.0 0.0 0.0 134-135 20.2125 0.0 0.0 0.0 0.0 136-137 21.0375 0.0 0.0 0.0 0.0 138-139 22.299999999999997 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTTAC 10 0.006830828 145.0 8 AAAAAAA 35 0.0035366106 20.714287 135-139 >>END_MODULE SRR12670114 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670114_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3595 37.0 37.0 37.0 37.0 37.0 2 36.246 37.0 37.0 37.0 37.0 37.0 3 36.214 37.0 37.0 37.0 37.0 37.0 4 36.272 37.0 37.0 37.0 37.0 37.0 5 36.3825 37.0 37.0 37.0 37.0 37.0 6 36.331 37.0 37.0 37.0 37.0 37.0 7 36.225 37.0 37.0 37.0 37.0 37.0 8 36.3795 37.0 37.0 37.0 37.0 37.0 9 36.328 37.0 37.0 37.0 37.0 37.0 10-14 36.3872 37.0 37.0 37.0 37.0 37.0 15-19 36.3458 37.0 37.0 37.0 37.0 37.0 20-24 36.3096 37.0 37.0 37.0 37.0 37.0 25-29 36.2744 37.0 37.0 37.0 37.0 37.0 30-34 36.23969999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.2279 37.0 37.0 37.0 37.0 37.0 40-44 36.215599999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.1567 37.0 37.0 37.0 37.0 37.0 50-54 36.127 37.0 37.0 37.0 37.0 37.0 55-59 36.131499999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.111900000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.0757 37.0 37.0 37.0 37.0 37.0 70-74 36.0246 37.0 37.0 37.0 37.0 37.0 75-79 36.0336 37.0 37.0 37.0 37.0 37.0 80-84 35.9798 37.0 37.0 37.0 37.0 37.0 85-89 35.9737 37.0 37.0 37.0 37.0 37.0 90-94 35.9739 37.0 37.0 37.0 37.0 37.0 95-99 35.956900000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.872800000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.8012 37.0 37.0 37.0 37.0 37.0 110-114 35.7313 37.0 37.0 37.0 37.0 37.0 115-119 35.7333 37.0 37.0 37.0 37.0 37.0 120-124 35.557900000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.4249 37.0 37.0 37.0 37.0 37.0 130-134 35.3422 37.0 37.0 37.0 34.6 37.0 135-139 35.0658 37.0 37.0 37.0 27.4 37.0 140-144 34.825 37.0 37.0 37.0 25.0 37.0 145-149 34.435700000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.06925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 2.0 15 1.0 16 0.0 17 2.0 18 1.0 19 1.0 20 2.0 21 1.0 22 3.0 23 3.0 24 10.0 25 8.0 26 11.0 27 7.0 28 12.0 29 16.0 30 26.0 31 50.0 32 83.0 33 114.0 34 219.0 35 564.0 36 2558.0 37 304.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.25 22.400000000000002 9.75 31.6 2 26.575 25.5 31.674999999999997 16.25 3 21.525 26.950000000000003 32.574999999999996 18.95 4 23.599999999999998 34.125 23.400000000000002 18.875 5 25.8 35.725 22.45 16.025 6 20.5 38.9 22.55 18.05 7 19.7 22.95 37.25 20.1 8 22.400000000000002 25.825 26.400000000000002 25.374999999999996 9 21.099999999999998 25.35 30.175 23.375 10-14 23.369999999999997 29.025000000000002 26.395000000000003 21.21 15-19 23.93 27.750000000000004 26.69 21.63 20-24 23.575 28.53 26.810000000000002 21.085 25-29 23.765 27.450000000000003 27.250000000000004 21.535 30-34 22.81 27.839999999999996 27.54 21.81 35-39 23.195 27.675 27.334999999999997 21.795 40-44 23.085 28.025 27.04 21.85 45-49 23.419999999999998 28.415000000000003 27.71 20.455000000000002 50-54 23.990000000000002 27.125 27.384999999999998 21.5 55-59 23.815 27.805000000000003 26.825 21.555 60-64 24.16 27.644999999999996 26.31 21.884999999999998 65-69 23.955000000000002 27.400000000000002 27.055 21.59 70-74 23.39 28.025 26.6 21.985 75-79 23.45 27.889999999999997 26.75 21.91 80-84 23.849999999999998 27.935 26.740000000000002 21.475 85-89 24.525 28.465 26.334999999999997 20.674999999999997 90-94 23.995 28.075 27.255000000000003 20.674999999999997 95-99 24.785 27.889999999999997 26.68 20.645 100-104 25.224999999999998 27.13 26.61 21.035 105-109 24.81 28.355000000000004 26.05 20.785 110-114 25.95 28.4 25.224999999999998 20.424999999999997 115-119 26.58 27.35 25.835 20.235 120-124 26.590000000000003 28.48 25.395 19.535 125-129 26.974999999999998 27.965 25.629999999999995 19.43 130-134 27.98 26.44 26.235000000000003 19.345000000000002 135-139 28.79 26.279999999999998 26.150000000000002 18.78 140-144 29.01 26.5 25.285000000000004 19.205 145-149 29.84 26.775 25.124999999999996 18.26 150-151 30.325000000000003 26.0375 25.7 17.9375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.5 10 1.0 11 1.0 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 2.0 26 3.5 27 3.0 28 2.5 29 5.0 30 8.0 31 9.0 32 15.5 33 25.0 34 31.0 35 50.0 36 74.0 37 81.0 38 98.5 39 134.0 40 168.5 41 209.0 42 263.0 43 280.0 44 278.0 45 292.0 46 284.0 47 254.5 48 239.0 49 219.5 50 171.0 51 153.5 52 141.5 53 106.5 54 87.0 55 77.0 56 62.5 57 44.5 58 27.5 59 22.5 60 20.5 61 11.5 62 7.5 63 4.5 64 1.5 65 1.5 66 0.5 67 0.0 68 1.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.5 93 0.5 94 0.5 95 0.5 96 1.5 97 2.0 98 1.5 99 1.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.25 #Duplication Level Percentage of deduplicated Percentage of total 1 82.52307692307693 67.05 2 13.446153846153846 21.85 3 3.0153846153846153 7.35 4 0.6461538461538461 2.1 5 0.24615384615384617 1.0 6 0.06153846153846154 0.3 7 0.06153846153846154 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 7 0.17500000000000002 No Hit CTATGTCCTCTATTTCCTTGTTTTAGCAATGCAGCCAAGAATGTTGTTGA 7 0.17500000000000002 No Hit CGTATACAGTGCATCTGTTCAAAGGACTCTTTTTCAAATGGCAAAGGCTG 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GTCAAACAAGTCTCCCCCCTCTCGTTCTCTCTTTCTCATTCAAAAAAAAA 5 0.125 No Hit CTCTAGCGAACATGCCAGAAAAGATAGAGGGCTTGTCTTTCTCAGGGATG 5 0.125 No Hit AATGCAAGCAGCTGCAATGGCAGCCCACGCAATCCTCACAGCCACTCCAC 5 0.125 No Hit AATAAATCCTTAGATCTCTCCCCAACCACCACCTTATCCTCCATCAGAAT 5 0.125 No Hit CGCACCATCAGCTAAACAATGGCAGCAGCAACAATGGCCCTCTCCTCCCC 5 0.125 No Hit GAAACTCTAAGAGACCCCAGAGGTTTTGCTGTGAAATTCTACACTAGAGA 5 0.125 No Hit CTTCAATCGTAAATCACAAATACATACACGTTTACTCATCAGCTCGAAAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1375 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.375 0.0 0.0 0.0 0.0 74-75 0.5375000000000001 0.0 0.0 0.0 0.0 76-77 0.6375 0.0 0.0 0.0 0.0 78-79 0.9125 0.0 0.0 0.0 0.0 80-81 1.15 0.0 0.0 0.0 0.0 82-83 1.275 0.0 0.0 0.0 0.0 84-85 1.5125 0.0 0.0 0.0 0.0 86-87 2.0125 0.0 0.0 0.0 0.0 88-89 2.3 0.0 0.0 0.0 0.0 90-91 2.6624999999999996 0.0 0.0 0.0 0.0 92-93 3.275 0.0 0.0 0.0 0.0 94-95 3.7125 0.0 0.0 0.0 0.0 96-97 4.325 0.0 0.0 0.0 0.0 98-99 4.9 0.0 0.0 0.0 0.0 100-101 5.7 0.0 0.0 0.0 0.0 102-103 6.575 0.0 0.0 0.0 0.0 104-105 7.325 0.0 0.0 0.0 0.0 106-107 8.225 0.0 0.0 0.0 0.0 108-109 8.962499999999999 0.0 0.0 0.0 0.0 110-111 9.7 0.0 0.0 0.0 0.0 112-113 10.5125 0.0 0.0 0.0 0.0 114-115 11.149999999999999 0.0 0.0 0.0 0.0 116-117 12.1125 0.0 0.0 0.0 0.0 118-119 12.8625 0.0 0.0 0.0 0.0 120-121 13.85 0.0 0.0 0.0 0.0 122-123 14.8375 0.0 0.0 0.0 0.0 124-125 15.7 0.0 0.0 0.0 0.0 126-127 16.675 0.0 0.0 0.0 0.0 128-129 17.674999999999997 0.0 0.0 0.0 0.0 130-131 18.5625 0.0 0.0 0.0 0.0 132-133 19.325 0.0 0.0 0.0 0.0 134-135 20.325 0.0 0.0 0.0 0.0 136-137 21.174999999999997 0.0 0.0 0.0 0.0 138-139 22.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 90 0.0048656333 16.11111 145 >>END_MODULE Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723155 spots for SRR12670114.sra Written 723155 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra Read 723146 spots for SRR12670114.sra Written 723146 spots for SRR12670114.sra SRR ids: ['SRR12670114.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zww5qhz2 SRR12670114.sra spots: 14462929 blocks: [[1, 723146], [723147, 1446292], [1446293, 2169438], [2169439, 2892584], [2892585, 3615730], [3615731, 4338876], [4338877, 5062022], [5062023, 5785168], [5785169, 6508314], [6508315, 7231460], [7231461, 7954606], [7954607, 8677752], [8677753, 9400898], [9400899, 10124044], [10124045, 10847190], [10847191, 11570336], [11570337, 12293482], [12293483, 13016628], [13016629, 13739774], [13739775, 14462929]] SRR12670114 file size 4893435 SRR12670114 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670114 SRR12670114_1.fastq SRR12670114_2.fastq Input file: SRR12670114_1.fastq Paired file: SRR12670114_2.fastq trimmed: SRR12670114-trimmed-pair1.fastq, SRR12670114-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:43:12 2025 >> started Mon Feb 10 23:43:28 2025 >> done (16.019s) 14462929 read pairs processed; of these: 69 ( 0.00%) short read pairs filtered out after trimming by size control 7261 ( 0.05%) empty read pairs filtered out after trimming by size control 14455599 (99.95%) read pairs available; of these: 3926507 (27.16%) trimmed read pairs available after processing 10529092 (72.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 4 0.00% 21 15 0.00% 22 22 0.00% 23 25 0.00% 24 34 0.00% 25 35 0.00% 26 35 0.00% 27 39 0.00% 28 49 0.00% 29 62 0.00% 30 64 0.00% 31 70 0.00% 32 69 0.00% 33 78 0.00% 34 88 0.00% 35 108 0.00% 36 114 0.00% 37 107 0.00% 38 115 0.00% 39 146 0.00% 40 157 0.00% 41 184 0.00% 42 204 0.00% 43 197 0.00% 44 233 0.00% 45 227 0.00% 46 253 0.00% 47 294 0.00% 48 398 0.00% 49 439 0.00% 50 535 0.00% 51 582 0.00% 52 666 0.00% 53 662 0.00% 54 732 0.01% 55 821 0.01% 56 915 0.01% 57 987 0.01% 58 1235 0.01% 59 1472 0.01% 60 1672 0.01% 61 2029 0.01% 62 2283 0.02% 63 2546 0.02% 64 2827 0.02% 65 2877 0.02% 66 3231 0.02% 67 3662 0.03% 68 3992 0.03% 69 4641 0.03% 70 5081 0.04% 71 5983 0.04% 72 6849 0.05% 73 8019 0.06% 74 8547 0.06% 75 9325 0.06% 76 10068 0.07% 77 10790 0.07% 78 11980 0.08% 79 13090 0.09% 80 14176 0.10% 81 15989 0.11% 82 17638 0.12% 83 19728 0.14% 84 21824 0.15% 85 23700 0.16% 86 24947 0.17% 87 25510 0.18% 88 27445 0.19% 89 28101 0.19% 90 30338 0.21% 91 32757 0.23% 92 34071 0.24% 93 37229 0.26% 94 39843 0.28% 95 41375 0.29% 96 42380 0.29% 97 43836 0.30% 98 44279 0.31% 99 45453 0.31% 100 47121 0.33% 101 47766 0.33% 102 49255 0.34% 103 50982 0.35% 104 52861 0.37% 105 54762 0.38% 106 56175 0.39% 107 56440 0.39% 108 57114 0.40% 109 57616 0.40% 110 57425 0.40% 111 57621 0.40% 112 58979 0.41% 113 58966 0.41% 114 60310 0.42% 115 62513 0.43% 116 63668 0.44% 117 64401 0.45% 118 64052 0.44% 119 63147 0.44% 120 64281 0.44% 121 63907 0.44% 122 64506 0.45% 123 64534 0.45% 124 64843 0.45% 125 65401 0.45% 126 67140 0.46% 127 66343 0.46% 128 66023 0.46% 129 65891 0.46% 130 66833 0.46% 131 64923 0.45% 132 65291 0.45% 133 65806 0.46% 134 65972 0.46% 135 66473 0.46% 136 66283 0.46% 137 66568 0.46% 138 66543 0.46% 139 68321 0.47% 140 66364 0.46% 141 66384 0.46% 142 66522 0.46% 143 65900 0.46% 144 66225 0.46% 145 65872 0.46% 146 65629 0.45% 147 65806 0.46% 148 66934 0.46% 149 65160 0.45% 150 66065 0.46% 151 10529092 72.84% 14455599 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=24 prefix-density=0.69 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=151.31 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=13.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTGT criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=17 prefix-density=0.90 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=42.31 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=1.9 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12670114 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:44:13 Started mapping on | Feb 10 23:44:13 Finished on | Feb 10 23:45:46 Mapping speed, Million of reads per hour | 559.57 Number of input reads | 14455599 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 13669464 Uniquely mapped reads % | 94.56% Average mapped length | 283.33 Number of splices: Total | 13387177 Number of splices: Annotated (sjdb) | 13141195 Number of splices: GT/AG | 13110490 Number of splices: GC/AG | 232692 Number of splices: AT/AC | 7226 Number of splices: Non-canonical | 36769 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 322338 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 29644 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 463797 463797 463797 N_multimapping 322338 322338 322338 N_noFeature 337236 13476025 411732 N_ambiguous 201626 584 82424 UnstrandedReadsAssigned:13130602 PositiveStrandReadsAssigned:192855 NegativeStrandReadsAssigned:13175308 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=135 echo kmer=131 SRR12670114 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670114-trimmed-pair1.fastq SRR12670114-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,455,599 reads, 13,248,606 reads pseudoaligned [quant] estimated average fragment length: 207.005 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52401 SRR12670114.ke.tsv 34699 SRR12670114.se.tsv 87100 total ==> SRR12670114.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1811.99 401 16.3519 Potri.005G024800.1.v4.1 1035 828.995 188 16.7566 Potri.004G059700.1.v4.1 961 755.059 17 1.6636 Potri.007G009000.2.v4.1 1416 1209.99 0 0 Potri.003G141000.2.v4.1 2943 2736.99 707 19.0864 Potri.016G087400.1.v4.1 270 109.586 531 358.028 Potri.015G069301.1.v4.1 564 364.975 0 0 Potri.010G195200.1.v4.1 1773 1566.99 22 1.03737 Potri.012G127500.1.v4.1 977 771.027 119 11.404 ==> SRR12670114.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 471 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 229 Potri.001G212900.v4.1 22 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR12670114 completed mapping pipeline successfully