Starting /dee2/code/volunteer_pipeline.sh SRR12670120 current disk space = 3057476182016 free memory = 1344705556 SRR12670120 SRAfilesize 27f38e6d0aeabf8ea193780e72fe84f4 SRR12670120.sra SRR12670120.sra file validated SRR12670120 is paired end SRR12670120 is conventional basespace SRR12670120 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670120_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6225 37.0 37.0 37.0 37.0 37.0 2 36.49575 37.0 37.0 37.0 37.0 37.0 3 36.592 37.0 37.0 37.0 37.0 37.0 4 36.6705 37.0 37.0 37.0 37.0 37.0 5 36.677 37.0 37.0 37.0 37.0 37.0 6 36.6475 37.0 37.0 37.0 37.0 37.0 7 36.58 37.0 37.0 37.0 37.0 37.0 8 36.6265 37.0 37.0 37.0 37.0 37.0 9 36.6485 37.0 37.0 37.0 37.0 37.0 10-14 36.6317 37.0 37.0 37.0 37.0 37.0 15-19 36.6334 37.0 37.0 37.0 37.0 37.0 20-24 36.6182 37.0 37.0 37.0 37.0 37.0 25-29 36.5726 37.0 37.0 37.0 37.0 37.0 30-34 36.554700000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.5025 37.0 37.0 37.0 37.0 37.0 40-44 36.4944 37.0 37.0 37.0 37.0 37.0 45-49 36.4694 37.0 37.0 37.0 37.0 37.0 50-54 36.4333 37.0 37.0 37.0 37.0 37.0 55-59 36.3977 37.0 37.0 37.0 37.0 37.0 60-64 36.4218 37.0 37.0 37.0 37.0 37.0 65-69 36.3993 37.0 37.0 37.0 37.0 37.0 70-74 36.3683 37.0 37.0 37.0 37.0 37.0 75-79 36.376599999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.3343 37.0 37.0 37.0 37.0 37.0 85-89 36.3028 37.0 37.0 37.0 37.0 37.0 90-94 36.3549 37.0 37.0 37.0 37.0 37.0 95-99 36.2648 37.0 37.0 37.0 37.0 37.0 100-104 36.2957 37.0 37.0 37.0 37.0 37.0 105-109 36.2521 37.0 37.0 37.0 37.0 37.0 110-114 36.195299999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.24980000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.069900000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.953900000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.8986 37.0 37.0 37.0 37.0 37.0 135-139 35.6832 37.0 37.0 37.0 37.0 37.0 140-144 35.3545 37.0 37.0 37.0 37.0 37.0 145-149 35.161 37.0 37.0 37.0 32.2 37.0 150-151 34.766 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 2.0 26 4.0 27 2.0 28 12.0 29 21.0 30 23.0 31 30.0 32 49.0 33 85.0 34 138.0 35 353.0 36 2814.0 37 465.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.550000000000004 12.525 5.8500000000000005 43.075 2 17.990478576797795 13.304936106239037 38.53670759208219 30.16787772488098 3 16.8 16.325 28.9 37.974999999999994 4 22.725 24.55 24.25 28.475 5 22.475 30.85 25.674999999999997 21.0 6 18.925 34.325 25.55 21.2 7 15.475 26.125 40.550000000000004 17.849999999999998 8 17.599999999999998 27.400000000000002 30.8 24.2 9 17.275 21.95 36.675000000000004 24.099999999999998 10-14 20.07 29.345 27.095000000000002 23.49 15-19 20.59 27.955000000000002 27.445000000000004 24.01 20-24 20.615 27.99 27.985 23.41 25-29 20.495 28.255000000000003 27.800000000000004 23.45 30-34 20.119999999999997 28.775000000000002 27.435 23.669999999999998 35-39 20.655 28.435 27.155 23.755000000000003 40-44 20.215 28.98 27.46 23.345 45-49 20.855 28.325 26.43 24.39 50-54 20.724999999999998 27.68 27.810000000000002 23.785 55-59 20.375 28.355000000000004 27.834999999999997 23.435 60-64 21.16 27.794999999999998 27.985 23.06 65-69 20.3 28.425 27.584999999999997 23.69 70-74 20.785 28.04 27.560000000000002 23.615 75-79 20.59 28.125 28.000000000000004 23.285 80-84 20.599999999999998 28.345 27.250000000000004 23.805 85-89 20.61 28.720000000000002 26.795 23.875 90-94 22.0 27.66 27.01 23.330000000000002 95-99 20.68 28.749999999999996 27.045 23.525 100-104 21.04 28.83 26.945000000000004 23.185 105-109 21.395 28.505000000000003 26.384999999999998 23.715 110-114 21.15 28.87 25.985000000000003 23.995 115-119 21.385 28.715000000000003 25.77 24.13 120-124 21.685 28.849999999999998 25.6 23.865 125-129 21.51 28.58 25.785000000000004 24.125 130-134 21.77 28.810000000000002 25.55 23.87 135-139 21.46 27.955000000000002 26.035000000000004 24.55 140-144 21.41 28.025 25.230000000000004 25.335 145-149 22.11 27.24 25.89 24.759999999999998 150-151 22.287499999999998 26.637499999999996 25.912499999999998 25.162499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 3.0 25 8.0 26 8.0 27 7.0 28 7.0 29 6.0 30 17.0 31 22.5 32 26.5 33 35.0 34 46.5 35 71.5 36 76.5 37 85.0 38 114.0 39 160.5 40 192.0 41 212.0 42 212.5 43 225.5 44 259.0 45 265.0 46 265.0 47 267.0 48 266.0 49 215.5 50 182.0 51 156.0 52 117.0 53 95.5 54 80.0 55 74.5 56 65.5 57 50.5 58 31.0 59 23.5 60 19.0 61 8.5 62 3.0 63 3.0 64 4.0 65 2.5 66 2.0 67 2.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 82.60470804035464 67.55 2 13.634974014062978 22.3 3 2.751452155304188 6.75 4 0.9171507184347295 3.0 5 0.06114338122898196 0.25 6 0.03057169061449098 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAAC 6 0.15 No Hit CCAAACTTCACAATGCTTTTCTCTCCAGACCCTTCTTCTTTGTCCAAGCT 5 0.125 No Hit ACCTGATGCAACAAGTTGTCTACCATCCTCAGCCACATAGCTGCTGCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.4375 0.0 0.0 0.0 0.0 76-77 0.5625 0.0 0.0 0.0 0.0 78-79 0.675 0.0 0.0 0.0 0.0 80-81 0.7875 0.0 0.0 0.0 0.0 82-83 0.9625 0.0 0.0 0.0 0.0 84-85 1.4249999999999998 0.0 0.0 0.0 0.0 86-87 1.7999999999999998 0.0 0.0 0.0 0.0 88-89 2.25 0.0 0.0 0.0 0.0 90-91 2.45 0.0 0.0 0.0 0.0 92-93 2.85 0.0 0.0 0.0 0.0 94-95 3.575 0.0 0.0 0.0 0.0 96-97 4.3875 0.0 0.0 0.0 0.0 98-99 4.975 0.0 0.0 0.0 0.0 100-101 5.5625 0.0 0.0 0.0 0.0 102-103 6.1375 0.0 0.0 0.0 0.0 104-105 6.75 0.0 0.0 0.0 0.0 106-107 7.4 0.0 0.0 0.0 0.0 108-109 8.2 0.0 0.0 0.0 0.0 110-111 9.275 0.0 0.0 0.0 0.0 112-113 10.1125 0.0 0.0 0.0 0.0 114-115 10.975000000000001 0.0 0.0 0.0 0.0 116-117 11.875 0.0 0.0 0.0 0.0 118-119 12.825 0.0 0.0 0.0 0.0 120-121 13.6625 0.0 0.0 0.0 0.0 122-123 14.725000000000001 0.0 0.0 0.0 0.0 124-125 15.6875 0.0 0.0 0.0 0.0 126-127 16.6 0.0 0.0 0.0 0.0 128-129 17.762500000000003 0.0 0.0 0.0 0.0 130-131 19.15 0.0 0.0 0.0 0.0 132-133 20.475 0.0 0.0 0.0 0.0 134-135 21.8125 0.0 0.0 0.0 0.0 136-137 22.799999999999997 0.0 0.0 0.0 0.0 138-139 24.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670120 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670120_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.338 37.0 37.0 37.0 37.0 37.0 2 36.1965 37.0 37.0 37.0 37.0 37.0 3 36.2305 37.0 37.0 37.0 37.0 37.0 4 36.323 37.0 37.0 37.0 37.0 37.0 5 36.3055 37.0 37.0 37.0 37.0 37.0 6 36.3405 37.0 37.0 37.0 37.0 37.0 7 36.347 37.0 37.0 37.0 37.0 37.0 8 36.3985 37.0 37.0 37.0 37.0 37.0 9 36.4285 37.0 37.0 37.0 37.0 37.0 10-14 36.4008 37.0 37.0 37.0 37.0 37.0 15-19 36.426 37.0 37.0 37.0 37.0 37.0 20-24 36.3716 37.0 37.0 37.0 37.0 37.0 25-29 36.3243 37.0 37.0 37.0 37.0 37.0 30-34 36.302299999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.2998 37.0 37.0 37.0 37.0 37.0 40-44 36.222300000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.2906 37.0 37.0 37.0 37.0 37.0 50-54 36.2177 37.0 37.0 37.0 37.0 37.0 55-59 36.178 37.0 37.0 37.0 37.0 37.0 60-64 36.2099 37.0 37.0 37.0 37.0 37.0 65-69 36.1862 37.0 37.0 37.0 37.0 37.0 70-74 36.1028 37.0 37.0 37.0 37.0 37.0 75-79 36.076499999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.084199999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.0331 37.0 37.0 37.0 37.0 37.0 90-94 36.0507 37.0 37.0 37.0 37.0 37.0 95-99 35.952 37.0 37.0 37.0 37.0 37.0 100-104 35.9658 37.0 37.0 37.0 37.0 37.0 105-109 35.904700000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.80409999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.8026 37.0 37.0 37.0 37.0 37.0 120-124 35.6329 37.0 37.0 37.0 37.0 37.0 125-129 35.4525 37.0 37.0 37.0 37.0 37.0 130-134 35.2598 37.0 37.0 37.0 29.8 37.0 135-139 35.1334 37.0 37.0 37.0 29.8 37.0 140-144 34.858999999999995 37.0 37.0 37.0 25.0 37.0 145-149 34.5173 37.0 37.0 37.0 25.0 37.0 150-151 34.1945 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 0.0 16 2.0 17 2.0 18 0.0 19 1.0 20 0.0 21 2.0 22 0.0 23 1.0 24 3.0 25 5.0 26 9.0 27 11.0 28 12.0 29 19.0 30 28.0 31 49.0 32 70.0 33 110.0 34 244.0 35 553.0 36 2574.0 37 303.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.875 21.475 9.65 28.999999999999996 2 26.724999999999998 25.35 33.5 14.424999999999999 3 19.400000000000002 27.425 34.525 18.65 4 24.6 33.625 23.825 17.95 5 24.65 36.15 22.55 16.650000000000002 6 21.55 38.2 21.8 18.45 7 20.125 21.825 38.925 19.125 8 18.75 25.724999999999998 29.849999999999998 25.674999999999997 9 21.8 24.85 30.575000000000003 22.775000000000002 10-14 23.544999999999998 28.965000000000003 26.889999999999997 20.599999999999998 15-19 23.745 27.305 28.29 20.66 20-24 23.455000000000002 27.91 27.76 20.875 25-29 22.71 27.91 28.4 20.979999999999997 30-34 22.785 28.595 27.744999999999997 20.875 35-39 23.200000000000003 27.839999999999996 28.17 20.79 40-44 23.115 27.694999999999997 28.615000000000002 20.575 45-49 23.375 27.935 28.205000000000002 20.485 50-54 23.169999999999998 27.495000000000005 27.96 21.375 55-59 23.265 27.560000000000002 28.04 21.135 60-64 23.335 26.83 28.4 21.435000000000002 65-69 22.935 28.205000000000002 27.465 21.395 70-74 23.325000000000003 27.57 27.560000000000002 21.545 75-79 23.71 27.85 27.685 20.755000000000003 80-84 22.895 27.315 28.999999999999996 20.79 85-89 23.635 26.905 28.244999999999997 21.215 90-94 24.740000000000002 28.110000000000003 26.810000000000002 20.34 95-99 24.23 28.365000000000002 27.169999999999998 20.235 100-104 24.905 27.689999999999998 27.694999999999997 19.71 105-109 24.495 27.98 27.295 20.23 110-114 25.4 28.060000000000002 26.534999999999997 20.005 115-119 25.895000000000003 27.889999999999997 26.369999999999997 19.845 120-124 26.295 27.985 25.8 19.919999999999998 125-129 26.795 27.685 26.115 19.405 130-134 27.55 27.13 26.505000000000003 18.815 135-139 28.65 27.034999999999997 25.89 18.425 140-144 28.54 26.545 26.445 18.47 145-149 30.5 26.240000000000002 25.47 17.79 150-151 31.574999999999996 25.575 25.074999999999996 17.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.5 22 2.5 23 2.0 24 2.0 25 1.5 26 1.0 27 5.5 28 9.0 29 18.0 30 22.0 31 24.0 32 33.0 33 38.0 34 53.5 35 63.0 36 76.0 37 105.5 38 125.5 39 154.5 40 201.0 41 221.5 42 235.5 43 250.0 44 278.0 45 285.0 46 256.5 47 245.0 48 225.5 49 215.5 50 180.5 51 143.5 52 111.0 53 78.0 54 80.0 55 70.0 56 54.5 57 37.5 58 21.5 59 19.0 60 15.5 61 8.5 62 7.5 63 5.0 64 1.5 65 2.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 1.0 99 1.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.1 #Duplication Level Percentage of deduplicated Percentage of total 1 83.37393422655298 68.45 2 12.850182704019488 21.099999999999998 3 2.7710109622411694 6.825 4 0.8221680876979294 2.7 5 0.09135200974421437 0.375 6 0.06090133982947624 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.03045066991473812 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 10 0.25 No Hit GGGATTTCATGTGTTTGTACTGCAATGACAAGCGTCAACCTTTCAACAGC 6 0.15 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit CCTGATTTGGGATTATTTTCTCCTCCTAACTCAATAAGATCATGGTTTTT 5 0.125 No Hit GGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGC 5 0.125 No Hit GAAATGTTTCAAAAGATATTGGATGAAGCATTGGCAGGTGATAATGTTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.4375 0.0 0.0 0.0 0.0 76-77 0.5625 0.0 0.0 0.0 0.0 78-79 0.675 0.0 0.0 0.0 0.0 80-81 0.7875 0.0 0.0 0.0 0.0 82-83 0.9625 0.0 0.0 0.0 0.0 84-85 1.4249999999999998 0.0 0.0 0.0 0.0 86-87 1.7999999999999998 0.0 0.0 0.0 0.0 88-89 2.25 0.0 0.0 0.0 0.0 90-91 2.4749999999999996 0.0 0.0 0.0 0.0 92-93 2.875 0.0 0.0 0.0 0.0 94-95 3.5999999999999996 0.0 0.0 0.0 0.0 96-97 4.4125 0.0 0.0 0.0 0.0 98-99 5.0 0.0 0.0 0.0 0.0 100-101 5.5875 0.0 0.0 0.0 0.0 102-103 6.1625 0.0 0.0 0.0 0.0 104-105 6.775 0.0 0.0 0.0 0.0 106-107 7.425 0.0 0.0 0.0 0.0 108-109 8.225 0.0 0.0 0.0 0.0 110-111 9.3 0.0 0.0 0.0 0.0 112-113 10.1875 0.0 0.0 0.0 0.0 114-115 11.075 0.0 0.0 0.0 0.0 116-117 11.962499999999999 0.0 0.0 0.0 0.0 118-119 12.9 0.0 0.0 0.0 0.0 120-121 13.7375 0.0 0.0 0.0 0.0 122-123 14.8 0.0 0.0 0.0 0.0 124-125 15.7625 0.0 0.0 0.0 0.0 126-127 16.675 0.0 0.0 0.0 0.0 128-129 17.825 0.0 0.0 0.0 0.0 130-131 19.200000000000003 0.0 0.0 0.0 0.0 132-133 20.5375 0.0 0.0 0.0 0.0 134-135 21.9125 0.0 0.0 0.0 0.0 136-137 22.924999999999997 0.0 0.0 0.0 0.0 138-139 24.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCGTCT 10 0.006830828 145.0 6 >>END_MODULE Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655173 spots for SRR12670120.sra Written 655173 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra Read 655162 spots for SRR12670120.sra Written 655162 spots for SRR12670120.sra SRR ids: ['SRR12670120.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tpembvoo SRR12670120.sra spots: 13103251 blocks: [[1, 655162], [655163, 1310324], [1310325, 1965486], [1965487, 2620648], [2620649, 3275810], [3275811, 3930972], [3930973, 4586134], [4586135, 5241296], [5241297, 5896458], [5896459, 6551620], [6551621, 7206782], [7206783, 7861944], [7861945, 8517106], [8517107, 9172268], [9172269, 9827430], [9827431, 10482592], [10482593, 11137754], [11137755, 11792916], [11792917, 12448078], [12448079, 13103251]] SRR12670120 file size 4431357 SRR12670120 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670120 SRR12670120_1.fastq SRR12670120_2.fastq Input file: SRR12670120_1.fastq Paired file: SRR12670120_2.fastq trimmed: SRR12670120-trimmed-pair1.fastq, SRR12670120-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:06:46 2025 >> started Tue Feb 11 00:07:02 2025 >> done (15.382s) 13103251 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 2212 ( 0.02%) empty read pairs filtered out after trimming by size control 13100959 (99.98%) read pairs available; of these: 3742148 (28.56%) trimmed read pairs available after processing 9358811 (71.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 7 0.00% 21 8 0.00% 22 20 0.00% 23 18 0.00% 24 26 0.00% 25 34 0.00% 26 29 0.00% 27 43 0.00% 28 29 0.00% 29 48 0.00% 30 54 0.00% 31 60 0.00% 32 67 0.00% 33 74 0.00% 34 70 0.00% 35 70 0.00% 36 104 0.00% 37 101 0.00% 38 131 0.00% 39 124 0.00% 40 136 0.00% 41 153 0.00% 42 215 0.00% 43 177 0.00% 44 198 0.00% 45 234 0.00% 46 198 0.00% 47 287 0.00% 48 310 0.00% 49 402 0.00% 50 474 0.00% 51 499 0.00% 52 548 0.00% 53 582 0.00% 54 636 0.00% 55 619 0.00% 56 723 0.01% 57 877 0.01% 58 1040 0.01% 59 1214 0.01% 60 1456 0.01% 61 1662 0.01% 62 1835 0.01% 63 2173 0.02% 64 2278 0.02% 65 2498 0.02% 66 2705 0.02% 67 3056 0.02% 68 3451 0.03% 69 3812 0.03% 70 4528 0.03% 71 5239 0.04% 72 5944 0.05% 73 6711 0.05% 74 7586 0.06% 75 7956 0.06% 76 8580 0.07% 77 9483 0.07% 78 10021 0.08% 79 11339 0.09% 80 12514 0.10% 81 13999 0.11% 82 15729 0.12% 83 17317 0.13% 84 18658 0.14% 85 19824 0.15% 86 21418 0.16% 87 22028 0.17% 88 23715 0.18% 89 24994 0.19% 90 26822 0.20% 91 28617 0.22% 92 30504 0.23% 93 32994 0.25% 94 34927 0.27% 95 37276 0.28% 96 37776 0.29% 97 39288 0.30% 98 40110 0.31% 99 40872 0.31% 100 42724 0.33% 101 43435 0.33% 102 45148 0.34% 103 47816 0.36% 104 49398 0.38% 105 49918 0.38% 106 51254 0.39% 107 52351 0.40% 108 51789 0.40% 109 52996 0.40% 110 53285 0.41% 111 54051 0.41% 112 55503 0.42% 113 56605 0.43% 114 57980 0.44% 115 58909 0.45% 116 60839 0.46% 117 60533 0.46% 118 60948 0.47% 119 60941 0.47% 120 60730 0.46% 121 61665 0.47% 122 62213 0.47% 123 63379 0.48% 124 64049 0.49% 125 64781 0.49% 126 65150 0.50% 127 65467 0.50% 128 65260 0.50% 129 64107 0.49% 130 64435 0.49% 131 64187 0.49% 132 65185 0.50% 133 64595 0.49% 134 65826 0.50% 135 66197 0.51% 136 66208 0.51% 137 66764 0.51% 138 65566 0.50% 139 66569 0.51% 140 65691 0.50% 141 66211 0.51% 142 65965 0.50% 143 66050 0.50% 144 67002 0.51% 145 66482 0.51% 146 67055 0.51% 147 66454 0.51% 148 67373 0.51% 149 66345 0.51% 150 66423 0.51% 151 9358811 71.44% 13100959 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=24 prefix-density=0.47 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=21.58 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=7.2 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCGGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTGTA criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=22 prefix-density=0.62 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=39.89 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.4 sequence=CAATATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTATCATTGCCTTCTCTCCTTTATCCATGGCAGCTCGAGAATTGGTCGACTATGGAAAAGATAGCGTTACCGTCAATATCCCATCAACTGGCGATGTATCATCTAGAAGCCAGCCTCCTACCTATGCCCCACGAACTGGCAGTGGATGTAGCATTTACCAACGAGATTGTCCTAAGAAAAAACCTTGTAATCCTTACAAGCGTAGCTGCCATCGCCCTTGAAAATGAAAGAGTAGTTTGATTTGGGTCCATTATCTAGTGGTAAAAGCTGTGAGCTCAAAGCACCAGGGCTATCTATTACTTTCATTTCCATTACCAATGTAATTA SRR12670120 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:07:45 Started mapping on | Feb 11 00:07:45 Finished on | Feb 11 00:09:13 Mapping speed, Million of reads per hour | 535.95 Number of input reads | 13100959 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 12202182 Uniquely mapped reads % | 93.14% Average mapped length | 282.88 Number of splices: Total | 11673843 Number of splices: Annotated (sjdb) | 11423818 Number of splices: GT/AG | 11424348 Number of splices: GC/AG | 199075 Number of splices: AT/AC | 6656 Number of splices: Non-canonical | 43764 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298715 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 126384 % of reads mapped to too many loci | 0.96% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.43% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 600062 600062 600062 N_multimapping 298715 298715 298715 N_noFeature 527295 12000197 616539 N_ambiguous 185729 787 72470 UnstrandedReadsAssigned:11489158 PositiveStrandReadsAssigned:201198 NegativeStrandReadsAssigned:11513173 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=134 echo kmer=129 SRR12670120 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670120-trimmed-pair1.fastq SRR12670120-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,100,959 reads, 11,593,586 reads pseudoaligned [quant] estimated average fragment length: 199.342 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR12670120.ke.tsv 34699 SRR12670120.se.tsv 87100 total ==> SRR12670120.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1819.66 641 29.2314 Potri.005G024800.1.v4.1 1035 836.658 132 13.092 Potri.004G059700.1.v4.1 961 762.783 4 0.435151 Potri.007G009000.2.v4.1 1416 1217.66 0 0 Potri.003G141000.2.v4.1 2943 2744.66 662 20.0148 Potri.016G087400.1.v4.1 270 109.505 433.672 328.631 Potri.015G069301.1.v4.1 564 371.702 0 0 Potri.010G195200.1.v4.1 1773 1574.66 94 4.95362 Potri.012G127500.1.v4.1 977 778.727 29 3.09025 ==> SRR12670120.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 114 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 224 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12670120 completed mapping pipeline successfully