Starting /dee2/code/volunteer_pipeline.sh SRR12670122 current disk space = 3057469501440 free memory = 1461260076 SRR12670122 SRAfilesize 9d721268529c80da7fadc86a0ba88201 SRR12670122.sra SRR12670122.sra file validated SRR12670122 is paired end SRR12670122 is conventional basespace SRR12670122 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670122_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.612 37.0 37.0 37.0 37.0 37.0 2 36.46025 37.0 37.0 37.0 37.0 37.0 3 36.5075 37.0 37.0 37.0 37.0 37.0 4 36.6345 37.0 37.0 37.0 37.0 37.0 5 36.604 37.0 37.0 37.0 37.0 37.0 6 36.661 37.0 37.0 37.0 37.0 37.0 7 36.5875 37.0 37.0 37.0 37.0 37.0 8 36.615 37.0 37.0 37.0 37.0 37.0 9 36.572 37.0 37.0 37.0 37.0 37.0 10-14 36.629599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5967 37.0 37.0 37.0 37.0 37.0 20-24 36.581300000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.5464 37.0 37.0 37.0 37.0 37.0 30-34 36.529700000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.5393 37.0 37.0 37.0 37.0 37.0 40-44 36.481 37.0 37.0 37.0 37.0 37.0 45-49 36.484399999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.469899999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.4293 37.0 37.0 37.0 37.0 37.0 60-64 36.39889999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.3517 37.0 37.0 37.0 37.0 37.0 70-74 36.3531 37.0 37.0 37.0 37.0 37.0 75-79 36.358200000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.306200000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2715 37.0 37.0 37.0 37.0 37.0 90-94 36.2903 37.0 37.0 37.0 37.0 37.0 95-99 36.2823 37.0 37.0 37.0 37.0 37.0 100-104 36.3217 37.0 37.0 37.0 37.0 37.0 105-109 36.2926 37.0 37.0 37.0 37.0 37.0 110-114 36.1774 37.0 37.0 37.0 37.0 37.0 115-119 36.2176 37.0 37.0 37.0 37.0 37.0 120-124 36.123900000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.082800000000006 37.0 37.0 37.0 37.0 37.0 130-134 36.016200000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.902 37.0 37.0 37.0 37.0 37.0 140-144 35.6745 37.0 37.0 37.0 37.0 37.0 145-149 35.609500000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.39075 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 2.0 23 0.0 24 1.0 25 2.0 26 4.0 27 3.0 28 4.0 29 17.0 30 26.0 31 37.0 32 37.0 33 84.0 34 110.0 35 307.0 36 2939.0 37 425.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.5 11.125 7.5249999999999995 45.85 2 19.28768497617256 12.967143215450214 37.84800601956358 29.897165788813645 3 18.05 15.375 26.674999999999997 39.900000000000006 4 22.475 23.875 22.775000000000002 30.875000000000004 5 23.7 29.325000000000003 25.074999999999996 21.9 6 21.95 31.75 24.275 22.025 7 15.55 28.375 38.05 18.025 8 18.65 26.25 31.7 23.400000000000002 9 17.525 24.775 34.65 23.05 10-14 20.02 28.595 28.23 23.155 15-19 20.585 27.334999999999997 27.975 24.104999999999997 20-24 20.41 27.405 27.860000000000003 24.325 25-29 20.445 27.560000000000002 27.950000000000003 24.044999999999998 30-34 20.45 27.650000000000002 27.485 24.415 35-39 20.39 28.535 27.235 23.84 40-44 19.93 27.35 27.87 24.85 45-49 21.154999999999998 26.884999999999998 27.915 24.044999999999998 50-54 21.5 27.91 26.529999999999998 24.060000000000002 55-59 20.745 28.595 27.13 23.53 60-64 20.794999999999998 27.685 27.46 24.060000000000002 65-69 20.785 27.71 27.689999999999998 23.815 70-74 21.285 27.495000000000005 27.150000000000002 24.07 75-79 20.755000000000003 27.72 27.500000000000004 24.025 80-84 20.605 27.185 28.205000000000002 24.005000000000003 85-89 21.135 28.32 26.47 24.075 90-94 20.95 27.71 27.71 23.630000000000003 95-99 21.275 27.400000000000002 27.6 23.724999999999998 100-104 22.035 27.500000000000004 26.97 23.494999999999997 105-109 21.385 27.779999999999998 26.85 23.985 110-114 22.134999999999998 27.49 26.325 24.05 115-119 21.43 27.87 27.060000000000002 23.64 120-124 21.455 27.445000000000004 26.85 24.25 125-129 21.135 27.375 26.700000000000003 24.79 130-134 21.01 27.775 26.395000000000003 24.82 135-139 21.385 27.634999999999998 26.165 24.815 140-144 21.47 27.57 26.605 24.355 145-149 21.740000000000002 27.29 26.68 24.29 150-151 22.05 27.075 26.7625 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.5 24 1.5 25 0.5 26 1.5 27 3.0 28 7.0 29 7.5 30 6.5 31 13.5 32 20.0 33 22.5 34 35.0 35 57.0 36 73.5 37 95.0 38 115.5 39 128.5 40 160.0 41 204.5 42 225.5 43 243.5 44 258.5 45 275.0 46 294.5 47 275.5 48 233.0 49 209.0 50 210.5 51 186.0 52 137.5 53 109.5 54 89.5 55 71.0 56 65.0 57 47.0 58 34.5 59 29.0 60 18.5 61 12.5 62 7.5 63 5.5 64 2.0 65 1.0 66 2.5 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 82.24414303329223 66.7 2 13.625154130702835 22.1 3 3.082614056720099 7.5 4 0.8014796547472256 2.6 5 0.15413070283600494 0.625 6 0.06165228113440197 0.3 7 0.030826140567200986 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATGAGTTTTGATGATTCAGGCAATGATCTTCTAAAGTCTTGAAATTGTTT 7 0.17500000000000002 No Hit GCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAG 6 0.15 No Hit GCCTTTAAAATGCAAGTACCATAGCCAATGCAAGTCTAACTACAGTTAGT 6 0.15 No Hit TCCCAGACCTGCCAAGCACACCAAATGAGTTGCTCTCATCCAACAAAACA 5 0.125 No Hit GTTACAACCATGATTAAGATACCACCTTTTGCTATACAAAGTATGCCCGC 5 0.125 No Hit GTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTA 5 0.125 No Hit GCCTTATGATATGCACGAATAACCATAAGCCCAGCATACTCTCCAGCAGC 5 0.125 No Hit GGAGGTATTCTGCATCAGTCTGCCTAAATGCTTCAACAATTGCTGTCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.36250000000000004 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.5874999999999999 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.9624999999999999 0.0 0.0 0.0 0.0 88-89 1.1875 0.0 0.0 0.0 0.0 90-91 1.45 0.0 0.0 0.0 0.0 92-93 1.775 0.0 0.0 0.0 0.0 94-95 2.1125 0.0 0.0 0.0 0.0 96-97 2.525 0.0 0.0 0.0 0.0 98-99 3.0375 0.0 0.0 0.0 0.0 100-101 3.3875 0.0 0.0 0.0 0.0 102-103 3.8125 0.0 0.0 0.0 0.0 104-105 4.375 0.0 0.0 0.0 0.0 106-107 5.0625 0.0 0.0 0.0 0.0 108-109 5.5375 0.0 0.0 0.0 0.0 110-111 6.025 0.0 0.0 0.0 0.0 112-113 6.95 0.0 0.0 0.0 0.0 114-115 7.7 0.0 0.0 0.0 0.0 116-117 8.350000000000001 0.0 0.0 0.0 0.0 118-119 9.0625 0.0 0.0 0.0 0.0 120-121 9.6375 0.0 0.0 0.0 0.0 122-123 10.475 0.0 0.0 0.0 0.0 124-125 11.3125 0.0 0.0 0.0 0.0 126-127 12.225 0.0 0.0 0.0 0.0 128-129 12.8875 0.0 0.0 0.0 0.0 130-131 13.9 0.0 0.0 0.0 0.0 132-133 14.9625 0.0 0.0 0.0 0.0 134-135 15.95 0.0 0.0 0.0 0.0 136-137 16.8125 0.0 0.0 0.0 0.0 138-139 17.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTGCA 10 0.006830828 145.0 1 CATTCCA 10 0.006830828 145.0 4 >>END_MODULE SRR12670122 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670122_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3455 37.0 37.0 37.0 37.0 37.0 2 36.2845 37.0 37.0 37.0 37.0 37.0 3 36.2985 37.0 37.0 37.0 37.0 37.0 4 36.1905 37.0 37.0 37.0 37.0 37.0 5 36.3275 37.0 37.0 37.0 37.0 37.0 6 36.24 37.0 37.0 37.0 37.0 37.0 7 36.2205 37.0 37.0 37.0 37.0 37.0 8 36.4325 37.0 37.0 37.0 37.0 37.0 9 36.418 37.0 37.0 37.0 37.0 37.0 10-14 36.3785 37.0 37.0 37.0 37.0 37.0 15-19 36.366 37.0 37.0 37.0 37.0 37.0 20-24 36.2304 37.0 37.0 37.0 37.0 37.0 25-29 36.260000000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.2287 37.0 37.0 37.0 37.0 37.0 35-39 36.1161 37.0 37.0 37.0 37.0 37.0 40-44 36.193099999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.1653 37.0 37.0 37.0 37.0 37.0 50-54 36.1048 37.0 37.0 37.0 37.0 37.0 55-59 36.017 37.0 37.0 37.0 37.0 37.0 60-64 36.062 37.0 37.0 37.0 37.0 37.0 65-69 36.0305 37.0 37.0 37.0 37.0 37.0 70-74 35.9886 37.0 37.0 37.0 37.0 37.0 75-79 36.00449999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.9072 37.0 37.0 37.0 37.0 37.0 85-89 35.938599999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.928599999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.9339 37.0 37.0 37.0 37.0 37.0 100-104 35.81909999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.8092 37.0 37.0 37.0 37.0 37.0 110-114 35.7598 37.0 37.0 37.0 37.0 37.0 115-119 35.865700000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.662699999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.596599999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.4808 37.0 37.0 37.0 37.0 37.0 135-139 35.4276 37.0 37.0 37.0 37.0 37.0 140-144 35.3162 37.0 37.0 37.0 37.0 37.0 145-149 34.9409 37.0 37.0 37.0 25.0 37.0 150-151 34.45 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 3.0 15 6.0 16 0.0 17 2.0 18 3.0 19 3.0 20 2.0 21 1.0 22 2.0 23 3.0 24 1.0 25 5.0 26 6.0 27 7.0 28 13.0 29 15.0 30 16.0 31 47.0 32 50.0 33 93.0 34 210.0 35 613.0 36 2625.0 37 271.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.175 22.975 10.0 31.85 2 26.875 27.6 29.15 16.375 3 21.075 28.7 29.925 20.3 4 22.8 35.05 22.900000000000002 19.25 5 25.5 35.725 21.8 16.975 6 20.724999999999998 39.85 21.975 17.45 7 20.375 23.724999999999998 36.725 19.175 8 20.7 25.424999999999997 29.7 24.175 9 23.225 24.775 28.4 23.599999999999998 10-14 23.18 29.099999999999998 25.995 21.725 15-19 23.435 28.395 27.045 21.125 20-24 23.055 29.215000000000003 26.51 21.22 25-29 23.275000000000002 28.175 26.845000000000002 21.705 30-34 23.630000000000003 28.110000000000003 27.445000000000004 20.815 35-39 23.265 28.52 26.55 21.665 40-44 23.325000000000003 28.860000000000003 27.150000000000002 20.665 45-49 23.135 27.450000000000003 27.07 22.345000000000002 50-54 23.715 28.084999999999997 26.86 21.34 55-59 23.315 27.79 27.72 21.175 60-64 23.59 28.055000000000003 27.26 21.095 65-69 23.895 26.965 27.555000000000003 21.584999999999997 70-74 24.385 26.905 27.185 21.525 75-79 22.575 27.975 27.365000000000002 22.085 80-84 23.625 27.939999999999998 26.540000000000003 21.895 85-89 23.630000000000003 28.79 26.365 21.215 90-94 23.915 27.915 27.01 21.16 95-99 24.779999999999998 27.634999999999998 26.875 20.71 100-104 24.515 28.03 26.39 21.065 105-109 24.695 27.935 26.685 20.685000000000002 110-114 25.929999999999996 27.215 26.815 20.04 115-119 25.19 27.855 26.46 20.495 120-124 25.365 28.18 25.845000000000002 20.61 125-129 26.424999999999997 27.334999999999997 26.165 20.075000000000003 130-134 26.52 26.93 26.3 20.25 135-139 26.845000000000002 27.634999999999998 26.174999999999997 19.345000000000002 140-144 27.400000000000002 26.82 26.435 19.345000000000002 145-149 28.199999999999996 26.72 25.169999999999998 19.91 150-151 28.025 27.712500000000002 26.737499999999997 17.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 2.5 28 4.0 29 6.5 30 7.0 31 5.0 32 10.0 33 25.5 34 34.5 35 58.5 36 92.0 37 100.0 38 118.0 39 164.0 40 195.0 41 207.5 42 228.5 43 251.0 44 265.0 45 289.5 46 290.0 47 249.0 48 230.5 49 224.5 50 202.0 51 157.5 52 119.5 53 100.0 54 86.5 55 71.0 56 48.0 57 41.5 58 31.5 59 17.0 60 13.0 61 9.5 62 6.5 63 4.5 64 3.0 65 1.0 66 1.0 67 1.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 1.0 96 1.0 97 1.5 98 1.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.025 #Duplication Level Percentage of deduplicated Percentage of total 1 82.59796359148412 66.925 2 13.14409132983647 21.3 3 3.1163221228016047 7.575 4 0.8022215365627894 2.6 5 0.12341869793273681 0.5 6 0.154273372415921 0.75 7 0.061709348966368406 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACGAACTGACGATGATAAGATAAGCCACAAAAGCACGCGCTAACACTCT 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACA 6 0.15 No Hit GCAAGCTGAAAGCATAGCAACATATAATTACTGTGTTTTCCAGTCCAGGC 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit CAAGATAGAGAGGAGATAAGATATAGACACTTGTTATAGGCTATCTTGCA 6 0.15 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit CATGGGCTTGCCAGCAAAATCCAGGCTTGCTTCAACCTGCAACATCTAAG 5 0.125 No Hit TGCATAGGCTGCAATCAAAAGATCTTTCTTTGTGTCACAGTATGATTCCA 5 0.125 No Hit AAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTT 5 0.125 No Hit CTCCACTTCTCCTCCTTCCCCAGTCGGGGATGACGTCGACGCCCAGCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.36250000000000004 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.5874999999999999 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.9624999999999999 0.0 0.0 0.0 0.0 88-89 1.1875 0.0 0.0 0.0 0.0 90-91 1.45 0.0 0.0 0.0 0.0 92-93 1.775 0.0 0.0 0.0 0.0 94-95 2.1125 0.0 0.0 0.0 0.0 96-97 2.525 0.0 0.0 0.0 0.0 98-99 3.0375 0.0 0.0 0.0 0.0 100-101 3.375 0.0 0.0 0.0 0.0 102-103 3.7875 0.0 0.0 0.0 0.0 104-105 4.325 0.0 0.0 0.0 0.0 106-107 4.987500000000001 0.0 0.0 0.0 0.0 108-109 5.4625 0.0 0.0 0.0 0.0 110-111 5.9875 0.0 0.0 0.0 0.0 112-113 6.925 0.0 0.0 0.0 0.0 114-115 7.675 0.0 0.0 0.0 0.0 116-117 8.325 0.0 0.0 0.0 0.0 118-119 9.05 0.0 0.0 0.0 0.0 120-121 9.649999999999999 0.0 0.0 0.0 0.0 122-123 10.5 0.0 0.0 0.0 0.0 124-125 11.3125 0.0 0.0 0.0 0.0 126-127 12.1875 0.0 0.0 0.0 0.0 128-129 12.8625 0.0 0.0 0.0 0.0 130-131 13.8625 0.0 0.0 0.0 0.0 132-133 14.8625 0.0 0.0 0.0 0.0 134-135 15.85 0.0 0.0 0.0 0.0 136-137 16.7125 0.0 0.0 0.0 0.0 138-139 17.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTAGAG 10 0.006830828 145.0 5 CGTGTAG 45 0.008957279 48.333332 145 TTCCTTA 30 0.0014437955 24.166668 140-144 TGTAGGG 30 0.0014437955 24.166668 125-129 GAGTGTT 35 0.0035366106 20.714287 135-139 GGAAAGA 40 0.0076550315 18.125 130-134 >>END_MODULE Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543991 spots for SRR12670122.sra Written 543991 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra Read 543990 spots for SRR12670122.sra Written 543990 spots for SRR12670122.sra SRR ids: ['SRR12670122.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_likt8zn1 SRR12670122.sra spots: 10879801 blocks: [[1, 543990], [543991, 1087980], [1087981, 1631970], [1631971, 2175960], [2175961, 2719950], [2719951, 3263940], [3263941, 3807930], [3807931, 4351920], [4351921, 4895910], [4895911, 5439900], [5439901, 5983890], [5983891, 6527880], [6527881, 7071870], [7071871, 7615860], [7615861, 8159850], [8159851, 8703840], [8703841, 9247830], [9247831, 9791820], [9791821, 10335810], [10335811, 10879801]] SRR12670122 file size 3675731 SRR12670122 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670122 SRR12670122_1.fastq SRR12670122_2.fastq Input file: SRR12670122_1.fastq Paired file: SRR12670122_2.fastq trimmed: SRR12670122-trimmed-pair1.fastq, SRR12670122-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:05:01 2025 >> started Tue Feb 11 00:05:14 2025 >> done (12.317s) 10879801 read pairs processed; of these: 47 ( 0.00%) short read pairs filtered out after trimming by size control 4458 ( 0.04%) empty read pairs filtered out after trimming by size control 10875296 (99.96%) read pairs available; of these: 2530496 (23.27%) trimmed read pairs available after processing 8344800 (76.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 10 0.00% 21 4 0.00% 22 5 0.00% 23 18 0.00% 24 17 0.00% 25 20 0.00% 26 17 0.00% 27 18 0.00% 28 48 0.00% 29 26 0.00% 30 38 0.00% 31 41 0.00% 32 47 0.00% 33 46 0.00% 34 38 0.00% 35 49 0.00% 36 69 0.00% 37 94 0.00% 38 80 0.00% 39 76 0.00% 40 105 0.00% 41 108 0.00% 42 103 0.00% 43 135 0.00% 44 121 0.00% 45 117 0.00% 46 135 0.00% 47 179 0.00% 48 192 0.00% 49 214 0.00% 50 268 0.00% 51 296 0.00% 52 348 0.00% 53 346 0.00% 54 372 0.00% 55 379 0.00% 56 408 0.00% 57 544 0.01% 58 647 0.01% 59 721 0.01% 60 805 0.01% 61 960 0.01% 62 1149 0.01% 63 1227 0.01% 64 1312 0.01% 65 1473 0.01% 66 1610 0.01% 67 1711 0.02% 68 1967 0.02% 69 2122 0.02% 70 2555 0.02% 71 2878 0.03% 72 3315 0.03% 73 3695 0.03% 74 4203 0.04% 75 4485 0.04% 76 4820 0.04% 77 5318 0.05% 78 5733 0.05% 79 6248 0.06% 80 7065 0.06% 81 8041 0.07% 82 8796 0.08% 83 9621 0.09% 84 10981 0.10% 85 12147 0.11% 86 12617 0.12% 87 13422 0.12% 88 13938 0.13% 89 14665 0.13% 90 15718 0.14% 91 17083 0.16% 92 17857 0.16% 93 19711 0.18% 94 21089 0.19% 95 22438 0.21% 96 23662 0.22% 97 24215 0.22% 98 24692 0.23% 99 25741 0.24% 100 26420 0.24% 101 26740 0.25% 102 28436 0.26% 103 29650 0.27% 104 30564 0.28% 105 32098 0.30% 106 33269 0.31% 107 33349 0.31% 108 33838 0.31% 109 34661 0.32% 110 34748 0.32% 111 35489 0.33% 112 36737 0.34% 113 37119 0.34% 114 38589 0.35% 115 39580 0.36% 116 40184 0.37% 117 41478 0.38% 118 41267 0.38% 119 41094 0.38% 120 41732 0.38% 121 42642 0.39% 122 42526 0.39% 123 42735 0.39% 124 43753 0.40% 125 44125 0.41% 126 44925 0.41% 127 46066 0.42% 128 45309 0.42% 129 45310 0.42% 130 45903 0.42% 131 45438 0.42% 132 46034 0.42% 133 46397 0.43% 134 46878 0.43% 135 46874 0.43% 136 47287 0.43% 137 47533 0.44% 138 48274 0.44% 139 48916 0.45% 140 48486 0.45% 141 47974 0.44% 142 48554 0.45% 143 48231 0.44% 144 49117 0.45% 145 49357 0.45% 146 49181 0.45% 147 48920 0.45% 148 49454 0.45% 149 49422 0.45% 150 50243 0.46% 151 8344800 76.73% 10875296 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=25 prefix-density=0.50 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=144.07 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=12.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=28 prefix-density=0.65 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=30 fanout-score=19.34 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=4.6 sequence=GCTGCTGTTTCTATCCCATCTTTCACCGGTCTTAAGGCAG SRR12670122 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:05:55 Started mapping on | Feb 11 00:05:55 Finished on | Feb 11 00:07:09 Mapping speed, Million of reads per hour | 529.07 Number of input reads | 10875296 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 10278388 Uniquely mapped reads % | 94.51% Average mapped length | 287.00 Number of splices: Total | 10228381 Number of splices: Annotated (sjdb) | 10020815 Number of splices: GT/AG | 10021718 Number of splices: GC/AG | 174451 Number of splices: AT/AC | 6190 Number of splices: Non-canonical | 26022 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250247 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 57135 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.51% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 346661 346661 346661 N_multimapping 250247 250247 250247 N_noFeature 281856 10127982 332521 N_ambiguous 159401 586 59315 UnstrandedReadsAssigned:9837131 PositiveStrandReadsAssigned:149820 NegativeStrandReadsAssigned:9886552 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR12670122 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670122-trimmed-pair1.fastq SRR12670122-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,875,296 reads, 9,915,209 reads pseudoaligned [quant] estimated average fragment length: 216.16 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 997 rounds 52401 SRR12670122.ke.tsv 34699 SRR12670122.se.tsv 87100 total ==> SRR12670122.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.84 277 14.5536 Potri.005G024800.1.v4.1 1035 819.84 68 7.85645 Potri.004G059700.1.v4.1 961 745.884 0 0 Potri.007G009000.2.v4.1 1416 1200.84 0 0 Potri.003G141000.2.v4.1 2943 2727.84 519 18.0217 Potri.016G087400.1.v4.1 270 103.348 428 392.275 Potri.015G069301.1.v4.1 564 356.148 0 0 Potri.010G195200.1.v4.1 1773 1557.84 11 0.668831 Potri.012G127500.1.v4.1 977 761.868 140 17.4058 ==> SRR12670122.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 176 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 132 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12670122 completed mapping pipeline successfully