Starting /dee2/code/volunteer_pipeline.sh SRR12670123 current disk space = 3057390432256 free memory = 1239527196 SRR12670123 SRAfilesize 39296ad348060398e0e3a3d0154b0a29 SRR12670123.sra SRR12670123.sra file validated SRR12670123 is paired end SRR12670123 is conventional basespace SRR12670123 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670123_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.636 37.0 37.0 37.0 37.0 37.0 2 36.435 37.0 37.0 37.0 37.0 37.0 3 36.6115 37.0 37.0 37.0 37.0 37.0 4 36.5915 37.0 37.0 37.0 37.0 37.0 5 36.677 37.0 37.0 37.0 37.0 37.0 6 36.66 37.0 37.0 37.0 37.0 37.0 7 36.62 37.0 37.0 37.0 37.0 37.0 8 36.5915 37.0 37.0 37.0 37.0 37.0 9 36.589 37.0 37.0 37.0 37.0 37.0 10-14 36.6102 37.0 37.0 37.0 37.0 37.0 15-19 36.575599999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.5397 37.0 37.0 37.0 37.0 37.0 25-29 36.5358 37.0 37.0 37.0 37.0 37.0 30-34 36.4855 37.0 37.0 37.0 37.0 37.0 35-39 36.5025 37.0 37.0 37.0 37.0 37.0 40-44 36.480599999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.4017 37.0 37.0 37.0 37.0 37.0 50-54 36.4212 37.0 37.0 37.0 37.0 37.0 55-59 36.3952 37.0 37.0 37.0 37.0 37.0 60-64 36.379900000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.3183 37.0 37.0 37.0 37.0 37.0 70-74 36.2796 37.0 37.0 37.0 37.0 37.0 75-79 36.3007 37.0 37.0 37.0 37.0 37.0 80-84 36.327200000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.2849 37.0 37.0 37.0 37.0 37.0 90-94 36.2885 37.0 37.0 37.0 37.0 37.0 95-99 36.2066 37.0 37.0 37.0 37.0 37.0 100-104 36.2358 37.0 37.0 37.0 37.0 37.0 105-109 36.205799999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.2261 37.0 37.0 37.0 37.0 37.0 115-119 36.1765 37.0 37.0 37.0 37.0 37.0 120-124 36.0483 37.0 37.0 37.0 37.0 37.0 125-129 36.0 37.0 37.0 37.0 37.0 37.0 130-134 35.9166 37.0 37.0 37.0 37.0 37.0 135-139 35.8024 37.0 37.0 37.0 37.0 37.0 140-144 35.5673 37.0 37.0 37.0 37.0 37.0 145-149 35.486599999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.2485 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 4.0 25 3.0 26 6.0 27 4.0 28 9.0 29 15.0 30 20.0 31 34.0 32 46.0 33 75.0 34 146.0 35 322.0 36 2905.0 37 409.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.75 12.775 6.775 41.699999999999996 2 20.180270405608415 13.069604406609914 36.905358037055585 29.84476715072609 3 16.475 15.75 27.025 40.75 4 21.3 23.875 23.525 31.3 5 23.05 30.0 25.25 21.7 6 22.400000000000002 33.300000000000004 24.325 19.975 7 16.400000000000002 25.924999999999997 39.375 18.3 8 17.45 24.675 32.375 25.5 9 16.6 24.325 35.85 23.225 10-14 19.325 29.01 27.525 24.14 15-19 20.07 27.400000000000002 27.755000000000003 24.775 20-24 20.815 27.215 27.915 24.055 25-29 20.025000000000002 27.384999999999998 28.23 24.36 30-34 20.115 27.315 27.92 24.65 35-39 20.645 27.21 27.73 24.415 40-44 20.905 27.87 28.21 23.015 45-49 20.830000000000002 27.57 28.115000000000002 23.485 50-54 20.68 27.345000000000002 27.595 24.38 55-59 19.43 27.42 28.375 24.775 60-64 20.505000000000003 27.450000000000003 27.785 24.26 65-69 20.595 27.79 28.12 23.494999999999997 70-74 20.395 27.865000000000002 27.375 24.365000000000002 75-79 20.825 27.37 27.439999999999998 24.365000000000002 80-84 20.990000000000002 27.834999999999997 27.555000000000003 23.62 85-89 21.529999999999998 27.529999999999998 26.66 24.279999999999998 90-94 21.77 27.639999999999997 27.02 23.57 95-99 21.98 27.775 26.57 23.674999999999997 100-104 21.525 27.750000000000004 26.995 23.73 105-109 21.68 27.68 26.755000000000003 23.885 110-114 21.78 27.79 26.384999999999998 24.044999999999998 115-119 21.625 28.09 25.979999999999997 24.305 120-124 21.525 27.27 26.05 25.155 125-129 21.645 28.315 25.525 24.515 130-134 21.490000000000002 27.089999999999996 26.384999999999998 25.035 135-139 21.465 27.944999999999997 25.755 24.834999999999997 140-144 22.03 27.6 25.555 24.815 145-149 22.415 26.900000000000002 25.72 24.965 150-151 22.975 26.375 25.4875 25.162499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.5 26 2.5 27 2.5 28 5.0 29 7.5 30 5.5 31 8.0 32 23.0 33 32.0 34 32.5 35 51.5 36 68.5 37 79.0 38 105.5 39 139.0 40 168.5 41 182.5 42 237.0 43 277.0 44 272.0 45 274.0 46 276.5 47 268.5 48 254.0 49 237.0 50 196.0 51 157.5 52 129.5 53 112.0 54 102.0 55 75.5 56 50.0 57 45.5 58 40.0 59 27.5 60 15.0 61 8.5 62 6.0 63 4.5 64 4.5 65 4.5 66 4.0 67 2.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 82.08164537239016 65.85 2 12.994702399501401 20.849999999999998 3 3.5213462137737612 8.475000000000001 4 1.090682455593643 3.5000000000000004 5 0.28046120286693677 1.125 6 0.0 0.0 7 0.0 0.0 8 0.03116235587410408 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGGTGTTTCCGGCAGCATCAAGGGCATCAGTTCTCTCTCGGATTCTGTG 8 0.2 No Hit GCCCTAACCGATTTAATCACCGCAATTCTAACATTACTGGGCACTTCCTC 5 0.125 No Hit CACACTCTGAACACACTGTGTCTCCTGCTGAATGGTCGCATACTACCTCT 5 0.125 No Hit GGTAACTTCAACCTCAACACCAGGTTCAATTGTGATAGAGGTGATCTGCT 5 0.125 No Hit TCTTGAGTAGAGCCTGTAATTTTCAGCAAACTTGATGTGACGTACCACAA 5 0.125 No Hit GGTTCTTCGACTTTTTCCCTTTCTGGTACGTGTATGGCCTGCTGTTATCA 5 0.125 No Hit GTTCAATATGTAAATTAGGCTTTTGTGGCTTCAACTGGGGTTTTGGCCCT 5 0.125 No Hit GAATTAGGCTCGTGGAAGCAATTATATCCGGAATCTCCCCACGATACACC 5 0.125 No Hit AACCTTTCCAAAGCCACCAACCCCAAGAACCAAACTCTCAGTGAAGTTAT 5 0.125 No Hit AACAGGTTAGTCCAGGATAATAAGACATCCAAAGCATACTAAATTCCTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.5 0.0 0.0 0.0 0.0 76-77 0.6875 0.0 0.0 0.0 0.0 78-79 0.9375 0.0 0.0 0.0 0.0 80-81 1.1375000000000002 0.0 0.0 0.0 0.0 82-83 1.5750000000000002 0.0 0.0 0.0 0.0 84-85 1.9125 0.0 0.0 0.0 0.0 86-87 2.3875 0.0 0.0 0.0 0.0 88-89 2.7625 0.0 0.0 0.0 0.0 90-91 3.1875 0.0 0.0 0.0 0.0 92-93 3.6500000000000004 0.0 0.0 0.0 0.0 94-95 4.125 0.0 0.0 0.0 0.0 96-97 4.7125 0.0 0.0 0.0 0.0 98-99 5.375 0.0 0.0 0.0 0.0 100-101 5.9625 0.0 0.0 0.0 0.0 102-103 6.7875 0.0 0.0 0.0 0.0 104-105 7.675000000000001 0.0 0.0 0.0 0.0 106-107 8.55 0.0 0.0 0.0 0.0 108-109 9.4375 0.0 0.0 0.0 0.0 110-111 10.0375 0.0 0.0 0.0 0.0 112-113 10.7875 0.0 0.0 0.0 0.0 114-115 11.9125 0.0 0.0 0.0 0.0 116-117 12.8875 0.0 0.0 0.0 0.0 118-119 13.75 0.0 0.0 0.0 0.0 120-121 14.825 0.0 0.0 0.0 0.0 122-123 15.7125 0.0 0.0 0.0 0.0 124-125 16.7125 0.0 0.0 0.0 0.0 126-127 17.8 0.0 0.0 0.0 0.0 128-129 18.6875 0.0 0.0 0.0 0.0 130-131 19.7875 0.0 0.0 0.0 0.0 132-133 20.6 0.0 0.0 0.0 0.0 134-135 21.8125 0.0 0.0 0.0 0.0 136-137 22.7875 0.0 0.0 0.0 0.0 138-139 23.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCATCC 10 0.006830828 145.0 3 GAAATGT 10 0.006830828 145.0 3 TTTCTCA 10 0.006830828 145.0 145 CATCCAC 10 0.006830828 145.0 5 TGTCATC 10 0.006830828 145.0 7 CGAAATG 10 0.006830828 145.0 2 TCATCAG 10 0.006830828 145.0 9 GCATCCA 10 0.006830828 145.0 4 AAATGTC 10 0.006830828 145.0 4 CCGAAAT 10 0.006830828 145.0 1 ACTCCAG 95 0.007278115 15.263159 145 CAGTCAC 70 7.343502E-4 14.5 140-144 AGTCACA 70 7.343502E-4 14.5 140-144 >>END_MODULE SRR12670123 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670123_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4435 37.0 37.0 37.0 37.0 37.0 2 36.323 37.0 37.0 37.0 37.0 37.0 3 36.311 37.0 37.0 37.0 37.0 37.0 4 36.3825 37.0 37.0 37.0 37.0 37.0 5 36.496 37.0 37.0 37.0 37.0 37.0 6 36.3875 37.0 37.0 37.0 37.0 37.0 7 36.3875 37.0 37.0 37.0 37.0 37.0 8 36.4405 37.0 37.0 37.0 37.0 37.0 9 36.407 37.0 37.0 37.0 37.0 37.0 10-14 36.4035 37.0 37.0 37.0 37.0 37.0 15-19 36.400200000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.380100000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.3575 37.0 37.0 37.0 37.0 37.0 30-34 36.327600000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.30200000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.227000000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.266099999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.207499999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.2039 37.0 37.0 37.0 37.0 37.0 60-64 36.1928 37.0 37.0 37.0 37.0 37.0 65-69 36.1808 37.0 37.0 37.0 37.0 37.0 70-74 36.1368 37.0 37.0 37.0 37.0 37.0 75-79 36.1297 37.0 37.0 37.0 37.0 37.0 80-84 36.0963 37.0 37.0 37.0 37.0 37.0 85-89 36.1174 37.0 37.0 37.0 37.0 37.0 90-94 36.1262 37.0 37.0 37.0 37.0 37.0 95-99 36.0552 37.0 37.0 37.0 37.0 37.0 100-104 36.00750000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.983799999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.8958 37.0 37.0 37.0 37.0 37.0 115-119 35.851099999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.711400000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.60340000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.418499999999995 37.0 37.0 37.0 34.6 37.0 135-139 35.2919 37.0 37.0 37.0 37.0 37.0 140-144 35.0065 37.0 37.0 37.0 25.0 37.0 145-149 34.6937 37.0 37.0 37.0 25.0 37.0 150-151 34.26525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 2.0 18 1.0 19 1.0 20 4.0 21 0.0 22 3.0 23 1.0 24 8.0 25 5.0 26 8.0 27 7.0 28 10.0 29 17.0 30 25.0 31 38.0 32 63.0 33 125.0 34 177.0 35 487.0 36 2672.0 37 342.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.9 21.75 10.85 30.5 2 26.3 27.575 29.549999999999997 16.575 3 19.475 29.849999999999998 31.874999999999996 18.8 4 24.349999999999998 33.4 23.65 18.6 5 26.275 36.225 21.0 16.5 6 22.15 36.95 21.95 18.95 7 20.8 23.425 36.575 19.2 8 22.075 26.35 27.1 24.474999999999998 9 21.25 25.575 29.525000000000002 23.65 10-14 23.494999999999997 28.965000000000003 26.345000000000002 21.195 15-19 23.115 28.485 27.35 21.05 20-24 23.395 28.33 26.810000000000002 21.465 25-29 23.044999999999998 27.735 27.905 21.315 30-34 22.99 28.16 27.62 21.23 35-39 23.605 28.139999999999997 26.995 21.26 40-44 23.150000000000002 27.72 27.845 21.285 45-49 22.505 27.855 28.115000000000002 21.525 50-54 23.405 28.18 26.740000000000002 21.675 55-59 23.36 28.249999999999996 27.24 21.15 60-64 22.825 27.839999999999996 27.634999999999998 21.7 65-69 23.04 27.54 27.565 21.855 70-74 23.195 27.765 26.745 22.295 75-79 23.25 27.565 27.32 21.865000000000002 80-84 23.555 28.325 26.21 21.91 85-89 24.22 27.950000000000003 26.674999999999997 21.154999999999998 90-94 24.47 27.46 26.840000000000003 21.23 95-99 24.675 28.655 26.229999999999997 20.44 100-104 24.705 28.294999999999998 26.66 20.34 105-109 24.779999999999998 28.26 26.505000000000003 20.455000000000002 110-114 26.27 28.560000000000002 25.080000000000002 20.09 115-119 26.05 28.42 25.840000000000003 19.689999999999998 120-124 26.755000000000003 28.970000000000002 24.945 19.33 125-129 26.815 28.9 25.295 18.990000000000002 130-134 27.675 27.46 25.490000000000002 19.375 135-139 28.37 27.52 25.0 19.11 140-144 28.67 26.919999999999998 25.840000000000003 18.57 145-149 29.615000000000002 27.189999999999998 25.124999999999996 18.07 150-151 29.325000000000003 26.825 25.324999999999996 18.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 1.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 2.5 19 2.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 2.5 26 3.0 27 2.0 28 3.0 29 2.5 30 6.0 31 12.5 32 14.0 33 22.0 34 31.0 35 45.5 36 70.0 37 84.5 38 111.0 39 165.0 40 217.0 41 224.5 42 219.0 43 270.0 44 298.0 45 285.5 46 279.0 47 260.5 48 232.0 49 208.5 50 177.5 51 143.5 52 121.0 53 103.0 54 100.5 55 83.0 56 47.5 57 32.5 58 31.0 59 29.0 60 24.0 61 10.0 62 3.0 63 2.5 64 1.5 65 1.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 1.0 94 0.5 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 79.825 #Duplication Level Percentage of deduplicated Percentage of total 1 81.61603507673034 65.14999999999999 2 13.435640463513938 21.45 3 3.4137175070466643 8.175 4 1.252740369558409 4.0 5 0.18791105543376135 0.75 6 0.06263701847792046 0.3 7 0.03131850923896023 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit CTTAGACTCTATATCCTCAAGAAGTTCGGAGGTGAAAGTCATTATTGTTG 6 0.15 No Hit CTCCACTGTTCTGATGACTATTGGAGTTGCCATTGTTAGTTGGATTGCTC 6 0.15 No Hit CCTACCAAGGTTCTTAACATTACCACCAGGAAATCCCCTTGTGGTGAAGG 5 0.125 No Hit GGTGGCTACTATTGGCATTACCGATCATGCTCAGGACCATTTGGGTGAAG 5 0.125 No Hit CGTGGGTGTCGCGCCAGGGGCTGCAGCTGATGCGGGAGCAGCAGTGGTAG 5 0.125 No Hit GTGGTAGGAAGCTCACCTGCTCTTACCCTGGCATCAAATTCTCCTATGGG 5 0.125 No Hit TGCCGTTTCGGGAGTCGAAACTTTTCGTTCCAATGGTAAATTGCAAAATC 5 0.125 No Hit GGGTGGAAGATTTCCTTGATGATGATAACAGCAGGCCATACACGTACCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.45 0.0 0.0 0.0 0.0 76-77 0.6375 0.0 0.0 0.0 0.0 78-79 0.8875 0.0 0.0 0.0 0.0 80-81 1.0875 0.0 0.0 0.0 0.0 82-83 1.525 0.0 0.0 0.0 0.0 84-85 1.8375 0.0 0.0 0.0 0.0 86-87 2.3125 0.0 0.0 0.0 0.0 88-89 2.6875 0.0 0.0 0.0 0.0 90-91 3.1125 0.0 0.0 0.0 0.0 92-93 3.575 0.0 0.0 0.0 0.0 94-95 4.05 0.0 0.0 0.0 0.0 96-97 4.625 0.0 0.0 0.0 0.0 98-99 5.275 0.0 0.0 0.0 0.0 100-101 5.8625 0.0 0.0 0.0 0.0 102-103 6.6875 0.0 0.0 0.0 0.0 104-105 7.574999999999999 0.0 0.0 0.0 0.0 106-107 8.4375 0.0 0.0 0.0 0.0 108-109 9.3125 0.0 0.0 0.0 0.0 110-111 9.9375 0.0 0.0 0.0 0.0 112-113 10.7375 0.0 0.0 0.0 0.0 114-115 11.8625 0.0 0.0 0.0 0.0 116-117 12.875 0.0 0.0 0.0 0.0 118-119 13.725000000000001 0.0 0.0 0.0 0.0 120-121 14.8 0.0 0.0 0.0 0.0 122-123 15.6875 0.0 0.0 0.0 0.0 124-125 16.674999999999997 0.0 0.0 0.0 0.0 126-127 17.762500000000003 0.0 0.0 0.0 0.0 128-129 18.6375 0.0 0.0 0.0 0.0 130-131 19.725 0.0 0.0 0.0 0.0 132-133 20.55 0.0 0.0 0.0 0.0 134-135 21.7875 0.0 0.0 0.0 0.0 136-137 22.7625 0.0 0.0 0.0 0.0 138-139 23.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTCTT 10 0.006830828 145.0 5 TCGACTC 10 0.006830828 145.0 7 GGTCTTG 10 0.006830828 145.0 6 TTCGACT 10 0.006830828 145.0 6 ATGGTCT 15 1.1411342E-4 145.0 4 CTGATGG 10 0.006830828 145.0 1 TATTTCG 10 0.006830828 145.0 3 GACTCGG 10 0.006830828 145.0 9 ATTTCGA 10 0.006830828 145.0 4 CGACTCG 10 0.006830828 145.0 8 TTTCGAC 10 0.006830828 145.0 5 GATGGTC 25 8.7132835E-4 87.0 3 GAAAGAG 95 0.007278115 15.263159 145 GAGTGTA 75 0.0012377208 13.533334 140-144 AGTGTAC 75 0.0012377208 13.533334 140-144 >>END_MODULE Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636370 spots for SRR12670123.sra Written 636370 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra Read 636369 spots for SRR12670123.sra Written 636369 spots for SRR12670123.sra SRR ids: ['SRR12670123.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c1_31zzo SRR12670123.sra spots: 12727381 blocks: [[1, 636369], [636370, 1272738], [1272739, 1909107], [1909108, 2545476], [2545477, 3181845], [3181846, 3818214], [3818215, 4454583], [4454584, 5090952], [5090953, 5727321], [5727322, 6363690], [6363691, 7000059], [7000060, 7636428], [7636429, 8272797], [8272798, 8909166], [8909167, 9545535], [9545536, 10181904], [10181905, 10818273], [10818274, 11454642], [11454643, 12091011], [12091012, 12727381]] SRR12670123 file size 4303620 SRR12670123 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670123 SRR12670123_1.fastq SRR12670123_2.fastq Input file: SRR12670123_1.fastq Paired file: SRR12670123_2.fastq trimmed: SRR12670123-trimmed-pair1.fastq, SRR12670123-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:57:56 2025 >> started Mon Feb 10 23:58:18 2025 >> done (21.320s) 12727381 read pairs processed; of these: 72 ( 0.00%) short read pairs filtered out after trimming by size control 12971 ( 0.10%) empty read pairs filtered out after trimming by size control 12714338 (99.90%) read pairs available; of these: 3537712 (27.82%) trimmed read pairs available after processing 9176626 (72.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 6 0.00% 21 3 0.00% 22 11 0.00% 23 8 0.00% 24 12 0.00% 25 33 0.00% 26 17 0.00% 27 35 0.00% 28 34 0.00% 29 41 0.00% 30 43 0.00% 31 52 0.00% 32 50 0.00% 33 83 0.00% 34 67 0.00% 35 94 0.00% 36 97 0.00% 37 81 0.00% 38 107 0.00% 39 133 0.00% 40 167 0.00% 41 190 0.00% 42 211 0.00% 43 239 0.00% 44 190 0.00% 45 247 0.00% 46 233 0.00% 47 272 0.00% 48 375 0.00% 49 435 0.00% 50 503 0.00% 51 609 0.00% 52 628 0.00% 53 708 0.01% 54 785 0.01% 55 776 0.01% 56 898 0.01% 57 1015 0.01% 58 1263 0.01% 59 1473 0.01% 60 1824 0.01% 61 2175 0.02% 62 2295 0.02% 63 2645 0.02% 64 2794 0.02% 65 2987 0.02% 66 3247 0.03% 67 3576 0.03% 68 4021 0.03% 69 4569 0.04% 70 5371 0.04% 71 6102 0.05% 72 6982 0.05% 73 7948 0.06% 74 8748 0.07% 75 9622 0.08% 76 10266 0.08% 77 10874 0.09% 78 11633 0.09% 79 12835 0.10% 80 14005 0.11% 81 15657 0.12% 82 17595 0.14% 83 19460 0.15% 84 21323 0.17% 85 23300 0.18% 86 24059 0.19% 87 24654 0.19% 88 26440 0.21% 89 26890 0.21% 90 28506 0.22% 91 30895 0.24% 92 32657 0.26% 93 35029 0.28% 94 37196 0.29% 95 38410 0.30% 96 40155 0.32% 97 40893 0.32% 98 40842 0.32% 99 42159 0.33% 100 43572 0.34% 101 43540 0.34% 102 46004 0.36% 103 47559 0.37% 104 49214 0.39% 105 50344 0.40% 106 51709 0.41% 107 51223 0.40% 108 51955 0.41% 109 52281 0.41% 110 51570 0.41% 111 51986 0.41% 112 53755 0.42% 113 53544 0.42% 114 55117 0.43% 115 56575 0.44% 116 57154 0.45% 117 57796 0.45% 118 57972 0.46% 119 56249 0.44% 120 56584 0.45% 121 57204 0.45% 122 56442 0.44% 123 57172 0.45% 124 57952 0.46% 125 57702 0.45% 126 59142 0.47% 127 58939 0.46% 128 58115 0.46% 129 58389 0.46% 130 58154 0.46% 131 57462 0.45% 132 56967 0.45% 133 57634 0.45% 134 57414 0.45% 135 58265 0.46% 136 59005 0.46% 137 58186 0.46% 138 57755 0.45% 139 58856 0.46% 140 57110 0.45% 141 56915 0.45% 142 57389 0.45% 143 56794 0.45% 144 57476 0.45% 145 56987 0.45% 146 57315 0.45% 147 56816 0.45% 148 57964 0.46% 149 56667 0.45% 150 56951 0.45% 151 9176626 72.18% 12714338 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=26 prefix-density=0.38 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=102.79 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=10.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTGT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=26 prefix-density=0.49 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=68.84 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=2.3 sequence=AGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12670123 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:58:59 Started mapping on | Feb 10 23:59:00 Finished on | Feb 11 00:00:31 Mapping speed, Million of reads per hour | 502.98 Number of input reads | 12714338 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 11982982 Uniquely mapped reads % | 94.25% Average mapped length | 282.55 Number of splices: Total | 11773701 Number of splices: Annotated (sjdb) | 11531889 Number of splices: GT/AG | 11540311 Number of splices: GC/AG | 192620 Number of splices: AT/AC | 7757 Number of splices: Non-canonical | 33013 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 3.03 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 281645 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 43136 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.10% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 449711 449711 449711 N_multimapping 281645 281645 281645 N_noFeature 308202 11800358 378980 N_ambiguous 181414 704 69142 UnstrandedReadsAssigned:11493366 PositiveStrandReadsAssigned:181920 NegativeStrandReadsAssigned:11534860 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=133 echo kmer=129 SRR12670123 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670123-trimmed-pair1.fastq SRR12670123-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,714,338 reads, 11,549,621 reads pseudoaligned [quant] estimated average fragment length: 209.02 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR12670123.ke.tsv 34699 SRR12670123.se.tsv 87100 total ==> SRR12670123.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.98 462 21.1805 Potri.005G024800.1.v4.1 1035 826.98 157 15.7533 Potri.004G059700.1.v4.1 961 753.048 6 0.661143 Potri.007G009000.2.v4.1 1416 1207.98 0 0 Potri.003G141000.2.v4.1 2943 2734.98 619 18.7803 Potri.016G087400.1.v4.1 270 110.634 668 501.018 Potri.015G069301.1.v4.1 564 363.471 0 0 Potri.010G195200.1.v4.1 1773 1564.98 46 2.43902 Potri.012G127500.1.v4.1 977 769.006 59 6.36633 ==> SRR12670123.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 75 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 204 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 8 SRR12670123 completed mapping pipeline successfully