Starting /dee2/code/volunteer_pipeline.sh SRR12670125 current disk space = 3057373921280 free memory = 1466022932 SRR12670125 SRAfilesize 86523a50c931994f0cd493e93cf6f94d SRR12670125.sra SRR12670125.sra file validated SRR12670125 is paired end SRR12670125 is conventional basespace SRR12670125 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670125_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6325 37.0 37.0 37.0 37.0 37.0 2 36.4275 37.0 37.0 37.0 37.0 37.0 3 36.4925 37.0 37.0 37.0 37.0 37.0 4 36.575 37.0 37.0 37.0 37.0 37.0 5 36.5955 37.0 37.0 37.0 37.0 37.0 6 36.611 37.0 37.0 37.0 37.0 37.0 7 36.5785 37.0 37.0 37.0 37.0 37.0 8 36.6225 37.0 37.0 37.0 37.0 37.0 9 36.5475 37.0 37.0 37.0 37.0 37.0 10-14 36.5685 37.0 37.0 37.0 37.0 37.0 15-19 36.5613 37.0 37.0 37.0 37.0 37.0 20-24 36.4829 37.0 37.0 37.0 37.0 37.0 25-29 36.467200000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4313 37.0 37.0 37.0 37.0 37.0 35-39 36.4517 37.0 37.0 37.0 37.0 37.0 40-44 36.4298 37.0 37.0 37.0 37.0 37.0 45-49 36.3445 37.0 37.0 37.0 37.0 37.0 50-54 36.346199999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.397 37.0 37.0 37.0 37.0 37.0 60-64 36.3721 37.0 37.0 37.0 37.0 37.0 65-69 36.2986 37.0 37.0 37.0 37.0 37.0 70-74 36.2445 37.0 37.0 37.0 37.0 37.0 75-79 36.2756 37.0 37.0 37.0 37.0 37.0 80-84 36.276799999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.1999 37.0 37.0 37.0 37.0 37.0 90-94 36.206 37.0 37.0 37.0 37.0 37.0 95-99 36.1478 37.0 37.0 37.0 37.0 37.0 100-104 36.1054 37.0 37.0 37.0 37.0 37.0 105-109 36.1135 37.0 37.0 37.0 37.0 37.0 110-114 36.0275 37.0 37.0 37.0 37.0 37.0 115-119 36.023399999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.9073 37.0 37.0 37.0 37.0 37.0 125-129 35.752700000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.588 37.0 37.0 37.0 37.0 37.0 135-139 35.3271 37.0 37.0 37.0 34.6 37.0 140-144 34.902100000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.550200000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.183 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 5.0 26 7.0 27 6.0 28 13.0 29 18.0 30 32.0 31 48.0 32 75.0 33 123.0 34 166.0 35 374.0 36 2823.0 37 309.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.275000000000006 12.2 5.625 38.9 2 19.028542814221332 12.794191286930396 37.25588382573861 30.921382073109665 3 16.575 16.975 28.375 38.074999999999996 4 22.225 25.0 23.474999999999998 29.299999999999997 5 22.55 32.2 24.3 20.95 6 21.425 34.4 24.275 19.900000000000002 7 15.875 28.199999999999996 39.875 16.05 8 18.975 25.900000000000002 30.15 24.975 9 16.8 23.200000000000003 35.125 24.875 10-14 20.225 29.93 26.834999999999997 23.01 15-19 20.785 28.29 27.250000000000004 23.674999999999997 20-24 20.445 27.985 27.779999999999998 23.79 25-29 20.335 28.455000000000002 27.63 23.580000000000002 30-34 20.244999999999997 28.13 27.750000000000004 23.875 35-39 20.845 27.91 27.325 23.919999999999998 40-44 20.71 28.235 27.515 23.54 45-49 20.355 27.655 28.02 23.97 50-54 20.78 28.22 27.665 23.335 55-59 20.39 28.535 27.725 23.35 60-64 21.125 27.38 28.02 23.474999999999998 65-69 20.580000000000002 27.860000000000003 27.605 23.955000000000002 70-74 21.185000000000002 27.655 27.36 23.799999999999997 75-79 21.245 27.93 27.35 23.474999999999998 80-84 21.099999999999998 27.735 27.644999999999996 23.52 85-89 21.16 28.015 27.045 23.78 90-94 21.69 28.294999999999998 26.085 23.93 95-99 21.105 29.265 26.125 23.505000000000003 100-104 21.665 28.884999999999998 25.905 23.544999999999998 105-109 21.425 28.42 26.534999999999997 23.62 110-114 21.365000000000002 27.87 26.795 23.97 115-119 20.880000000000003 28.044999999999998 26.924999999999997 24.15 120-124 21.605 27.88 25.94 24.575 125-129 21.165 27.334999999999997 26.534999999999997 24.965 130-134 21.39 27.47 26.405 24.735 135-139 21.89 26.784999999999997 26.83 24.495 140-144 21.94 26.705000000000002 26.43 24.925 145-149 21.875 26.5 26.340000000000003 25.285000000000004 150-151 22.55 26.737499999999997 26.450000000000003 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.5 23 3.0 24 5.0 25 6.0 26 4.0 27 4.5 28 6.0 29 6.5 30 9.0 31 15.0 32 22.5 33 33.5 34 51.5 35 64.5 36 70.0 37 80.0 38 114.5 39 149.0 40 184.0 41 212.0 42 217.5 43 244.0 44 262.0 45 264.5 46 266.0 47 262.5 48 242.5 49 207.5 50 194.5 51 180.0 52 139.0 53 109.0 54 93.0 55 65.0 56 49.0 57 40.5 58 33.5 59 28.0 60 20.5 61 16.0 62 8.5 63 3.5 64 3.0 65 2.5 66 2.5 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.95 #Duplication Level Percentage of deduplicated Percentage of total 1 82.85539963392313 67.9 2 13.45332519829164 22.05 3 2.6540573520439295 6.525 4 0.8846857840146432 2.9000000000000004 5 0.1525320317266626 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATG 5 0.125 No Hit GCTCATACCACTTGAACCCCTTGGTCTTTTCCAATCCGATGAATGTTACT 5 0.125 No Hit CCCATGGTTAGAGCAGCGGTGAGAGTTGTTTTGCCGTGGTCTACATGGCC 5 0.125 No Hit TTCAAATGCTGTTTAAGCTTGTTGGCAAATGTCAAATCTGTGCCATTTGG 5 0.125 No Hit CATATTCCTCGAGTTTAGAGTGGGCGAATGCACGATTAGCCCAGTAAACT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1375 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2625 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.3625 0.0 0.0 0.0 0.0 74-75 0.525 0.0 0.0 0.0 0.0 76-77 0.8125 0.0 0.0 0.0 0.0 78-79 0.9375 0.0 0.0 0.0 0.0 80-81 1.175 0.0 0.0 0.0 0.0 82-83 1.6375000000000002 0.0 0.0 0.0 0.0 84-85 2.0375 0.0 0.0 0.0 0.0 86-87 2.3375 0.0 0.0 0.0 0.0 88-89 2.85 0.0 0.0 0.0 0.0 90-91 3.475 0.0 0.0 0.0 0.0 92-93 4.0375 0.0 0.0 0.0 0.0 94-95 4.7125 0.0 0.0 0.0 0.0 96-97 5.425 0.0 0.0 0.0 0.0 98-99 6.4125 0.0 0.0 0.0 0.0 100-101 7.2375 0.0 0.0 0.0 0.0 102-103 7.9375 0.0 0.0 0.0 0.0 104-105 8.6375 0.0 0.0 0.0 0.0 106-107 9.5625 0.0 0.0 0.0 0.0 108-109 10.6875 0.0 0.0 0.0 0.0 110-111 11.5625 0.0 0.0 0.0 0.0 112-113 12.4375 0.0 0.0 0.0 0.0 114-115 13.4 0.0 0.0 0.0 0.0 116-117 14.45 0.0 0.0 0.0 0.0 118-119 15.6125 0.0 0.0 0.0 0.0 120-121 16.375 0.0 0.0 0.0 0.0 122-123 17.5375 0.0 0.0 0.0 0.0 124-125 18.35 0.0 0.0 0.0 0.0 126-127 19.2125 0.0 0.0 0.0 0.0 128-129 20.15 0.0 0.0 0.0 0.0 130-131 21.4 0.0 0.0 0.0 0.0 132-133 22.3875 0.0 0.0 0.0 0.0 134-135 23.4125 0.0 0.0 0.0 0.0 136-137 24.3125 0.0 0.0 0.0 0.0 138-139 25.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATCAA 10 0.006830828 145.0 145 >>END_MODULE SRR12670125 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670125_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.423 37.0 37.0 37.0 37.0 37.0 2 36.274 37.0 37.0 37.0 37.0 37.0 3 36.1895 37.0 37.0 37.0 37.0 37.0 4 36.297 37.0 37.0 37.0 37.0 37.0 5 36.3895 37.0 37.0 37.0 37.0 37.0 6 36.371 37.0 37.0 37.0 37.0 37.0 7 36.4035 37.0 37.0 37.0 37.0 37.0 8 36.3815 37.0 37.0 37.0 37.0 37.0 9 36.3975 37.0 37.0 37.0 37.0 37.0 10-14 36.3918 37.0 37.0 37.0 37.0 37.0 15-19 36.3696 37.0 37.0 37.0 37.0 37.0 20-24 36.3279 37.0 37.0 37.0 37.0 37.0 25-29 36.340700000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.2582 37.0 37.0 37.0 37.0 37.0 35-39 36.2801 37.0 37.0 37.0 37.0 37.0 40-44 36.2579 37.0 37.0 37.0 37.0 37.0 45-49 36.31570000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.1995 37.0 37.0 37.0 37.0 37.0 55-59 36.1494 37.0 37.0 37.0 37.0 37.0 60-64 36.1572 37.0 37.0 37.0 37.0 37.0 65-69 36.1819 37.0 37.0 37.0 37.0 37.0 70-74 36.107299999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.0937 37.0 37.0 37.0 37.0 37.0 80-84 36.0113 37.0 37.0 37.0 37.0 37.0 85-89 36.0475 37.0 37.0 37.0 37.0 37.0 90-94 36.02380000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.9774 37.0 37.0 37.0 37.0 37.0 100-104 35.871700000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.852500000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.7796 37.0 37.0 37.0 37.0 37.0 115-119 35.7181 37.0 37.0 37.0 37.0 37.0 120-124 35.4956 37.0 37.0 37.0 37.0 37.0 125-129 35.3606 37.0 37.0 37.0 37.0 37.0 130-134 34.9929 37.0 37.0 37.0 27.4 37.0 135-139 34.7856 37.0 37.0 37.0 25.0 37.0 140-144 34.3909 37.0 37.0 37.0 25.0 37.0 145-149 34.0699 37.0 37.0 37.0 25.0 37.0 150-151 33.891625000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 2.0 14 2.0 15 0.0 16 1.0 17 2.0 18 0.0 19 0.0 20 1.0 21 2.0 22 4.0 23 1.0 24 4.0 25 9.0 26 5.0 27 12.0 28 14.0 29 19.0 30 27.0 31 57.0 32 73.0 33 142.0 34 232.0 35 515.0 36 2565.0 37 307.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.725 25.575 8.1 25.6 2 26.875 25.575 31.1 16.45 3 19.525000000000002 26.775 32.95 20.75 4 22.675 34.275 24.175 18.875 5 24.474999999999998 37.075 21.224999999999998 17.224999999999998 6 20.95 38.025 22.8 18.224999999999998 7 20.674999999999997 21.875 38.175 19.275000000000002 8 21.099999999999998 27.1 27.925 23.875 9 21.425 25.874999999999996 30.175 22.525000000000002 10-14 23.52 29.445 26.525 20.51 15-19 23.630000000000003 28.005000000000003 27.365000000000002 21.0 20-24 23.77 28.16 27.145000000000003 20.925 25-29 22.665 29.020000000000003 27.555000000000003 20.76 30-34 23.044999999999998 28.615000000000002 27.43 20.91 35-39 22.53 28.185 28.199999999999996 21.085 40-44 22.7 28.255000000000003 27.715 21.33 45-49 22.95 27.48 28.410000000000004 21.16 50-54 22.445 27.97 28.08 21.505 55-59 22.785 27.57 27.944999999999997 21.7 60-64 23.86 27.735 27.315 21.09 65-69 22.84 27.589999999999996 28.205000000000002 21.365000000000002 70-74 23.655 26.72 27.825 21.8 75-79 23.355 27.3 27.32 22.025 80-84 23.73 26.955000000000002 27.779999999999998 21.535 85-89 23.849999999999998 27.93 26.529999999999998 21.69 90-94 24.52 26.88 27.42 21.18 95-99 24.759999999999998 27.515 26.369999999999997 21.355 100-104 24.785 27.465 26.575 21.175 105-109 25.445 27.855 26.69 20.01 110-114 25.900000000000002 28.055000000000003 26.455000000000002 19.59 115-119 26.565 28.175 25.595000000000002 19.665 120-124 27.065 27.62 25.94 19.375 125-129 27.395000000000003 27.605 25.785000000000004 19.215 130-134 27.74 26.86 26.445 18.955 135-139 28.895 25.814999999999998 26.484999999999996 18.805 140-144 29.054999999999996 26.305 26.045 18.595 145-149 30.058005800580055 26.227622762276226 25.71257125712571 18.001800180018 150-151 32.304038004750595 25.115639454931866 25.715714464308036 16.864608076009503 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 1.5 22 2.5 23 1.0 24 0.0 25 1.0 26 2.0 27 5.5 28 7.5 29 5.5 30 9.5 31 21.0 32 28.0 33 29.0 34 42.0 35 72.0 36 90.0 37 90.5 38 109.0 39 146.0 40 187.0 41 218.0 42 261.0 43 287.0 44 280.0 45 275.0 46 261.5 47 242.5 48 217.0 49 201.0 50 178.0 51 158.0 52 135.5 53 98.0 54 75.5 55 61.0 56 51.5 57 39.0 58 29.0 59 22.5 60 20.0 61 13.5 62 2.0 63 1.5 64 2.0 65 0.5 66 0.5 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 2.0 92 1.5 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 83.55123137731833 68.7 2 12.648221343873518 20.8 3 2.766798418972332 6.825 4 0.7905138339920948 2.6 5 0.15202189115232592 0.625 6 0.09121313469139557 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit CTTCCACCAGACTGGTGATGCCAAATATGGAAACTCAAAATTCTAACGTT 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit AGAACAAAACACATCCTCTCATACATTTCTCTCCCAATCAAGAAAACTCT 5 0.125 No Hit AAATTATGCGAATGAGAGATTACAGCAACACTTCAATCGTCATTTATTCA 5 0.125 No Hit GGGAGCCGAGAATGGCTGCAAGTGTGGAGCCAACTGTACCTGCGATCCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1375 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2625 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.3625 0.0 0.0 0.0 0.0 74-75 0.525 0.0 0.0 0.0 0.0 76-77 0.8125 0.0 0.0 0.0 0.0 78-79 0.9375 0.0 0.0 0.0 0.0 80-81 1.175 0.0 0.0 0.0 0.0 82-83 1.6375000000000002 0.0 0.0 0.0 0.0 84-85 2.0375 0.0 0.0 0.0 0.0 86-87 2.3375 0.0 0.0 0.0 0.0 88-89 2.85 0.0 0.0 0.0 0.0 90-91 3.475 0.0 0.0 0.0 0.0 92-93 4.0375 0.0 0.0 0.0 0.0 94-95 4.725 0.0 0.0 0.0 0.0 96-97 5.45 0.0 0.0 0.0 0.0 98-99 6.4625 0.0 0.0 0.0 0.0 100-101 7.3 0.0 0.0 0.0 0.0 102-103 8.0125 0.0 0.0 0.0 0.0 104-105 8.7125 0.0 0.0 0.0 0.0 106-107 9.649999999999999 0.0 0.0 0.0 0.0 108-109 10.7875 0.0 0.0 0.0 0.0 110-111 11.6625 0.0 0.0 0.0 0.0 112-113 12.5125 0.0 0.0 0.0 0.0 114-115 13.4875 0.0 0.0 0.0 0.0 116-117 14.5875 0.0 0.0 0.0 0.0 118-119 15.7625 0.0 0.0 0.0 0.0 120-121 16.5375 0.0 0.0 0.0 0.0 122-123 17.7125 0.0 0.0 0.0 0.0 124-125 18.55 0.0 0.0 0.0 0.0 126-127 19.425 0.0 0.0 0.0 0.0 128-129 20.387500000000003 0.0 0.0 0.0 0.0 130-131 21.6625 0.0 0.0 0.0 0.0 132-133 22.674999999999997 0.0 0.0 0.0 0.0 134-135 23.6875 0.0 0.0 0.0 0.0 136-137 24.5375 0.0 0.0 0.0 0.0 138-139 25.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATAAG 10 0.006830828 145.0 145 >>END_MODULE Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra Read 590379 spots for SRR12670125.sra Written 590379 spots for SRR12670125.sra Read 590362 spots for SRR12670125.sra Written 590362 spots for SRR12670125.sra SRR ids: ['SRR12670125.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mvf5711g SRR12670125.sra spots: 11807257 blocks: [[1, 590362], [590363, 1180724], [1180725, 1771086], [1771087, 2361448], [2361449, 2951810], [2951811, 3542172], [3542173, 4132534], [4132535, 4722896], [4722897, 5313258], [5313259, 5903620], [5903621, 6493982], [6493983, 7084344], [7084345, 7674706], [7674707, 8265068], [8265069, 8855430], [8855431, 9445792], [9445793, 10036154], [10036155, 10626516], [10626517, 11216878], [11216879, 11807257]] SRR12670125 file size 3990922 SRR12670125 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670125 SRR12670125_1.fastq SRR12670125_2.fastq Input file: SRR12670125_1.fastq Paired file: SRR12670125_2.fastq trimmed: SRR12670125-trimmed-pair1.fastq, SRR12670125-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:22:31 2025 >> started Tue Feb 11 00:22:45 2025 >> done (13.456s) 11807257 read pairs processed; of these: 44 ( 0.00%) short read pairs filtered out after trimming by size control 4390 ( 0.04%) empty read pairs filtered out after trimming by size control 11802823 (99.96%) read pairs available; of these: 3721843 (31.53%) trimmed read pairs available after processing 8080980 (68.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 7 0.00% 20 9 0.00% 21 14 0.00% 22 20 0.00% 23 17 0.00% 24 29 0.00% 25 39 0.00% 26 33 0.00% 27 45 0.00% 28 56 0.00% 29 61 0.00% 30 61 0.00% 31 69 0.00% 32 74 0.00% 33 75 0.00% 34 97 0.00% 35 88 0.00% 36 110 0.00% 37 126 0.00% 38 156 0.00% 39 156 0.00% 40 202 0.00% 41 188 0.00% 42 249 0.00% 43 248 0.00% 44 241 0.00% 45 264 0.00% 46 326 0.00% 47 362 0.00% 48 420 0.00% 49 540 0.00% 50 617 0.01% 51 630 0.01% 52 712 0.01% 53 776 0.01% 54 858 0.01% 55 968 0.01% 56 1058 0.01% 57 1145 0.01% 58 1446 0.01% 59 1592 0.01% 60 1986 0.02% 61 2174 0.02% 62 2553 0.02% 63 2791 0.02% 64 3049 0.03% 65 3191 0.03% 66 3478 0.03% 67 3961 0.03% 68 4366 0.04% 69 4928 0.04% 70 5983 0.05% 71 6563 0.06% 72 7699 0.07% 73 8563 0.07% 74 9355 0.08% 75 9891 0.08% 76 10740 0.09% 77 11782 0.10% 78 12656 0.11% 79 14042 0.12% 80 15100 0.13% 81 17441 0.15% 82 19402 0.16% 83 20816 0.18% 84 22960 0.19% 85 24348 0.21% 86 25268 0.21% 87 26096 0.22% 88 28182 0.24% 89 28649 0.24% 90 30851 0.26% 91 32957 0.28% 92 34577 0.29% 93 37801 0.32% 94 39806 0.34% 95 41523 0.35% 96 42194 0.36% 97 43415 0.37% 98 43653 0.37% 99 44436 0.38% 100 46036 0.39% 101 46514 0.39% 102 48980 0.41% 103 50639 0.43% 104 52041 0.44% 105 53518 0.45% 106 53945 0.46% 107 54161 0.46% 108 53685 0.45% 109 54780 0.46% 110 54294 0.46% 111 54761 0.46% 112 56618 0.48% 113 56588 0.48% 114 58753 0.50% 115 59598 0.50% 116 60181 0.51% 117 59861 0.51% 118 60299 0.51% 119 59367 0.50% 120 59559 0.50% 121 59966 0.51% 122 59892 0.51% 123 60878 0.52% 124 61309 0.52% 125 61643 0.52% 126 62182 0.53% 127 62003 0.53% 128 61288 0.52% 129 60808 0.52% 130 60940 0.52% 131 59888 0.51% 132 60192 0.51% 133 59908 0.51% 134 60344 0.51% 135 60781 0.51% 136 61243 0.52% 137 60039 0.51% 138 59902 0.51% 139 61280 0.52% 140 59101 0.50% 141 58943 0.50% 142 59325 0.50% 143 58546 0.50% 144 60022 0.51% 145 59443 0.50% 146 59442 0.50% 147 59222 0.50% 148 58982 0.50% 149 58100 0.49% 150 58643 0.50% 151 8080980 68.47% 11802823 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=28 prefix-density=0.44 prefix-fanout=2.0 sequence=TTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.13 sequence-density-rank=23 fanout-score=23.50 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=7.7 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=26 prefix-density=0.63 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=29.22 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=1.9 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12670125 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:23:38 Started mapping on | Feb 11 00:23:39 Finished on | Feb 11 00:24:48 Mapping speed, Million of reads per hour | 615.80 Number of input reads | 11802823 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 11162413 Uniquely mapped reads % | 94.57% Average mapped length | 279.69 Number of splices: Total | 10537614 Number of splices: Annotated (sjdb) | 10322908 Number of splices: GT/AG | 10314967 Number of splices: GC/AG | 179682 Number of splices: AT/AC | 6268 Number of splices: Non-canonical | 36697 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 263998 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 43604 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 376412 376412 376412 N_multimapping 263998 263998 263998 N_noFeature 363567 10989804 436541 N_ambiguous 164547 496 64634 UnstrandedReadsAssigned:10634299 PositiveStrandReadsAssigned:172113 NegativeStrandReadsAssigned:10661238 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=128 echo kmer=123 SRR12670125 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670125-trimmed-pair1.fastq SRR12670125-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,802,823 reads, 10,670,088 reads pseudoaligned [quant] estimated average fragment length: 196.446 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,010 rounds 52401 SRR12670125.ke.tsv 34699 SRR12670125.se.tsv 87100 total ==> SRR12670125.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1822.55 371 18.7614 Potri.005G024800.1.v4.1 1035 839.554 94 10.3193 Potri.004G059700.1.v4.1 961 765.613 1 0.120383 Potri.007G009000.2.v4.1 1416 1220.55 0 0 Potri.003G141000.2.v4.1 2943 2747.55 671.563 22.5275 Potri.016G087400.1.v4.1 270 113.986 413 333.941 Potri.015G069301.1.v4.1 564 375.41 0 0 Potri.010G195200.1.v4.1 1773 1577.55 49 2.86276 Potri.012G127500.1.v4.1 977 781.595 61 7.19317 ==> SRR12670125.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 171 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 174 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12670125 completed mapping pipeline successfully