Starting /dee2/code/volunteer_pipeline.sh SRR12670130 current disk space = 3057430827008 free memory = 1153103088 SRR12670130 SRAfilesize 22df5be77da80b24d5b12e85ccd0eda0 SRR12670130.sra SRR12670130.sra file validated SRR12670130 is paired end SRR12670130 is conventional basespace SRR12670130 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670130_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.614 37.0 37.0 37.0 37.0 37.0 2 36.52275 37.0 37.0 37.0 37.0 37.0 3 36.6595 37.0 37.0 37.0 37.0 37.0 4 36.659 37.0 37.0 37.0 37.0 37.0 5 36.589 37.0 37.0 37.0 37.0 37.0 6 36.6445 37.0 37.0 37.0 37.0 37.0 7 36.626 37.0 37.0 37.0 37.0 37.0 8 36.6265 37.0 37.0 37.0 37.0 37.0 9 36.6635 37.0 37.0 37.0 37.0 37.0 10-14 36.6376 37.0 37.0 37.0 37.0 37.0 15-19 36.6165 37.0 37.0 37.0 37.0 37.0 20-24 36.5409 37.0 37.0 37.0 37.0 37.0 25-29 36.559999999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.5509 37.0 37.0 37.0 37.0 37.0 35-39 36.4966 37.0 37.0 37.0 37.0 37.0 40-44 36.4798 37.0 37.0 37.0 37.0 37.0 45-49 36.482299999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.4742 37.0 37.0 37.0 37.0 37.0 55-59 36.4405 37.0 37.0 37.0 37.0 37.0 60-64 36.41369999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.439099999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.409800000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.370900000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.34740000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.3261 37.0 37.0 37.0 37.0 37.0 90-94 36.328500000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.3235 37.0 37.0 37.0 37.0 37.0 100-104 36.333800000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.2829 37.0 37.0 37.0 37.0 37.0 110-114 36.1704 37.0 37.0 37.0 37.0 37.0 115-119 36.187 37.0 37.0 37.0 37.0 37.0 120-124 36.0974 37.0 37.0 37.0 37.0 37.0 125-129 36.0075 37.0 37.0 37.0 37.0 37.0 130-134 35.9362 37.0 37.0 37.0 37.0 37.0 135-139 35.811099999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.678700000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.513600000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.42675 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 1.0 26 0.0 27 7.0 28 9.0 29 20.0 30 22.0 31 30.0 32 44.0 33 69.0 34 149.0 35 300.0 36 2909.0 37 439.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.125 10.174999999999999 8.200000000000001 42.5 2 19.36452339254441 13.034776082061548 36.47735801851388 31.123342506880157 3 18.275 18.425 26.825 36.475 4 21.8 26.275 22.425 29.5 5 22.625 32.824999999999996 23.275000000000002 21.275 6 18.925 35.225 25.074999999999996 20.775 7 14.649999999999999 24.9 42.525 17.925 8 19.6 23.849999999999998 31.275 25.275 9 17.150000000000002 23.275000000000002 35.725 23.849999999999998 10-14 19.935 28.605000000000004 27.465 23.995 15-19 20.32 28.015 27.87 23.794999999999998 20-24 20.835 27.625 28.275 23.265 25-29 20.119999999999997 27.839999999999996 27.235 24.805 30-34 20.73 28.115000000000002 28.18 22.975 35-39 19.439999999999998 28.12 27.785 24.654999999999998 40-44 20.805 27.79 27.865000000000002 23.54 45-49 20.91 27.775 27.68 23.635 50-54 21.445 27.575 27.305 23.674999999999997 55-59 20.53 28.299999999999997 27.325 23.845 60-64 20.71 28.244999999999997 27.810000000000002 23.235 65-69 21.279999999999998 28.065 27.415 23.24 70-74 20.75 28.439999999999998 27.705000000000002 23.105 75-79 20.65 28.035 27.450000000000003 23.865 80-84 20.925 27.834999999999997 27.584999999999997 23.655 85-89 20.72 28.075 27.57 23.635 90-94 20.855 27.779999999999998 27.435 23.93 95-99 20.805 28.044999999999998 27.474999999999998 23.674999999999997 100-104 21.095 28.305000000000003 27.52 23.080000000000002 105-109 21.695 28.294999999999998 26.669999999999998 23.34 110-114 21.654999999999998 28.560000000000002 26.57 23.215 115-119 22.27 27.955000000000002 26.61 23.165 120-124 22.09 27.37 26.534999999999997 24.005000000000003 125-129 21.625 28.015 26.465 23.895 130-134 22.02 27.615000000000002 26.445 23.919999999999998 135-139 22.375 28.175 25.540000000000003 23.91 140-144 22.765 27.925 26.135 23.175 145-149 22.42 27.57 25.705 24.305 150-151 22.7 27.250000000000004 25.8 24.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 2.0 26 2.0 27 3.0 28 7.5 29 11.0 30 12.5 31 16.0 32 26.5 33 39.5 34 43.5 35 48.5 36 67.0 37 98.0 38 124.5 39 157.5 40 175.0 41 187.5 42 229.5 43 264.5 44 290.5 45 298.5 46 261.0 47 228.0 48 242.0 49 225.0 50 193.0 51 169.5 52 126.0 53 102.0 54 86.5 55 56.5 56 42.5 57 47.5 58 36.5 59 24.5 60 21.5 61 15.0 62 7.0 63 2.5 64 1.5 65 0.5 66 1.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 79.975 #Duplication Level Percentage of deduplicated Percentage of total 1 81.4316974054392 65.125 2 13.597999374804626 21.75 3 3.7511722413254143 9.0 4 1.031572366364489 3.3000000000000003 5 0.15629884338855893 0.625 6 0.0 0.0 7 0.0 0.0 8 0.03125976867771178 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAGATGCCTTATCTGCTGATTTTGTTCTTTTGGACAGCTTTGCTTCAT 8 0.2 No Hit CAGGAGGTTTTGGTATGGTCCGACTCCGGTCACGAGACCTTGCACAAAGT 5 0.125 No Hit CACTTTTTTCAACACCAATCTCATTCCTTTCCCTCACAATCCCCTCAATC 5 0.125 No Hit TATGCAAAGCTAGCAACCCCTTCTGCGCCGCTGTATTTGGACATCTTTCC 5 0.125 No Hit CACCATTGTCATGAATTATCTTACATATCTCATCGATTCCTTCTTCATAG 5 0.125 No Hit GCCAGATACTGGTTCTTGAAATCTGTTTTTGGGTTTTACCCAATGAGGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.3875 0.0 0.0 0.0 0.0 72-73 0.6000000000000001 0.0 0.0 0.0 0.0 74-75 0.6875 0.0 0.0 0.0 0.0 76-77 0.7625 0.0 0.0 0.0 0.0 78-79 0.7875000000000001 0.0 0.0 0.0 0.0 80-81 0.9375 0.0 0.0 0.0 0.0 82-83 1.2375 0.0 0.0 0.0 0.0 84-85 1.4625 0.0 0.0 0.0 0.0 86-87 1.7875 0.0 0.0 0.0 0.0 88-89 2.0625 0.0 0.0 0.0 0.0 90-91 2.5125 0.0 0.0 0.0 0.0 92-93 2.8625 0.0 0.0 0.0 0.0 94-95 3.2874999999999996 0.0 0.0 0.0 0.0 96-97 3.7875 0.0 0.0 0.0 0.0 98-99 4.4875 0.0 0.0 0.0 0.0 100-101 5.05 0.0 0.0 0.0 0.0 102-103 5.7375 0.0 0.0 0.0 0.0 104-105 6.6625 0.0 0.0 0.0 0.0 106-107 7.3625 0.0 0.0 0.0 0.0 108-109 8.3375 0.0 0.0 0.0 0.0 110-111 9.3875 0.0 0.0 0.0 0.0 112-113 10.3 0.0 0.0 0.0 0.0 114-115 11.0 0.0 0.0 0.0 0.0 116-117 11.6625 0.0 0.0 0.0 0.0 118-119 12.45 0.0 0.0 0.0 0.0 120-121 13.3625 0.0 0.0 0.0 0.0 122-123 14.1625 0.0 0.0 0.0 0.0 124-125 14.8 0.0 0.0 0.0 0.0 126-127 15.4875 0.0 0.0 0.0 0.0 128-129 16.15 0.0 0.0 0.0 0.0 130-131 16.924999999999997 0.0 0.0 0.0 0.0 132-133 18.012500000000003 0.0 0.0 0.0 0.0 134-135 19.4375 0.0 0.0 0.0 0.0 136-137 20.55 0.0 0.0 0.0 0.0 138-139 21.512500000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTGTC 10 0.006830828 145.0 4 GATAATG 10 0.006830828 145.0 7 ATTGTCA 10 0.006830828 145.0 5 CCATTGT 10 0.006830828 145.0 3 AATTGAA 10 0.006830828 145.0 5 >>END_MODULE SRR12670130 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670130_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.351 37.0 37.0 37.0 37.0 37.0 2 36.205 37.0 37.0 37.0 37.0 37.0 3 36.1375 37.0 37.0 37.0 37.0 37.0 4 36.281 37.0 37.0 37.0 37.0 37.0 5 36.376 37.0 37.0 37.0 37.0 37.0 6 36.254 37.0 37.0 37.0 37.0 37.0 7 36.338 37.0 37.0 37.0 37.0 37.0 8 36.38 37.0 37.0 37.0 37.0 37.0 9 36.2385 37.0 37.0 37.0 37.0 37.0 10-14 36.297799999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.2844 37.0 37.0 37.0 37.0 37.0 20-24 36.200199999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.2189 37.0 37.0 37.0 37.0 37.0 30-34 36.18769999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.184200000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.156400000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.1907 37.0 37.0 37.0 37.0 37.0 50-54 36.0968 37.0 37.0 37.0 37.0 37.0 55-59 36.0889 37.0 37.0 37.0 37.0 37.0 60-64 36.0957 37.0 37.0 37.0 37.0 37.0 65-69 36.06830000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.054199999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.05159999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.971500000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.9106 37.0 37.0 37.0 37.0 37.0 90-94 35.9588 37.0 37.0 37.0 37.0 37.0 95-99 35.8268 37.0 37.0 37.0 37.0 37.0 100-104 35.7675 37.0 37.0 37.0 37.0 37.0 105-109 35.744499999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.696600000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.705200000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.576 37.0 37.0 37.0 37.0 37.0 125-129 35.3962 37.0 37.0 37.0 37.0 37.0 130-134 35.2082 37.0 37.0 37.0 32.2 37.0 135-139 35.142 37.0 37.0 37.0 29.8 37.0 140-144 34.8832 37.0 37.0 37.0 25.0 37.0 145-149 34.4752 37.0 37.0 37.0 25.0 37.0 150-151 34.170125 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 3.0 15 10.0 16 1.0 17 0.0 18 1.0 19 2.0 20 1.0 21 0.0 22 5.0 23 9.0 24 2.0 25 9.0 26 10.0 27 6.0 28 11.0 29 13.0 30 20.0 31 37.0 32 60.0 33 119.0 34 229.0 35 574.0 36 2636.0 37 239.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.875 20.674999999999997 11.65 27.800000000000004 2 26.200000000000003 27.250000000000004 30.275000000000002 16.275000000000002 3 20.95 27.950000000000003 31.8 19.3 4 24.349999999999998 35.275 21.75 18.625 5 24.3 36.25 22.05 17.4 6 20.25 38.65 22.8 18.3 7 19.85 22.45 37.925 19.775000000000002 8 21.45 25.4 28.199999999999996 24.95 9 21.275 24.8 31.275 22.650000000000002 10-14 23.085 29.57 25.775 21.57 15-19 23.145 28.255000000000003 27.310000000000002 21.29 20-24 22.675 28.125 28.389999999999997 20.810000000000002 25-29 22.67 28.165000000000003 27.77 21.395 30-34 23.21 27.51 27.900000000000002 21.38 35-39 22.56 28.375 26.995 22.07 40-44 23.06 28.33 27.63 20.979999999999997 45-49 22.755 27.88 28.215 21.15 50-54 23.215 28.735 27.42 20.630000000000003 55-59 22.985 27.750000000000004 27.405 21.86 60-64 23.255 28.035 27.37 21.34 65-69 22.445 28.095 28.07 21.39 70-74 22.895 28.275 27.145000000000003 21.685 75-79 23.375 29.054999999999996 26.22 21.349999999999998 80-84 23.09 27.805000000000003 27.994999999999997 21.11 85-89 23.72 28.575 26.334999999999997 21.37 90-94 23.9 28.205000000000002 26.83 21.065 95-99 23.419999999999998 27.99 27.43 21.16 100-104 24.52 28.78 26.075 20.625 105-109 24.875 28.470000000000002 26.305 20.349999999999998 110-114 25.44 28.765 26.105 19.689999999999998 115-119 26.240000000000002 28.645 25.34 19.775000000000002 120-124 26.135 28.625 26.26 18.98 125-129 27.32 27.98 25.655 19.045 130-134 28.349999999999998 27.465 25.75 18.435000000000002 135-139 28.46 27.465 26.125 17.95 140-144 29.235 26.57 26.275 17.919999999999998 145-149 30.073007300730076 26.587658765876586 25.16251625162516 18.176817681768178 150-151 29.678709838729837 26.465808226028255 25.890736342042754 17.96474559319915 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.5 13 1.5 14 1.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.5 20 2.0 21 1.0 22 0.5 23 0.5 24 1.0 25 2.5 26 3.5 27 7.0 28 8.5 29 6.5 30 11.0 31 18.5 32 28.5 33 33.5 34 40.0 35 65.0 36 82.0 37 93.5 38 132.0 39 170.5 40 195.0 41 234.0 42 247.0 43 253.5 44 277.5 45 284.5 46 270.5 47 234.5 48 208.0 49 202.5 50 189.5 51 157.5 52 118.0 53 88.5 54 77.0 55 67.0 56 49.5 57 31.0 58 23.5 59 19.0 60 11.0 61 10.5 62 10.5 63 4.5 64 0.5 65 0.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 1.0 78 1.0 79 0.5 80 0.5 81 0.0 82 1.0 83 1.0 84 0.5 85 0.5 86 0.0 87 0.5 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.5 95 0.5 96 0.5 97 1.0 98 0.5 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 82.08164537239016 65.85 2 13.025864755375508 20.9 3 3.5836709255219694 8.625 4 1.0283577438454348 3.3000000000000003 5 0.1869741352446245 0.75 6 0.03116235587410408 0.15 7 0.0 0.0 8 0.03116235587410408 0.2 9 0.03116235587410408 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 9 0.22499999999999998 No Hit GTTTTACAACAAAACCCAGGTTAACAACAGAGACTTGTCTATTGCTGTCC 8 0.2 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit AACCTCACTTATGTAACTATGCTTCTCTGCTTGTACATTTTTGCCTCTCT 5 0.125 No Hit GCAAGACCAACCCAGTCACCATTCGTGTCCTCAAGGAAAAGCTCTTTTGT 5 0.125 No Hit GACAACCTATCAGCACTTATGGTTACATATCCCTCAACTCACGGGGTCTA 5 0.125 No Hit ATTTCGAGCACAAGGAGCCAAGCAGCGGGCGAAGATTTTCAATTTATGGC 5 0.125 No Hit CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 5 0.125 No Hit GGGATCTGTTGAAGAGTGATGTTGATAATTGGATGAAGGAGGCTGATGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.3875 0.0 0.0 0.0 0.0 72-73 0.6000000000000001 0.0 0.0 0.0 0.0 74-75 0.6875 0.0 0.0 0.0 0.0 76-77 0.7625 0.0 0.0 0.0 0.0 78-79 0.7875000000000001 0.0 0.0 0.0 0.0 80-81 0.9375 0.0 0.0 0.0 0.0 82-83 1.2375 0.0 0.0 0.0 0.0 84-85 1.4625 0.0 0.0 0.0 0.0 86-87 1.7875 0.0 0.0 0.0 0.0 88-89 2.075 0.0 0.0 0.0 0.0 90-91 2.5374999999999996 0.0 0.0 0.0 0.0 92-93 2.9125 0.0 0.0 0.0 0.0 94-95 3.3375000000000004 0.0 0.0 0.0 0.0 96-97 3.8499999999999996 0.0 0.0 0.0 0.0 98-99 4.5875 0.0 0.0 0.0 0.0 100-101 5.15 0.0 0.0 0.0 0.0 102-103 5.85 0.0 0.0 0.0 0.0 104-105 6.8125 0.0 0.0 0.0 0.0 106-107 7.5125 0.0 0.0 0.0 0.0 108-109 8.5 0.0 0.0 0.0 0.0 110-111 9.5375 0.0 0.0 0.0 0.0 112-113 10.462499999999999 0.0 0.0 0.0 0.0 114-115 11.2 0.0 0.0 0.0 0.0 116-117 11.8875 0.0 0.0 0.0 0.0 118-119 12.675 0.0 0.0 0.0 0.0 120-121 13.5875 0.0 0.0 0.0 0.0 122-123 14.3875 0.0 0.0 0.0 0.0 124-125 15.025 0.0 0.0 0.0 0.0 126-127 15.712499999999999 0.0 0.0 0.0 0.0 128-129 16.375 0.0 0.0 0.0 0.0 130-131 17.1625 0.0 0.0 0.0 0.0 132-133 18.225 0.0 0.0 0.0 0.0 134-135 19.612499999999997 0.0 0.0 0.0 0.0 136-137 20.7125 0.0 0.0 0.0 0.0 138-139 21.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520317 spots for SRR12670130.sra Written 520317 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra Read 520303 spots for SRR12670130.sra Written 520303 spots for SRR12670130.sra SRR ids: ['SRR12670130.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lulsa8ka SRR12670130.sra spots: 10406074 blocks: [[1, 520303], [520304, 1040606], [1040607, 1560909], [1560910, 2081212], [2081213, 2601515], [2601516, 3121818], [3121819, 3642121], [3642122, 4162424], [4162425, 4682727], [4682728, 5203030], [5203031, 5723333], [5723334, 6243636], [6243637, 6763939], [6763940, 7284242], [7284243, 7804545], [7804546, 8324848], [8324849, 8845151], [8845152, 9365454], [9365455, 9885757], [9885758, 10406074]] SRR12670130 file size 3514738 SRR12670130 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670130 SRR12670130_1.fastq SRR12670130_2.fastq Input file: SRR12670130_1.fastq Paired file: SRR12670130_2.fastq trimmed: SRR12670130-trimmed-pair1.fastq, SRR12670130-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:46:29 2025 >> started Tue Feb 11 00:46:42 2025 >> done (12.660s) 10406074 read pairs processed; of these: 55 ( 0.00%) short read pairs filtered out after trimming by size control 4799 ( 0.05%) empty read pairs filtered out after trimming by size control 10401220 (99.95%) read pairs available; of these: 2612741 (25.12%) trimmed read pairs available after processing 7788479 (74.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 7 0.00% 21 9 0.00% 22 16 0.00% 23 18 0.00% 24 21 0.00% 25 30 0.00% 26 39 0.00% 27 30 0.00% 28 40 0.00% 29 41 0.00% 30 58 0.00% 31 65 0.00% 32 62 0.00% 33 62 0.00% 34 60 0.00% 35 83 0.00% 36 104 0.00% 37 99 0.00% 38 113 0.00% 39 143 0.00% 40 137 0.00% 41 173 0.00% 42 166 0.00% 43 175 0.00% 44 198 0.00% 45 194 0.00% 46 265 0.00% 47 270 0.00% 48 308 0.00% 49 400 0.00% 50 445 0.00% 51 530 0.01% 52 553 0.01% 53 589 0.01% 54 572 0.01% 55 689 0.01% 56 710 0.01% 57 760 0.01% 58 969 0.01% 59 1088 0.01% 60 1314 0.01% 61 1538 0.01% 62 1693 0.02% 63 1846 0.02% 64 1933 0.02% 65 2237 0.02% 66 2389 0.02% 67 2589 0.02% 68 2797 0.03% 69 3207 0.03% 70 3625 0.03% 71 4317 0.04% 72 4951 0.05% 73 5674 0.05% 74 6002 0.06% 75 6577 0.06% 76 6907 0.07% 77 7215 0.07% 78 7652 0.07% 79 8819 0.08% 80 9739 0.09% 81 10862 0.10% 82 12172 0.12% 83 13434 0.13% 84 14583 0.14% 85 15347 0.15% 86 16272 0.16% 87 16692 0.16% 88 17241 0.17% 89 17887 0.17% 90 19662 0.19% 91 21312 0.20% 92 22652 0.22% 93 24303 0.23% 94 25811 0.25% 95 26991 0.26% 96 27341 0.26% 97 27476 0.26% 98 28063 0.27% 99 28066 0.27% 100 29384 0.28% 101 30671 0.29% 102 32467 0.31% 103 33689 0.32% 104 34878 0.34% 105 35534 0.34% 106 35804 0.34% 107 35742 0.34% 108 36155 0.35% 109 35682 0.34% 110 36540 0.35% 111 37490 0.36% 112 38191 0.37% 113 39732 0.38% 114 40643 0.39% 115 41523 0.40% 116 41738 0.40% 117 41908 0.40% 118 41201 0.40% 119 41055 0.39% 120 41158 0.40% 121 41742 0.40% 122 42192 0.41% 123 43010 0.41% 124 44219 0.43% 125 44652 0.43% 126 45594 0.44% 127 44613 0.43% 128 44399 0.43% 129 43484 0.42% 130 43538 0.42% 131 42969 0.41% 132 44251 0.43% 133 44825 0.43% 134 45329 0.44% 135 45735 0.44% 136 46095 0.44% 137 46193 0.44% 138 45396 0.44% 139 45407 0.44% 140 44114 0.42% 141 43736 0.42% 142 44644 0.43% 143 44762 0.43% 144 45614 0.44% 145 46213 0.44% 146 46704 0.45% 147 46211 0.44% 148 46220 0.44% 149 44758 0.43% 150 45452 0.44% 151 7788479 74.88% 10401220 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=29 prefix-density=0.33 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=187.86 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=14.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=33 prefix-density=0.43 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=26 fanout-score=34.10 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=12.1 sequence=AAAGAAAAGAAAA SRR12670130 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:47:26 Started mapping on | Feb 11 00:47:27 Finished on | Feb 11 00:48:30 Mapping speed, Million of reads per hour | 594.36 Number of input reads | 10401220 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 9789532 Uniquely mapped reads % | 94.12% Average mapped length | 284.48 Number of splices: Total | 9380674 Number of splices: Annotated (sjdb) | 9183611 Number of splices: GT/AG | 9190496 Number of splices: GC/AG | 153655 Number of splices: AT/AC | 6182 Number of splices: Non-canonical | 30341 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 3.03 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 218290 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 38504 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.26% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 393398 393398 393398 N_multimapping 218290 218290 218290 N_noFeature 344909 9654918 394697 N_ambiguous 137714 522 52610 UnstrandedReadsAssigned:9306909 PositiveStrandReadsAssigned:134092 NegativeStrandReadsAssigned:9342225 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=138 echo kmer=133 SRR12670130 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670130-trimmed-pair1.fastq SRR12670130-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,401,220 reads, 9,352,779 reads pseudoaligned [quant] estimated average fragment length: 211.205 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,008 rounds 52401 SRR12670130.ke.tsv 34699 SRR12670130.se.tsv 87100 total ==> SRR12670130.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.79 334 19.789 Potri.005G024800.1.v4.1 1035 824.795 57 7.40212 Potri.004G059700.1.v4.1 961 750.866 1 0.142648 Potri.007G009000.2.v4.1 1416 1205.79 0 0 Potri.003G141000.2.v4.1 2943 2732.79 469 18.382 Potri.016G087400.1.v4.1 270 106.228 412 415.417 Potri.015G069301.1.v4.1 564 360.648 0 0 Potri.010G195200.1.v4.1 1773 1562.79 37 2.53587 Potri.012G127500.1.v4.1 977 766.828 28 3.911 ==> SRR12670130.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 61 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 134 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR12670130 completed mapping pipeline successfully