Starting /dee2/code/volunteer_pipeline.sh SRR12670131 current disk space = 3057402380288 free memory = 1139791596 SRR12670131 SRAfilesize 7578fda2e9bd2fa86db40bd76f9a7842 SRR12670131.sra SRR12670131.sra file validated SRR12670131 is paired end SRR12670131 is conventional basespace SRR12670131 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670131_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.604 37.0 37.0 37.0 37.0 37.0 2 36.453 37.0 37.0 37.0 37.0 37.0 3 36.6175 37.0 37.0 37.0 37.0 37.0 4 36.588 37.0 37.0 37.0 37.0 37.0 5 36.6585 37.0 37.0 37.0 37.0 37.0 6 36.6075 37.0 37.0 37.0 37.0 37.0 7 36.4905 37.0 37.0 37.0 37.0 37.0 8 36.545 37.0 37.0 37.0 37.0 37.0 9 36.574 37.0 37.0 37.0 37.0 37.0 10-14 36.6148 37.0 37.0 37.0 37.0 37.0 15-19 36.568 37.0 37.0 37.0 37.0 37.0 20-24 36.5612 37.0 37.0 37.0 37.0 37.0 25-29 36.5119 37.0 37.0 37.0 37.0 37.0 30-34 36.4651 37.0 37.0 37.0 37.0 37.0 35-39 36.4619 37.0 37.0 37.0 37.0 37.0 40-44 36.4317 37.0 37.0 37.0 37.0 37.0 45-49 36.3651 37.0 37.0 37.0 37.0 37.0 50-54 36.363600000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.3556 37.0 37.0 37.0 37.0 37.0 60-64 36.3154 37.0 37.0 37.0 37.0 37.0 65-69 36.2667 37.0 37.0 37.0 37.0 37.0 70-74 36.27470000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.227700000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.255700000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2578 37.0 37.0 37.0 37.0 37.0 90-94 36.2456 37.0 37.0 37.0 37.0 37.0 95-99 36.176 37.0 37.0 37.0 37.0 37.0 100-104 36.1817 37.0 37.0 37.0 37.0 37.0 105-109 36.1582 37.0 37.0 37.0 37.0 37.0 110-114 36.086 37.0 37.0 37.0 37.0 37.0 115-119 36.109899999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.9462 37.0 37.0 37.0 37.0 37.0 125-129 35.8035 37.0 37.0 37.0 37.0 37.0 130-134 35.671499999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.443 37.0 37.0 37.0 37.0 37.0 140-144 35.097500000000004 37.0 37.0 37.0 34.6 37.0 145-149 34.8105 37.0 37.0 37.0 27.4 37.0 150-151 34.34725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 1.0 25 1.0 26 7.0 27 10.0 28 6.0 29 23.0 30 35.0 31 52.0 32 74.0 33 109.0 34 143.0 35 336.0 36 2770.0 37 428.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.0 10.45 6.775 40.775 2 18.11122244488978 12.049098196392785 37.6503006012024 32.18937875751503 3 17.325 16.150000000000002 28.175 38.35 4 19.925 22.375 26.375 31.324999999999996 5 24.675 30.099999999999998 22.900000000000002 22.325 6 21.8 33.85 24.775 19.575 7 15.275 26.450000000000003 40.475 17.8 8 19.375 24.15 32.800000000000004 23.674999999999997 9 17.7 24.275 34.725 23.3 10-14 19.919999999999998 28.57 27.644999999999996 23.865 15-19 20.8 26.540000000000003 28.115000000000002 24.545 20-24 20.71 27.185 27.46 24.645 25-29 20.82 27.305 27.575 24.3 30-34 20.01 27.584999999999997 28.21 24.195 35-39 20.385 27.04 27.884999999999998 24.69 40-44 20.625 27.465 28.24 23.669999999999998 45-49 20.805 27.49 27.744999999999997 23.96 50-54 20.560000000000002 28.125 26.93 24.385 55-59 20.31 27.49 27.675 24.525 60-64 20.599999999999998 28.08 27.97 23.35 65-69 20.560000000000002 27.305 27.534999999999997 24.6 70-74 20.305 27.955000000000002 27.325 24.415 75-79 20.47 27.73 27.79 24.01 80-84 21.17 27.435 27.650000000000002 23.745 85-89 21.565 28.044999999999998 26.82 23.57 90-94 21.87 28.23 26.155 23.745 95-99 21.235 27.810000000000002 27.115000000000002 23.84 100-104 21.245 28.470000000000002 25.979999999999997 24.305 105-109 21.94 28.27 26.115 23.674999999999997 110-114 21.605 28.199999999999996 25.645 24.55 115-119 21.565 28.565 25.485000000000003 24.385 120-124 21.445 27.955000000000002 25.230000000000004 25.369999999999997 125-129 20.849999999999998 27.805000000000003 25.85 25.495 130-134 21.86 28.04 25.645 24.455 135-139 22.125 27.52 25.45 24.905 140-144 22.900000000000002 26.700000000000003 25.525 24.875 145-149 23.544999999999998 26.674999999999997 24.92 24.86 150-151 24.3625 26.25 24.6125 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 1.5 23 1.0 24 1.0 25 3.0 26 4.0 27 5.5 28 7.0 29 9.0 30 13.0 31 13.5 32 18.5 33 24.0 34 39.0 35 64.5 36 69.0 37 80.5 38 105.5 39 129.5 40 156.5 41 184.5 42 222.5 43 245.5 44 266.5 45 287.5 46 275.5 47 255.5 48 250.5 49 234.5 50 194.5 51 167.5 52 139.0 53 109.0 54 89.5 55 69.5 56 49.0 57 45.5 58 44.0 59 36.5 60 28.5 61 12.5 62 10.5 63 9.0 64 5.0 65 4.0 66 4.0 67 4.0 68 2.0 69 0.5 70 0.5 71 0.0 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.25 #Duplication Level Percentage of deduplicated Percentage of total 1 82.7076923076923 67.2 2 13.046153846153846 21.2 3 3.0153846153846153 7.35 4 0.9846153846153847 3.2 5 0.1846153846153846 0.75 6 0.06153846153846154 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCATCGTTGGCGAAAGGGTAGTCTTCGATTGTAAGTTTTAGGCCATGTGG 6 0.15 No Hit GGGGGCACTTCCAAGTTCAAACATGGCCCATGTAGGACGTGCATATTCCT 6 0.15 No Hit GTGGGTGATAACTTTGGCCTTTTTAAATGACCATGTGCTCCATTCTTTGA 5 0.125 No Hit CACACACCATCGCCACCATCTACCATCTATACATACATCCCATCATCCCA 5 0.125 No Hit CACCAATGTTCTTAAGACCAAGAACAACTCCAACACCAATTATGTGACCA 5 0.125 No Hit GGCCATTGTAGCACGTGTGTCGCCCAGGGCATAAGGGGCATGATGACTTG 5 0.125 No Hit ACTTAACTCACGCTGCTTTGCCACTTCTGGGATAGAGGTAGGCTTCTTAA 5 0.125 No Hit GTGATTGATAGAATTGTTAAACACAGTTGCTTTTGCTGATGACGGTGGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.23750000000000002 0.0 0.0 0.0 0.0 66-67 0.3 0.0 0.0 0.0 0.0 68-69 0.325 0.0 0.0 0.0 0.0 70-71 0.3875 0.0 0.0 0.0 0.0 72-73 0.4625 0.0 0.0 0.0 0.0 74-75 0.5875 0.0 0.0 0.0 0.0 76-77 0.7749999999999999 0.0 0.0 0.0 0.0 78-79 0.8999999999999999 0.0 0.0 0.0 0.0 80-81 1.15 0.0 0.0 0.0 0.0 82-83 1.3125 0.0 0.0 0.0 0.0 84-85 1.6875 0.0 0.0 0.0 0.0 86-87 1.975 0.0 0.0 0.0 0.0 88-89 2.4124999999999996 0.0 0.0 0.0 0.0 90-91 2.8499999999999996 0.0 0.0 0.0 0.0 92-93 3.4375 0.0 0.0 0.0 0.0 94-95 4.1125 0.0 0.0 0.0 0.0 96-97 4.6375 0.0 0.0 0.0 0.0 98-99 5.3125 0.0 0.0 0.0 0.0 100-101 6.0375 0.0 0.0 0.0 0.0 102-103 6.95 0.0 0.0 0.0 0.0 104-105 8.05 0.0 0.0 0.0 0.0 106-107 9.325 0.0 0.0 0.0 0.0 108-109 10.0125 0.0 0.0 0.0 0.0 110-111 11.037500000000001 0.0 0.0 0.0 0.0 112-113 11.975000000000001 0.0 0.0 0.0 0.0 114-115 12.875 0.0 0.0 0.0 0.0 116-117 13.875 0.0 0.0 0.0 0.0 118-119 14.975000000000001 0.0 0.0 0.0 0.0 120-121 15.825 0.0 0.0 0.0 0.0 122-123 16.85 0.0 0.0 0.0 0.0 124-125 17.9125 0.0 0.0 0.0 0.0 126-127 18.924999999999997 0.0 0.0 0.0 0.0 128-129 20.1 0.0 0.0 0.0 0.0 130-131 21.4625 0.0 0.0 0.0 0.0 132-133 22.5625 0.0 0.0 0.0 0.0 134-135 23.625 0.0 0.0 0.0 0.0 136-137 24.5375 0.0 0.0 0.0 0.0 138-139 25.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTTTA 10 0.006830828 145.0 9 TTATCTT 10 0.006830828 145.0 7 CGATCCT 10 0.006830828 145.0 9 >>END_MODULE SRR12670131 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670131_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.179 37.0 37.0 37.0 37.0 37.0 2 35.923 37.0 37.0 37.0 37.0 37.0 3 36.0555 37.0 37.0 37.0 37.0 37.0 4 36.0525 37.0 37.0 37.0 37.0 37.0 5 36.2405 37.0 37.0 37.0 37.0 37.0 6 36.2325 37.0 37.0 37.0 37.0 37.0 7 36.1925 37.0 37.0 37.0 37.0 37.0 8 36.104 37.0 37.0 37.0 37.0 37.0 9 36.1955 37.0 37.0 37.0 37.0 37.0 10-14 36.235 37.0 37.0 37.0 37.0 37.0 15-19 36.249199999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.199 37.0 37.0 37.0 37.0 37.0 25-29 36.2144 37.0 37.0 37.0 37.0 37.0 30-34 36.098299999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.1287 37.0 37.0 37.0 37.0 37.0 40-44 36.0911 37.0 37.0 37.0 37.0 37.0 45-49 36.129200000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.9698 37.0 37.0 37.0 37.0 37.0 55-59 35.979499999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.0041 37.0 37.0 37.0 37.0 37.0 65-69 36.0013 37.0 37.0 37.0 37.0 37.0 70-74 35.9748 37.0 37.0 37.0 37.0 37.0 75-79 35.9105 37.0 37.0 37.0 37.0 37.0 80-84 35.853300000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.8777 37.0 37.0 37.0 37.0 37.0 90-94 35.924 37.0 37.0 37.0 37.0 37.0 95-99 35.8309 37.0 37.0 37.0 37.0 37.0 100-104 35.70949999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.6736 37.0 37.0 37.0 37.0 37.0 110-114 35.6824 37.0 37.0 37.0 37.0 37.0 115-119 35.7154 37.0 37.0 37.0 37.0 37.0 120-124 35.537200000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.4889 37.0 37.0 37.0 37.0 37.0 130-134 35.2849 37.0 37.0 37.0 32.2 37.0 135-139 35.177099999999996 37.0 37.0 37.0 29.8 37.0 140-144 35.0132 37.0 37.0 37.0 27.4 37.0 145-149 34.58030000000001 37.0 37.0 37.0 25.0 37.0 150-151 34.09675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 0.0 15 2.0 16 1.0 17 2.0 18 1.0 19 2.0 20 2.0 21 4.0 22 4.0 23 4.0 24 6.0 25 6.0 26 5.0 27 18.0 28 24.0 29 22.0 30 21.0 31 45.0 32 65.0 33 114.0 34 227.0 35 615.0 36 2563.0 37 244.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.800000000000004 22.3 10.725 28.175 2 26.85 26.724999999999998 29.9 16.525000000000002 3 21.075 27.55 32.65 18.725 4 24.25 33.575 22.55 19.625 5 24.099999999999998 36.0 22.85 17.05 6 21.4 39.375 21.075 18.15 7 20.325 23.200000000000003 37.55 18.925 8 23.35 23.925 28.625 24.099999999999998 9 21.525 24.85 29.2 24.425 10-14 23.189999999999998 29.265 25.900000000000002 21.645 15-19 23.474999999999998 28.499999999999996 27.12 20.905 20-24 23.025000000000002 28.305000000000003 27.134999999999998 21.535 25-29 23.885 27.6 27.315 21.2 30-34 23.25 28.025 27.04 21.685 35-39 24.005000000000003 28.215 26.845000000000002 20.935000000000002 40-44 23.13 27.395000000000003 27.474999999999998 22.0 45-49 23.244999999999997 28.095 27.73 20.93 50-54 23.165 28.53 27.200000000000003 21.105 55-59 23.89 27.345000000000002 27.255000000000003 21.51 60-64 23.185 27.400000000000002 27.345000000000002 22.07 65-69 24.285 27.92 26.950000000000003 20.845 70-74 24.154999999999998 28.425 27.075 20.345 75-79 24.22 27.894999999999996 26.68 21.205 80-84 24.32 27.589999999999996 26.525 21.565 85-89 24.875 27.205000000000002 27.034999999999997 20.885 90-94 24.705 28.235 26.5 20.560000000000002 95-99 23.825 28.305000000000003 26.88 20.990000000000002 100-104 25.19 28.439999999999998 25.995 20.375 105-109 24.959999999999997 28.455000000000002 26.36 20.225 110-114 26.36 28.08 25.72 19.84 115-119 27.075 28.38 24.990000000000002 19.555 120-124 27.084999999999997 27.67 25.405 19.84 125-129 27.58 27.544999999999998 24.895 19.98 130-134 27.205000000000002 28.134999999999998 25.040000000000003 19.62 135-139 27.450000000000003 27.04 25.89 19.62 140-144 28.585 26.735 25.595000000000002 19.085 145-149 29.404999999999998 26.235000000000003 25.729999999999997 18.63 150-151 30.275000000000002 26.8375 25.587500000000002 17.299999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 2.5 23 1.5 24 1.0 25 2.0 26 2.0 27 2.0 28 1.5 29 2.0 30 8.0 31 15.5 32 18.5 33 30.5 34 37.5 35 52.5 36 79.0 37 97.5 38 119.5 39 148.5 40 183.5 41 209.0 42 231.5 43 258.5 44 271.0 45 269.0 46 281.5 47 282.0 48 247.0 49 207.5 50 167.0 51 128.5 52 121.5 53 107.5 54 88.0 55 71.5 56 58.0 57 43.5 58 24.5 59 31.0 60 30.0 61 20.5 62 11.0 63 4.0 64 3.0 65 3.0 66 1.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 1.5 76 2.5 77 1.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.5 97 0.5 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 82.67570900123305 67.05 2 13.070283600493218 21.2 3 2.9593094944512948 7.199999999999999 4 1.0172626387176327 3.3000000000000003 5 0.21578298397040688 0.8750000000000001 6 0.030826140567200986 0.15 7 0.0 0.0 8 0.0 0.0 9 0.030826140567200986 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 9 0.22499999999999998 No Hit GAAAAGAGCAGTTAAGATTGGTAGGAAAGTGATCGCTGCAGCTGCTGTTA 6 0.15 No Hit TAGAGAATCATTAATCAATGCAGGTGGTATCATTGAGACTTCATTCTCTC 5 0.125 No Hit CTTACCAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCCT 5 0.125 No Hit TGGAATGAGCCAAATATCATTTAGTTCTGATGAGAGCATCTCCCTTAAGA 5 0.125 No Hit CTGAGATTTGCAGAATAAGATATTTTCTTTAGAAATGGGTGTTGTTATTG 5 0.125 No Hit CATCAGTGTTCCCAGCTAGTTCAAGATTGAATCCAGTAAGCTGTCCTGTT 5 0.125 No Hit TGGGTTAGCCCCATCAGCAAACAGGAAGGCAACTGCAGGATTGAAGCTTG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.23750000000000002 0.0 0.0 0.0 0.0 66-67 0.3 0.0 0.0 0.0 0.0 68-69 0.325 0.0 0.0 0.0 0.0 70-71 0.3875 0.0 0.0 0.0 0.0 72-73 0.4375 0.0 0.0 0.0 0.0 74-75 0.5625 0.0 0.0 0.0 0.0 76-77 0.7250000000000001 0.0 0.0 0.0 0.0 78-79 0.8500000000000001 0.0 0.0 0.0 0.0 80-81 1.075 0.0 0.0 0.0 0.0 82-83 1.2375 0.0 0.0 0.0 0.0 84-85 1.6125 0.0 0.0 0.0 0.0 86-87 1.9125 0.0 0.0 0.0 0.0 88-89 2.3625 0.0 0.0 0.0 0.0 90-91 2.8125 0.0 0.0 0.0 0.0 92-93 3.4125 0.0 0.0 0.0 0.0 94-95 4.0875 0.0 0.0 0.0 0.0 96-97 4.5875 0.0 0.0 0.0 0.0 98-99 5.262499999999999 0.0 0.0 0.0 0.0 100-101 5.987500000000001 0.0 0.0 0.0 0.0 102-103 6.9 0.0 0.0 0.0 0.0 104-105 7.9875 0.0 0.0 0.0 0.0 106-107 9.2625 0.0 0.0 0.0 0.0 108-109 9.9375 0.0 0.0 0.0 0.0 110-111 10.962499999999999 0.0 0.0 0.0 0.0 112-113 11.899999999999999 0.0 0.0 0.0 0.0 114-115 12.8 0.0 0.0 0.0 0.0 116-117 13.8 0.0 0.0 0.0 0.0 118-119 14.899999999999999 0.0 0.0 0.0 0.0 120-121 15.7625 0.0 0.0 0.0 0.0 122-123 16.775 0.0 0.0 0.0 0.0 124-125 17.862499999999997 0.0 0.0 0.0 0.0 126-127 18.85 0.0 0.0 0.0 0.0 128-129 20.0 0.0 0.0 0.0 0.0 130-131 21.4 0.0 0.0 0.0 0.0 132-133 22.5625 0.0 0.0 0.0 0.0 134-135 23.575000000000003 0.0 0.0 0.0 0.0 136-137 24.5375 0.0 0.0 0.0 0.0 138-139 25.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGGAT 10 0.006830828 145.0 145 >>END_MODULE Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513544 spots for SRR12670131.sra Written 513544 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra Read 513527 spots for SRR12670131.sra Written 513527 spots for SRR12670131.sra SRR ids: ['SRR12670131.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__8tyjez0 SRR12670131.sra spots: 10270557 blocks: [[1, 513527], [513528, 1027054], [1027055, 1540581], [1540582, 2054108], [2054109, 2567635], [2567636, 3081162], [3081163, 3594689], [3594690, 4108216], [4108217, 4621743], [4621744, 5135270], [5135271, 5648797], [5648798, 6162324], [6162325, 6675851], [6675852, 7189378], [7189379, 7702905], [7702906, 8216432], [8216433, 8729959], [8729960, 9243486], [9243487, 9757013], [9757014, 10270557]] SRR12670131 file size 3468684 SRR12670131 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670131 SRR12670131_1.fastq SRR12670131_2.fastq Input file: SRR12670131_1.fastq Paired file: SRR12670131_2.fastq trimmed: SRR12670131-trimmed-pair1.fastq, SRR12670131-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:52:56 2025 >> started Tue Feb 11 00:53:07 2025 >> done (11.201s) 10270557 read pairs processed; of these: 53 ( 0.00%) short read pairs filtered out after trimming by size control 5911 ( 0.06%) empty read pairs filtered out after trimming by size control 10264593 (99.94%) read pairs available; of these: 2966556 (28.90%) trimmed read pairs available after processing 7298037 (71.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 3 0.00% 21 15 0.00% 22 10 0.00% 23 14 0.00% 24 20 0.00% 25 28 0.00% 26 37 0.00% 27 39 0.00% 28 39 0.00% 29 28 0.00% 30 44 0.00% 31 60 0.00% 32 63 0.00% 33 51 0.00% 34 83 0.00% 35 76 0.00% 36 82 0.00% 37 80 0.00% 38 95 0.00% 39 124 0.00% 40 167 0.00% 41 153 0.00% 42 157 0.00% 43 140 0.00% 44 159 0.00% 45 178 0.00% 46 205 0.00% 47 242 0.00% 48 275 0.00% 49 335 0.00% 50 412 0.00% 51 430 0.00% 52 496 0.00% 53 601 0.01% 54 573 0.01% 55 577 0.01% 56 689 0.01% 57 750 0.01% 58 959 0.01% 59 1118 0.01% 60 1244 0.01% 61 1618 0.02% 62 1709 0.02% 63 1846 0.02% 64 2108 0.02% 65 2184 0.02% 66 2428 0.02% 67 2547 0.02% 68 2920 0.03% 69 3312 0.03% 70 3853 0.04% 71 4548 0.04% 72 5281 0.05% 73 5852 0.06% 74 6267 0.06% 75 6975 0.07% 76 7283 0.07% 77 7890 0.08% 78 8617 0.08% 79 9437 0.09% 80 10606 0.10% 81 11912 0.12% 82 13400 0.13% 83 14676 0.14% 84 15935 0.16% 85 17448 0.17% 86 18218 0.18% 87 18582 0.18% 88 19860 0.19% 89 20479 0.20% 90 22261 0.22% 91 23725 0.23% 92 25545 0.25% 93 27403 0.27% 94 29489 0.29% 95 31145 0.30% 96 31646 0.31% 97 32368 0.32% 98 32430 0.32% 99 33666 0.33% 100 35233 0.34% 101 35262 0.34% 102 36968 0.36% 103 38461 0.37% 104 40139 0.39% 105 41404 0.40% 106 42148 0.41% 107 42252 0.41% 108 42171 0.41% 109 42254 0.41% 110 42647 0.42% 111 43816 0.43% 112 44380 0.43% 113 44956 0.44% 114 46308 0.45% 115 47732 0.47% 116 47869 0.47% 117 49311 0.48% 118 48122 0.47% 119 47535 0.46% 120 48426 0.47% 121 47855 0.47% 122 48476 0.47% 123 49483 0.48% 124 49744 0.48% 125 50248 0.49% 126 50892 0.50% 127 51561 0.50% 128 50440 0.49% 129 50651 0.49% 130 50277 0.49% 131 49820 0.49% 132 50020 0.49% 133 50643 0.49% 134 50392 0.49% 135 51227 0.50% 136 51028 0.50% 137 50829 0.50% 138 50881 0.50% 139 51420 0.50% 140 50436 0.49% 141 50311 0.49% 142 50284 0.49% 143 49649 0.48% 144 51176 0.50% 145 50403 0.49% 146 50589 0.49% 147 50600 0.49% 148 50585 0.49% 149 50242 0.49% 150 50671 0.49% 151 7298037 71.10% 10264593 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=26 prefix-density=0.40 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTA criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=94.06 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=11.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=20 prefix-density=0.85 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.13 sequence-density-rank=28 fanout-score=30.59 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=11.6 sequence=AAAGAAAAGAAAA SRR12670131 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:53:52 Started mapping on | Feb 11 00:53:52 Finished on | Feb 11 00:55:02 Mapping speed, Million of reads per hour | 527.89 Number of input reads | 10264593 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 9560110 Uniquely mapped reads % | 93.14% Average mapped length | 282.28 Number of splices: Total | 9113295 Number of splices: Annotated (sjdb) | 8921950 Number of splices: GT/AG | 8923858 Number of splices: GC/AG | 150870 Number of splices: AT/AC | 5583 Number of splices: Non-canonical | 32984 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234360 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 114653 % of reads mapped to too many loci | 1.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 470123 470123 470123 N_multimapping 234360 234360 234360 N_noFeature 330684 9399393 393031 N_ambiguous 154761 583 56050 UnstrandedReadsAssigned:9074665 PositiveStrandReadsAssigned:160134 NegativeStrandReadsAssigned:9111029 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=132 echo kmer=127 SRR12670131 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670131-trimmed-pair1.fastq SRR12670131-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,264,593 reads, 9,201,727 reads pseudoaligned [quant] estimated average fragment length: 203.141 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,000 rounds 52401 SRR12670131.ke.tsv 34699 SRR12670131.se.tsv 87100 total ==> SRR12670131.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1815.86 256 14.2396 Potri.005G024800.1.v4.1 1035 832.859 85 10.3083 Potri.004G059700.1.v4.1 961 758.901 8 1.06475 Potri.007G009000.2.v4.1 1416 1213.86 0 0 Potri.003G141000.2.v4.1 2943 2740.86 374 13.7824 Potri.016G087400.1.v4.1 270 110.118 327 299.937 Potri.015G069301.1.v4.1 564 368.852 0 0 Potri.010G195200.1.v4.1 1773 1570.86 34 2.18617 Potri.012G127500.1.v4.1 977 774.87 24 3.12841 ==> SRR12670131.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 109 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 166 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12670131 completed mapping pipeline successfully