Starting /dee2/code/volunteer_pipeline.sh SRR12670132 current disk space = 3057062195200 free memory = 1489156064 SRR12670132 SRAfilesize ebe12a5788baf3bdbdb52d90ca7d90ef SRR12670132.sra SRR12670132.sra file validated SRR12670132 is paired end SRR12670132 is conventional basespace SRR12670132 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670132_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.638 37.0 37.0 37.0 37.0 37.0 2 36.5385 37.0 37.0 37.0 37.0 37.0 3 36.666 37.0 37.0 37.0 37.0 37.0 4 36.6685 37.0 37.0 37.0 37.0 37.0 5 36.709 37.0 37.0 37.0 37.0 37.0 6 36.709 37.0 37.0 37.0 37.0 37.0 7 36.723 37.0 37.0 37.0 37.0 37.0 8 36.6885 37.0 37.0 37.0 37.0 37.0 9 36.711 37.0 37.0 37.0 37.0 37.0 10-14 36.6785 37.0 37.0 37.0 37.0 37.0 15-19 36.5986 37.0 37.0 37.0 37.0 37.0 20-24 36.6124 37.0 37.0 37.0 37.0 37.0 25-29 36.5955 37.0 37.0 37.0 37.0 37.0 30-34 36.585699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.5847 37.0 37.0 37.0 37.0 37.0 40-44 36.5168 37.0 37.0 37.0 37.0 37.0 45-49 36.461600000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.4643 37.0 37.0 37.0 37.0 37.0 55-59 36.431799999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.4028 37.0 37.0 37.0 37.0 37.0 65-69 36.3821 37.0 37.0 37.0 37.0 37.0 70-74 36.309999999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.3965 37.0 37.0 37.0 37.0 37.0 80-84 36.3954 37.0 37.0 37.0 37.0 37.0 85-89 36.319 37.0 37.0 37.0 37.0 37.0 90-94 36.323800000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.298700000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.362199999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.3268 37.0 37.0 37.0 37.0 37.0 110-114 36.263 37.0 37.0 37.0 37.0 37.0 115-119 36.2328 37.0 37.0 37.0 37.0 37.0 120-124 36.1722 37.0 37.0 37.0 37.0 37.0 125-129 36.023700000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.93820000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.839099999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.7089 37.0 37.0 37.0 37.0 37.0 145-149 35.539 37.0 37.0 37.0 37.0 37.0 150-151 35.235 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 0.0 24 1.0 25 3.0 26 4.0 27 9.0 28 7.0 29 12.0 30 16.0 31 23.0 32 29.0 33 63.0 34 146.0 35 337.0 36 2914.0 37 434.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.825 11.1 6.15 40.925 2 17.97696544817226 13.219829744616925 37.48122183274912 31.321982974461694 3 17.1 16.5 30.725 35.675000000000004 4 22.5 24.4 23.849999999999998 29.25 5 21.925 31.8 23.825 22.45 6 21.125 33.975 23.575 21.325 7 16.0 26.375 41.05 16.575 8 17.825 25.324999999999996 32.025 24.825 9 17.275 23.5 34.55 24.675 10-14 20.48 28.599999999999998 27.400000000000002 23.52 15-19 20.025000000000002 28.275 27.98 23.72 20-24 21.275 27.38 27.51 23.835 25-29 20.23 28.515 26.979999999999997 24.275 30-34 20.474999999999998 27.405 28.095 24.025 35-39 20.285 28.560000000000002 26.77 24.385 40-44 20.75 28.075 27.58 23.595 45-49 21.060000000000002 28.199999999999996 27.034999999999997 23.705000000000002 50-54 21.3 28.355000000000004 27.065 23.28 55-59 21.105 28.299999999999997 26.945000000000004 23.65 60-64 21.075 28.165000000000003 26.935 23.825 65-69 20.89 28.105000000000004 27.33 23.674999999999997 70-74 21.560000000000002 28.42 27.029999999999998 22.99 75-79 21.565 27.61 27.435 23.39 80-84 21.095 27.98 27.495000000000005 23.43 85-89 21.185000000000002 28.155 26.900000000000002 23.76 90-94 21.88 27.915 26.755000000000003 23.45 95-99 21.535 27.91 27.505000000000003 23.05 100-104 22.1 28.825 25.82 23.255 105-109 21.555 28.634999999999998 26.115 23.695 110-114 21.279999999999998 28.485 26.1 24.135 115-119 22.335 28.15 25.36 24.154999999999998 120-124 21.990000000000002 28.465 25.790000000000003 23.755000000000003 125-129 21.77 27.825 25.955000000000002 24.45 130-134 21.825 28.01 25.865 24.3 135-139 22.52 27.150000000000002 26.290000000000003 24.04 140-144 22.07 27.055 26.384999999999998 24.490000000000002 145-149 23.155 26.939999999999998 25.95 23.955000000000002 150-151 23.2625 26.75 25.900000000000002 24.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 3.0 25 4.0 26 2.0 27 1.0 28 7.0 29 11.0 30 8.0 31 11.5 32 19.0 33 25.0 34 37.5 35 56.0 36 73.0 37 102.5 38 131.5 39 151.5 40 168.5 41 200.5 42 238.0 43 248.0 44 249.0 45 275.5 46 290.0 47 257.0 48 227.5 49 226.5 50 193.0 51 132.5 52 119.5 53 114.0 54 88.5 55 73.5 56 69.5 57 53.0 58 33.0 59 25.5 60 16.5 61 9.0 62 11.0 63 7.5 64 2.0 65 5.0 66 6.0 67 5.5 68 5.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.3 #Duplication Level Percentage of deduplicated Percentage of total 1 83.38396111786149 68.625 2 13.001215066828674 21.4 3 2.703523693803159 6.675000000000001 4 0.6682867557715675 2.1999999999999997 5 0.18226002430133656 0.75 6 0.030376670716889428 0.15 7 0.0 0.0 8 0.030376670716889428 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTGAGAGATCTCGTAT 8 0.2 TruSeq Adapter, Index 25 (97% over 38bp) CTTGCATACTGTGCAGGTGGTTGACCCCCATAGCCAGCTTGGGAAGACGG 6 0.15 No Hit CTCAACTTCTTGACAAAATTCTCCCTGCTTATCTTCTTCTCCCTGAACAG 5 0.125 No Hit GTTCTCTGTAATTGCAAAGTCATGCATCATTATGGGTTCTGATATAGTTA 5 0.125 No Hit GAGGATTATGTCCAAAAACTCATTCCCTGCTTTTGAATCACAAAGCTCTG 5 0.125 No Hit CGGAAATATGATAGAACCCAGTTCAAGATGAAACAACAAAAACTCCACAT 5 0.125 No Hit CTTCAGATTCCATAGAGAACTCCTCTTCATTACCTTCACCGATTGTGGCA 5 0.125 No Hit CATGAGTTGAGTGGTGTTCTTCCATTTTCAGAGCAACACCTGTTTCCTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.21250000000000002 0.0 0.0 0.0 0.0 64-65 0.30000000000000004 0.0 0.0 0.0 0.0 66-67 0.35 0.0 0.0 0.0 0.0 68-69 0.3875 0.0 0.0 0.0 0.0 70-71 0.42500000000000004 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.6499999999999999 0.0 0.0 0.0 0.0 76-77 0.8125 0.0 0.0 0.0 0.0 78-79 0.95 0.0 0.0 0.0 0.0 80-81 1.1375000000000002 0.0 0.0 0.0 0.0 82-83 1.4375 0.0 0.0 0.0 0.0 84-85 1.7 0.0 0.0 0.0 0.0 86-87 2.0625 0.0 0.0 0.0 0.0 88-89 2.5374999999999996 0.0 0.0 0.0 0.0 90-91 2.975 0.0 0.0 0.0 0.0 92-93 3.55 0.0 0.0 0.0 0.0 94-95 4.2375 0.0 0.0 0.0 0.0 96-97 4.8125 0.0 0.0 0.0 0.0 98-99 5.6125 0.0 0.0 0.0 0.0 100-101 6.2375 0.0 0.0 0.0 0.0 102-103 6.875 0.0 0.0 0.0 0.0 104-105 7.9125 0.0 0.0 0.0 0.0 106-107 8.5625 0.0 0.0 0.0 0.0 108-109 9.525 0.0 0.0 0.0 0.0 110-111 10.6375 0.0 0.0 0.0 0.0 112-113 11.5125 0.0 0.0 0.0 0.0 114-115 12.675 0.0 0.0 0.0 0.0 116-117 13.5125 0.0 0.0 0.0 0.0 118-119 14.55 0.0 0.0 0.0 0.0 120-121 15.55 0.0 0.0 0.0 0.0 122-123 16.4875 0.0 0.0 0.0 0.0 124-125 17.275 0.0 0.0 0.0 0.0 126-127 18.0 0.0 0.0 0.0 0.0 128-129 18.825 0.0 0.0 0.0 0.0 130-131 19.8875 0.0 0.0 0.0 0.0 132-133 21.0125 0.0 0.0 0.0 0.0 134-135 21.95 0.0 0.0 0.0 0.0 136-137 22.987499999999997 0.0 0.0 0.0 0.0 138-139 24.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCTTT 10 0.006830828 145.0 1 GAACTCC 65 0.0076375785 13.384615 130-134 CACTCTG 65 0.0076375785 13.384615 140-144 >>END_MODULE SRR12670132 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670132_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3145 37.0 37.0 37.0 37.0 37.0 2 36.2665 37.0 37.0 37.0 37.0 37.0 3 36.3125 37.0 37.0 37.0 37.0 37.0 4 36.3135 37.0 37.0 37.0 37.0 37.0 5 36.3665 37.0 37.0 37.0 37.0 37.0 6 36.3135 37.0 37.0 37.0 37.0 37.0 7 36.343 37.0 37.0 37.0 37.0 37.0 8 36.399 37.0 37.0 37.0 37.0 37.0 9 36.376 37.0 37.0 37.0 37.0 37.0 10-14 36.33539999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.3196 37.0 37.0 37.0 37.0 37.0 20-24 36.297399999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1936 37.0 37.0 37.0 37.0 37.0 30-34 36.2029 37.0 37.0 37.0 37.0 37.0 35-39 36.175200000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1606 37.0 37.0 37.0 37.0 37.0 45-49 36.2231 37.0 37.0 37.0 37.0 37.0 50-54 36.15840000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.135400000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.1137 37.0 37.0 37.0 37.0 37.0 65-69 36.119499999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.0753 37.0 37.0 37.0 37.0 37.0 75-79 36.0106 37.0 37.0 37.0 37.0 37.0 80-84 35.9788 37.0 37.0 37.0 37.0 37.0 85-89 36.0107 37.0 37.0 37.0 37.0 37.0 90-94 35.992399999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.9731 37.0 37.0 37.0 37.0 37.0 100-104 35.928399999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.8221 37.0 37.0 37.0 37.0 37.0 110-114 35.791000000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.797 37.0 37.0 37.0 37.0 37.0 120-124 35.63719999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.545100000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.300799999999995 37.0 37.0 37.0 34.6 37.0 135-139 35.148399999999995 37.0 37.0 37.0 29.8 37.0 140-144 34.9467 37.0 37.0 37.0 25.0 37.0 145-149 34.693 37.0 37.0 37.0 25.0 37.0 150-151 34.44375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 4.0 15 1.0 16 5.0 17 0.0 18 1.0 19 1.0 20 2.0 21 2.0 22 6.0 23 1.0 24 6.0 25 6.0 26 8.0 27 10.0 28 14.0 29 16.0 30 24.0 31 28.0 32 57.0 33 88.0 34 199.0 35 603.0 36 2669.0 37 245.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.425 23.575 9.55 28.449999999999996 2 26.85 24.825 31.5 16.825000000000003 3 20.375 27.3 33.275 19.05 4 23.075000000000003 34.1 22.7 20.125 5 25.224999999999998 36.125 21.375 17.275 6 22.375 38.3 22.650000000000002 16.675 7 22.5 21.4 36.7 19.400000000000002 8 22.45 25.775 28.000000000000004 23.775 9 23.95 23.849999999999998 29.549999999999997 22.650000000000002 10-14 23.84 30.06 25.525 20.575 15-19 23.32 27.71 27.389999999999997 21.58 20-24 23.145 28.29 27.155 21.41 25-29 23.7 28.315 26.795 21.19 30-34 23.95 27.615000000000002 27.52 20.915 35-39 23.415 27.389999999999997 27.839999999999996 21.355 40-44 22.99 27.925 27.395000000000003 21.69 45-49 23.015 27.62 27.715 21.65 50-54 23.865 27.12 27.779999999999998 21.235 55-59 22.97 27.175 27.750000000000004 22.105 60-64 23.175 27.755000000000003 27.950000000000003 21.12 65-69 24.2 27.839999999999996 26.825 21.135 70-74 23.200000000000003 27.810000000000002 27.625 21.365000000000002 75-79 23.77 27.045 27.665 21.52 80-84 24.48 27.975 26.545 21.0 85-89 24.43 28.07 26.445 21.055 90-94 24.05 28.09 26.16 21.7 95-99 25.124999999999996 27.994999999999997 26.415 20.465 100-104 25.155 27.665 26.419999999999998 20.76 105-109 25.679999999999996 27.825 26.395000000000003 20.1 110-114 26.215 28.04 26.095000000000002 19.650000000000002 115-119 26.8 28.21 26.095000000000002 18.895 120-124 27.785 28.000000000000004 25.205 19.009999999999998 125-129 28.575 27.195000000000004 25.77 18.459999999999997 130-134 29.544999999999998 27.334999999999997 24.965 18.154999999999998 135-139 29.825000000000003 27.215 25.314999999999998 17.645 140-144 31.025000000000002 26.21 24.595 18.17 145-149 32.910000000000004 25.195 24.815 17.080000000000002 150-151 34.449999999999996 24.7875 24.4125 16.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 1.0 9 1.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 2.0 17 1.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 1.0 24 0.5 25 1.0 26 1.5 27 4.5 28 5.0 29 4.0 30 8.5 31 15.5 32 16.0 33 19.5 34 32.0 35 42.0 36 59.5 37 95.5 38 132.0 39 162.0 40 189.0 41 228.5 42 254.5 43 266.5 44 287.5 45 282.5 46 262.5 47 250.0 48 221.5 49 199.5 50 187.5 51 165.0 52 125.0 53 92.0 54 83.5 55 66.5 56 50.0 57 35.5 58 27.0 59 23.0 60 16.5 61 12.0 62 12.0 63 8.5 64 4.0 65 2.0 66 2.5 67 3.5 68 1.5 69 1.5 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 1.0 91 1.5 92 1.0 93 0.5 94 0.5 95 0.5 96 0.5 97 3.0 98 2.5 99 1.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.5 #Duplication Level Percentage of deduplicated Percentage of total 1 83.66666666666667 69.025 2 12.848484848484848 21.2 3 2.5757575757575757 6.375 4 0.6060606060606061 2.0 5 0.21212121212121215 0.8750000000000001 6 0.06060606060606061 0.3 7 0.0 0.0 8 0.0 0.0 9 0.030303030303030304 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CATACTCCTTCATATGGAGCTCAAGCAGATTCAGCTCAAGGTTCATCTCA 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit GGGCTTTGTTCATAGAAAAAAAGGCATAAAAACAGCAAAGATGAATCACT 5 0.125 No Hit AAAAGACTAAAACATTCTTTCACTGCTCATCCAAAGGTGGATCCATTCAC 5 0.125 No Hit CTTCAATCGTAAATCACAAATACATACACGTTTACTCATCAGCTCGAAAA 5 0.125 No Hit CTTTAACTATCCTGCTGGTTTCTGTGATCACATCTACTTCTACAGCTGCC 5 0.125 No Hit CTTCATGCTTCTTGCACCACCATGCACTAACCACTCCTGCTAGATCAACC 5 0.125 No Hit GTGAGTCTCGGAAAATCCCCTTCATACAAGGAAGTAGCATTGGCCCCACC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.21250000000000002 0.0 0.0 0.0 0.0 64-65 0.30000000000000004 0.0 0.0 0.0 0.0 66-67 0.35 0.0 0.0 0.0 0.0 68-69 0.3875 0.0 0.0 0.0 0.0 70-71 0.42500000000000004 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.6499999999999999 0.0 0.0 0.0 0.0 76-77 0.8125 0.0 0.0 0.0 0.0 78-79 0.95 0.0 0.0 0.0 0.0 80-81 1.1375000000000002 0.0 0.0 0.0 0.0 82-83 1.4625 0.0 0.0 0.0 0.0 84-85 1.725 0.0 0.0 0.0 0.0 86-87 2.125 0.0 0.0 0.0 0.0 88-89 2.6375 0.0 0.0 0.0 0.0 90-91 3.075 0.0 0.0 0.0 0.0 92-93 3.65 0.0 0.0 0.0 0.0 94-95 4.3375 0.0 0.0 0.0 0.0 96-97 4.9125 0.0 0.0 0.0 0.0 98-99 5.7125 0.0 0.0 0.0 0.0 100-101 6.35 0.0 0.0 0.0 0.0 102-103 7.05 0.0 0.0 0.0 0.0 104-105 8.1125 0.0 0.0 0.0 0.0 106-107 8.7875 0.0 0.0 0.0 0.0 108-109 9.7625 0.0 0.0 0.0 0.0 110-111 10.9 0.0 0.0 0.0 0.0 112-113 11.8 0.0 0.0 0.0 0.0 114-115 12.975 0.0 0.0 0.0 0.0 116-117 13.8125 0.0 0.0 0.0 0.0 118-119 14.8625 0.0 0.0 0.0 0.0 120-121 15.8625 0.0 0.0 0.0 0.0 122-123 16.825 0.0 0.0 0.0 0.0 124-125 17.625 0.0 0.0 0.0 0.0 126-127 18.35 0.0 0.0 0.0 0.0 128-129 19.175 0.0 0.0 0.0 0.0 130-131 20.2625 0.0 0.0 0.0 0.0 132-133 21.3875 0.0 0.0 0.0 0.0 134-135 22.325 0.0 0.0 0.0 0.0 136-137 23.375 0.0 0.0 0.0 0.0 138-139 24.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTACACA 10 0.006830828 145.0 2 AAGAGTG 65 0.0076375785 13.384615 135-139 AGGGAAA 65 0.0076375785 13.384615 130-134 >>END_MODULE Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra Read 467223 spots for SRR12670132.sra Written 467223 spots for SRR12670132.sra Read 467204 spots for SRR12670132.sra Written 467204 spots for SRR12670132.sra SRR ids: ['SRR12670132.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w82lnzhg SRR12670132.sra spots: 9344099 blocks: [[1, 467204], [467205, 934408], [934409, 1401612], [1401613, 1868816], [1868817, 2336020], [2336021, 2803224], [2803225, 3270428], [3270429, 3737632], [3737633, 4204836], [4204837, 4672040], [4672041, 5139244], [5139245, 5606448], [5606449, 6073652], [6073653, 6540856], [6540857, 7008060], [7008061, 7475264], [7475265, 7942468], [7942469, 8409672], [8409673, 8876876], [8876877, 9344099]] SRR12670132 file size 3155114 SRR12670132 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670132 SRR12670132_1.fastq SRR12670132_2.fastq Input file: SRR12670132_1.fastq Paired file: SRR12670132_2.fastq trimmed: SRR12670132-trimmed-pair1.fastq, SRR12670132-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:16:57 2025 >> started Tue Feb 11 01:17:07 2025 >> done (10.391s) 9344099 read pairs processed; of these: 50 ( 0.00%) short read pairs filtered out after trimming by size control 8269 ( 0.09%) empty read pairs filtered out after trimming by size control 9335780 (99.91%) read pairs available; of these: 2691945 (28.83%) trimmed read pairs available after processing 6643835 (71.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 6 0.00% 21 5 0.00% 22 7 0.00% 23 15 0.00% 24 17 0.00% 25 28 0.00% 26 39 0.00% 27 40 0.00% 28 42 0.00% 29 51 0.00% 30 64 0.00% 31 52 0.00% 32 63 0.00% 33 73 0.00% 34 60 0.00% 35 100 0.00% 36 76 0.00% 37 96 0.00% 38 111 0.00% 39 109 0.00% 40 161 0.00% 41 157 0.00% 42 176 0.00% 43 156 0.00% 44 188 0.00% 45 212 0.00% 46 197 0.00% 47 260 0.00% 48 330 0.00% 49 335 0.00% 50 461 0.00% 51 526 0.01% 52 563 0.01% 53 626 0.01% 54 649 0.01% 55 704 0.01% 56 734 0.01% 57 834 0.01% 58 993 0.01% 59 1196 0.01% 60 1431 0.02% 61 1619 0.02% 62 1800 0.02% 63 2021 0.02% 64 2114 0.02% 65 2147 0.02% 66 2407 0.03% 67 2778 0.03% 68 3124 0.03% 69 3480 0.04% 70 4113 0.04% 71 4577 0.05% 72 5543 0.06% 73 6057 0.06% 74 6614 0.07% 75 6994 0.07% 76 7602 0.08% 77 7988 0.09% 78 8568 0.09% 79 9585 0.10% 80 10360 0.11% 81 11847 0.13% 82 13349 0.14% 83 14582 0.16% 84 16266 0.17% 85 17344 0.19% 86 17961 0.19% 87 18278 0.20% 88 19403 0.21% 89 20113 0.22% 90 21421 0.23% 91 22832 0.24% 92 24375 0.26% 93 26313 0.28% 94 27912 0.30% 95 29480 0.32% 96 30504 0.33% 97 31390 0.34% 98 31053 0.33% 99 31338 0.34% 100 32790 0.35% 101 33243 0.36% 102 34937 0.37% 103 36234 0.39% 104 37600 0.40% 105 39359 0.42% 106 39427 0.42% 107 39394 0.42% 108 39306 0.42% 109 39099 0.42% 110 38695 0.41% 111 39572 0.42% 112 40692 0.44% 113 41625 0.45% 114 42613 0.46% 115 43235 0.46% 116 44255 0.47% 117 44066 0.47% 118 44080 0.47% 119 42962 0.46% 120 42794 0.46% 121 42891 0.46% 122 43072 0.46% 123 43821 0.47% 124 44438 0.48% 125 45332 0.49% 126 45452 0.49% 127 45421 0.49% 128 44811 0.48% 129 43926 0.47% 130 44370 0.48% 131 42843 0.46% 132 43398 0.46% 133 43799 0.47% 134 43939 0.47% 135 44777 0.48% 136 44617 0.48% 137 44533 0.48% 138 44233 0.47% 139 44618 0.48% 140 43209 0.46% 141 43457 0.47% 142 43324 0.46% 143 43063 0.46% 144 43921 0.47% 145 43701 0.47% 146 43753 0.47% 147 43514 0.47% 148 44336 0.47% 149 42470 0.45% 150 43725 0.47% 151 6643835 71.17% 9335780 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=27 prefix-density=0.52 prefix-fanout=2.0 sequence=TGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTGTAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=106.48 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=3.0 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=0.97 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=16.30 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.2 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12670132 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:17:51 Started mapping on | Feb 11 01:17:51 Finished on | Feb 11 01:18:52 Mapping speed, Million of reads per hour | 550.96 Number of input reads | 9335780 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 8662059 Uniquely mapped reads % | 92.78% Average mapped length | 281.69 Number of splices: Total | 7915206 Number of splices: Annotated (sjdb) | 7749914 Number of splices: GT/AG | 7762129 Number of splices: GC/AG | 121293 Number of splices: AT/AC | 4993 Number of splices: Non-canonical | 26791 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264942 % of reads mapped to multiple loci | 2.84% Number of reads mapped to too many loci | 56723 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.63% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 408779 408779 408779 N_multimapping 264942 264942 264942 N_noFeature 251339 8521571 307578 N_ambiguous 139707 529 55117 UnstrandedReadsAssigned:8271013 PositiveStrandReadsAssigned:139959 NegativeStrandReadsAssigned:8299364 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=131 echo kmer=127 SRR12670132 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670132-trimmed-pair1.fastq SRR12670132-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,335,780 reads, 8,384,452 reads pseudoaligned [quant] estimated average fragment length: 204.394 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 994 rounds 52401 SRR12670132.ke.tsv 34699 SRR12670132.se.tsv 87100 total ==> SRR12670132.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1814.61 340 20.4835 Potri.005G024800.1.v4.1 1035 831.606 108 14.1976 Potri.004G059700.1.v4.1 961 757.656 14 2.02006 Potri.007G009000.2.v4.1 1416 1212.61 0 0 Potri.003G141000.2.v4.1 2943 2739.61 274.758 10.964 Potri.016G087400.1.v4.1 270 111.03 445.576 438.723 Potri.015G069301.1.v4.1 564 367.897 0 0 Potri.010G195200.1.v4.1 1773 1569.61 30 2.08948 Potri.012G127500.1.v4.1 977 773.634 434 61.3285 ==> SRR12670132.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 680 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 143 Potri.001G212900.v4.1 312 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12670132 completed mapping pipeline successfully